Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Dec 6.
Published in final edited form as: J Mol Biol. 2019 Oct 16;431(24):4993–5003. doi: 10.1016/j.jmb.2019.09.007

The Hsp90 Molecular Chaperone Regulates the Transcription Factor Network Controlling Chromatin Accessibility

Zlata Gvozdenov 1,2, Lindsey D Bendix 1, Janhavi Kolhe 1, Brian C Freeman 1,*
PMCID: PMC6983977  NIHMSID: NIHMS1544328  PMID: 31628945

SUMMARY

Genomic events including gene regulation and chromatin status are controlled by transcription factors. Here we report that the Hsp90 molecular chaperone broadly regulates the transcription factor protein family. Our studies identified a biphasic use of Hsp90 in which early inactivation (15 min) of the chaperone triggered a wide reduction of DNA binding events along the genome with concurrent changes to chromatin structure. Long-term loss (6 h) of Hsp90 resulted in a decline of a divergent yet overlaying pool of transcription factors that produced a distinct chromatin pattern. Although both phases involve protein folding, the early point correlated with Hsp90 acting in a late folding step that is critical for DNA binding function whereas prolonged Hsp90 inactivation led to a significant decrease in the steady-state transcription factor protein levels. Intriguingly, despite the broad chaperone-impact on a variety of transcription factors, the operational influence of Hsp90 was at the level of chromatin with only a mild effect on gene regulation. Thus, Hsp90 selectively governs the transcription factor process overseeing local chromatin structure.

Graphical Abstract

graphic file with name nihms-1544328-f0001.jpg

INTRODUCTION

Chromatin is an amalgam of DNA, RNA, and protein that serves to condense genomes into suitable packages to fit within nuclei, protect the DNA from damage, yet still provide ready access to the underlying genomic information1. At its foundation, chromatin is built with nucleosomes where the DNA is wrapped around histone octamers. The placement, density, and configuration of nucleosomes are dictated by the vast array of transcription factors that are expressed within a given cell2. Transcription factors are advantageous for governing large multifarious chromatin structures requiring exact assemblage since transcription factors selectively recognize cognate DNA motifs (driving precision) and are able to interact with a broad array of cofactors including numerous chromatin modifying complexes (providing a breadth of outcomes). The core principle enabling the prominent nuclear role played by transcription factors in both gene regulation and chromatin architecture is a select yet dynamic DNA binding function that enables effective responses to ever fluctuating physiological conditions encountered by cells.

Historically, transcription factors were considered any protein capable of influencing gene expression levels3. In general, a transcription factor exacts control over a gene by binding to a cognate DNA motif (consensus element) found at or near the locus start site. Once DNA-bound the transcription factor nucleates a series of cofactors (e.g., histone acetyltransferases, chromatin remodelers, mediator) to generate the needed changes to the transcription rate of a given target. In addition to gene regulation, it is now evident that transcription factors also perform other duties along the genome including the regulation of chromatin structure. Paralleling gene regulatory events, transcription factors influence the status of chromatin by recognizing cognate DNA elements and recruiting a series of cofactors to influence both the local and global architecture2. While it is unclear what determines whether a transcription factor mediates gene- and/or chromatin-regulatory events at a given DNA site, it is apparent that transcription factors are the keystone components of genomic pathways. Despite the pivotal roles played by transcription factors, the cellular process enabling the functionality of the heterogeneous transcription factor protein family is poorly understood.

Although transcription factors have the common ability to modulate gene promoter activities, the protein family does not share a common domain-structure or even a conserved amino acid motif. Rather, numerous polypeptide folds are utilized to oversee cellular gene programs. For instance, DNA binding domains (DBDs) use a variety of forms including basic helix-loop-helix (bHLH), zinc finger, Myb-like, homeodomain, basic leucine zipper (bZIP) as well as other types3. The complexity of the transcription factor family is expanded by variances within the amino acid sequences of the different folds. For example, single residue changes within an alpha helix of a bHLH domain can account for the recognition of vastly different cognate DNA elements3. Even with these differences the functional goal of any DBD is the same—to selectively bind DNA. How such a structurally diverse protein family is effectively managed to reach a singular end point is unclear.

We believe the Hsp90 molecular chaperone oversees the sizeable transcription factor protein family. Hsp90 was initially identified as a stable component of various steroid aporeceptor transcription factor complexes4. While early work implied the interaction was required to maintain the solubility and functionality of the hormone binding domain, more recent work suggests Hsp90 modulates the DNA binding activity of steroid receptors though direct evidence is lacking5. However, Hsp90 has been shown to support the DNA binding activities of certain bHLH factors, including MyoD and the Dioxin receptor, along with the Greek-key β-sandwich DBD of p53 6,7,8,9,10 Whether Hsp90 influences other types of DBD-folds is not clear. Perhaps notably, Hsp90 has long been regarded as an epigenetic factor and a broad regulatory role with DNA binding proteins might explain why Hsp90 impairment has been linked to enigmatic genomic events including aneuploidy and long-term phenotypic variation 11,12,13 Here, we explored the influence of Hsp90 on local chromatin structure as well as the DNA binding factors working along the genome.

RESULTS

Chromatin accessibility displays temporal changes following loss of Hsp90

To investigate the dependence of chromatin structure on Hsp90 we exploited budding yeast engineered to express either the wild type (WT) or the temperature sensitive (ts) variant G170D as its sole source of Hsp90 in conjunction with high throughput sequencing of DNase I treated nuclei (DNase-Seq) 14,15 Use of the ts allele avoids off-pathway complications associated with Hsp90 inhibitors and DNase-Seq permits an assessment of DNA binding activities (DNA footprints) in addition to evaluating local chromatin architecture16. We previously used this tactic to discover that Hsp90 regulates the Remodel the Structure of Chromatin (RSC) nucleosome-remodeling complex17. In our prior work we probed the local chromatin structure following a short-term (15 min) inactivation of Hsp9017. Under these conditions DNase I cleavage levels were enhanced at RSC-dependent sites since Hsp90 terminates RSC action (i.e., dissociates the nucleosome-bound complex)17. However, further analysis of this DNase-Seq dataset revealed that at RSC-independent sites there was a general reduction in the status of open chromatin with an ~15% decrease in the number of DNase I hypersensitive sites (DHSs) contributing to an ~13% decline in the total length of open chromatin across the genome (Figure 1A; Table S1). Hence, the main feature triggered by the loss of Hsp90 is a reduction in DNA access (i.e., chromatin openness) indicating that Hsp90 contributes to other chromatin-associated activities besides RSC.

Figure 1. Chromatin architecture is Hsp90-dependent.

Figure 1.

(A) Chromatin access was probed by DNase I cleavage in yeast expressing Hsp90 wild type (WT) or the temperature sensitive allele G170D following incubation at 37°C for 15 min17 A representative section of the genome is shown with the pink arrows demarking DHSs with increased hypersensitivity and blue arrows marking reduced DHSs following loss of Hsp90 in the G170D strain. (B) The pattern of DHSs changed following long-term (6 h) inactivation of Hsp90. The blue bar represents DHSs unique to WT, the grey/white bars are the overlapping DHSs, and the bronze bar are the DHSs unique to G170D after 6 h at 37°C. (C) The local chromatin structure was distinct after long-term (6 h) Hsp90 inactivation. A representative section of the genome is shown with the blue arrows marking DHSs with reduced length and/or hypersensitivity after 6 h at 37°C in G170D.

To expand our evaluation we checked the chromatin structure following a prolonged inactivation of Hsp90 (6 h). We selected the 6 h point since it was the longest Hsp90-inactivation time at which the growth of G170D yeast continued and was fully recovered following a shift back to a permissive temperature (30°C) indicating that no permanent damage to cell viability had occurred (Figure S1A). Overall, the chromatin displayed a further reduction in accessibility relative to the 15 min treatment as there was an ~17% reduction in the total length of open chromatin after 6 h at 37°C in G170D expressing yeast compared to WT Hsp90 (Figure 1B and Table S1). In contrast to the 15 min time point, sites where DNA accessibility significantly increased (e.g., RSC-associated sites) were not common after 6 h of Hsp90 loss (Figure 1A and 1C). Yet, when comparing cells expressing WT Hsp90 vs. G170D the total number of DHSs increased slightly as G170D had ~9% less DHSs than WT Hsp90 at 6 h whereas the decline was ~13% at 15 min (Table S1). However, the rise in the number of DHSs mainly stemmed from the “splitting” of peaks (i.e., one large peak in WT deteriorated into two or more smaller peaks) as well as a general loss of weak DHSs in both WT and G170D cells incubated at 37°C for 6 h rather than from the emergence of d e novo open chromatin sites.

As nucleosome density/positioning typically dictates DNA accessibility, we checked the nucleosome status at two DHSs found to be impacted after 6 h of Hsp90 inactivation by DNase-Seq (Figure 2C). Here, we used the small molecule inhibitor Radicicol as an alternative means to inactivate Hsp90 and used an established PCR-based MNase-mapping assay17 to assess the nucleosome conditions at these loci. At both sites the apparent nucleosome density was increased thereby justifying why DNA accessibility declined (Figure 2C and Figure S1B).

Figure 2. Loss of Hsp90 correlates with a decline in DNA footprints.

Figure 2.

(A) The total number of DNA footprints in yeast expressing WT or G170D was determined after 15 min or 6 h incubation at 37°C, as marked. The Venn diagrams indicate the absolute overlap in the number of DNA motif types independent of exact location (Numbers in Black are for WT while those in red are for G170D). DNA footprints were detected within computed DHSs using the DNase2TF (fdr 0.01) algorithm (20). (B) The DNA footprint pattern altered significantly following loss of Hsp90. The DNase I cleavage levels at representative sites, either Chromosome X 115,000–118,000 bp or Chromosome IV 129,000–131,500 bp, are shown along with the detected DNA footprints. DNA motifs corresponding to known consensus elements were identified with RSA-tools using frequency matrices obtained from JASPAR that are marked accordingly as well as the open reading frames (ORFs)21,22.

Of note, the previously described RSC-associated DHSs with increased hypersensitivity at 15 min of Hsp90-inactivation were no longer detected after 6 h at 37°C (Figure S2A)17 Whether the loss is Hsp90-dependent, however, is not clear since these DHSs also dissipated in the WT background following 6 h at 37°C (Figure S2A). Besides the RSC-sites we observed other chromatin changes linked to the prolonged incubation at 37°C including a rise in DHSs at subt elomeric regions, tRNA genes, and Long Terminal Repeats (LTRs) (Figures S2B and S2C; Table S2). These chromatin alterations are consistent with prior studies showing that environmental changes including increased temperature reduce subtelomeric gene silencing and increase transcription at LTR-retrotransposons18,19. Nevertheless, the general trend following Hsp90 inactivation is a decline in chromatin accessibility.

Chromatin changes correlate with declined transcription factor DNA occupancies

In addition to revealing local chromatin structure, DNase-Seq is useful for detecting short protected DNA sites within DNase I hypersensitivity sites (i.e., DNA footprints). In conjunction with a DNA-motif scan the transcription factors bound within DHSs can be identified based upon homology to established cognate binding elements (i.e., consensus sequences)16,20. A genome-wide digital footprint analysis of the 15 min and 6 h datasets showed that the reduction in open chromatin following Hsp90 inactivation correlated with a decline in DNA bound proteins (Figures 2 and S3). While the total number of identified DNA footprints varied depending upon the computational program used, the trends were consistent with ~33% less occupied DNA motifs after 15 min of Hsp90 inactivation and ~25% less after 6 h (Figures 2 and S3). Briefly, the 3 programs we employed vary the footprint detection algorithms and computing depth thereby leading to different numbers of occupied DNA footprints16,20,23. Nevertheless, the trends and overlap (~85%) in the computed footprints with respect to the founding digital footprinting program16 indicated a consistent decline in bound transcription factors following the loss of the Hsp90 (Figure S3).

To investigate the impact of Hsp90 on DNA binding events we focused on the computational findings revealed using the DNase2TF program with a 1% false discovery rate (0.01 fdr) since this tactic produced the highest potential coverage of DNA footprints20. With these criteria, 84077 footprints were detected in yeast expressing WT Hsp90 grown for 15 min at 37°C and 55 272 in yeast with G170D whereas 45019 footprints were identified in WT after 6 h at 37°C but only 33585 were found in G170D (Figure 2A). Paralleling the chromatin affects an influence of prolonged incubation at 37°C was apparent even in yeast expre ssing WT Hsp90. Yet at both time points a significant Hsp90-dependent effect was apparent since there was a ~35% decline in footprints at 15 min and ~26% after 6 h. When a more in-depth evaluation was performed where motif locations were followed, it was evident that ~55% of the WT footprints were lost following Hsp90 inactivation at either time point but that the emergence of new footprints in G170D buffered the decline in total numbers (Figure 2A). For example, 17896 footprints arise along the genome in G170D after 15 min at 37°C and these G170D-specific binding events essentially veil the apparent decline in total footprints (Figure 2A and Table S3).

To illustrate these convoluted changes, we show discreet areas of chromosome X and IV that displayed typical alterations in the DNA footprint patterns occurring after 6 h of Hsp90 loss (Figure 2B). At both sections it is evident that all footprints, ones corresponding to identified cognate motifs as well sites bound by unidentified factors, were reduced in the G170D background and that the occupied consensus elements changed. Importantly, these were not isolated examples. If we evaluate the detected DNA footprints along a larger tract of DNA (chromosome I between bases 120,000 and 180,000) we found that a distinct set of DNA binding activities are apparent under each experimental condition with Hsp90 loss drove a decline of DNA footprints at either 15 min or 6 h (Figures 3A and S4A; Table S4). Within this region the total number of occupied consensus elements was 327 for WT 15 min, 201 for G170D 15 min, 265 for WT 6 h, and 160 for G170D 6 h and each time point displayed a distinct set of DNA binding activities (Figure S4A). Of note, the pattern of occupied DNA sites varied between the 15 min and 6 h time points suggesting that the impact of Hsp90 inactivation shifted with time.

Figure 3. Protein-DNA binding patterns shift at 37°C with an Hsp90-dependency.

Figure 3.

DNA footprints were detected using DNase-Seq and RSA-tools in yeast expressing WT or G170D Hsp90 incubated 15 min or 6 h at 37°C. (A) DNA footprints on Chromosome I between 120,000–180,000 bp were determined by DNase-Seq using DNase2TF (fdr 0.01) from yeast expressing WT or G170D Hsp90 incubated at 37°C for 15 min or 6 h. The total number of footprints in this region was 327 for WT 15 min, 201 for G170D 15 min, 265 for WT 6 h, and 160 for G170D 6 h. The pattern of overlap is shown in (A) using Cytoscape. The actual identified DNA footprints are listed in Table S4 indexed as a-series for WT 15 min, b-series for G170D 15 min, c-series for WT 6 h and d-series for G170D 6 h at 37°C. (B) The genome-wide occupancies of consensus motifs generally declined in the absence of Hsp90 activity (i.e., G170D background). For illustrative purposes all consensus motifs were graphed in order of binding usage observed in the WT 15 min sample and the actual numbers and motifs are shown in Table S3.

Extending our analysis to a genome-wide view revealed that the occupancy of 32 of 164 consensus motifs declined (count in G170D was 75% or less relative to WT Hsp90) after 15 min of Hsp90 inactivation and that 61 were down after 6 h (Figures 3B and S4B; Table S4). As before, there were considerable changes in the pattern of transcription factor binding, which resulted in a low overlap with only ~7% (5660 of the 84077) of the sites found in the WT 15 min being occupied in the other 3 datasets (Table S5). Regardless of whether a cognate binding partner was known for a DNA motif or not, Hsp90 inactivation reduced the occupancy of all DNA binding activities (Figure 3B and S4B). A two-tailed statistical test on the 6 h datasets indicated a significant difference (P value = 0.0493) across all sites. The 15 min data was not as straightforward since not all sites show a change, yet if the top 96 motifs (164 total) were considered a difference was apparent (P value = 0.0094). Given that only a small percent (~18%) of the observed DNA footprints align with the known consensus motifs (Figure S4B)22, these observations are notable since it indicates that Hsp90 has a general role in promoting all cellular DNA binding factors.

Hsp90 supports transcription factor protein stability and DNA binding

Hsp90 is a central component of the cellular molecular chaperone system and is known to maintain the stability of labile proteins4. As such, a probable mechanism driving the broad reach of Hsp90 in DNA binding events is the maintenance of steady-state protein levels. To check this possibility we followed transcription factors displaying reduced DNA footprints at 15 min (Cbf1), at 6 h (Abf1, Reb1, Rsc3), or at both 15 min and 6 h (Ecm22, Ino2, Ino4, Mcm1, Rap1). Interestingly, only Mcm1 showed a reduction in protein levels at the 15 min time point but all except Cbf1 showed reduced protein amounts by 6 h of Hsp90 loss (Figure 4A). We validated these findings using the Hsp90 inhibitor Radicicol and the transcription factors Abf1, Ino2/4, Rap1 (Figure 4B). Hence, Hsp90 is broadly used to support long-term (6 h) transcription factor protein stability in budding yeast (Figure 4A and 4B).

Figure 4. Transcription factor protein stability and activation of DNA binding activity are Hsp90-dependent.

Figure 4.

(A) The steady-state protein levels of the indicated transcription factors were visualized by immunoblot analysis from yeast expressing WT or G170D Hsp90 grown at 30°C (0) or 37°C for 15 min or 6 h, as marked. All transcription factors were TAP-tag fusions detected using an anti-TAP antibody. (B) The steady-state protein levels of the indicated TAP-tagged transcription factors were visualized by immunoblot analysis from yeast untreated or treated for 15 or 360 min with either DMSO or Radicicol (20 μM), as indicated. (C) The steady-state protein levels of the c-Myc, Hsf1, and GATA5 transcription factors in the mouse fibroblast cell line 3T3 grown in the absence or presence of radicicol (10 μM) were determined by immunoblot analysis using antibodies select for each factor. (D) The DNA binding activities of recombinant Rap1 (250 pM), Cbf1 (1 nM), Abf1 (100 nM), and Met31 (1 μM) were determined by EMSA using radiolabeled cognate consensus element for each factor alone or in the presence of increasing amounts of recombinant yeast Hsp90 (4, 12, and 34 μM) and total protein amounts were balanced with BSA. (E) The DNA binding activities of Ino2 (1.25 μM), Ino4 (1.25 μM), and Ino2/Ino4 (300 nM) was determined by EMSA using a radiolabeled consensus element alone or in the presence of increasing amounts of recombinant yeast Hsp90 (4, 12, and 34 μM) with total protein amounts being balanced with BSA. The specificity of Ino2/Ino4 was assessed using radiolabeled probes representing consensus elements for Ino2/4, Mcm1, Rap1, or Abf1, as marked.

We checked whether the ability of Hsp90 to protect transcription factors is conserved. We treated 3T3 mouse fibroblast cells with the Hsp90 inhibitor radicicol and monitored the levels of c-Myc, HSF1, and GATA5. In the presence of radicicol the levels of all the transcription factors declined (Figure 4C). While the conserved ability of Hsp90 to maintain protein stability can explain why DNA binding events were reduced after 6 hours of Hsp90 inactivation, why DNA occupancies declined after only 15 min of Hsp90 loss was not apparent since steady-state levels remain constant at the early time point.

Prior studies showed that Hsp90 can ‘activate’ the DNA binding activities of the muscle specific basic helix-loop-helix (bHLH) transcription factors MyoD and E126,8. We investigated whether Hsp90 might broadly influence the DNA binding functions of transcription factors irrespective of the type of DBD fold. We selected 9 potential targets that displayed reduced DNA footprints following Hsp90 inactivation (Table S3). These transcription factors contain bHLH (Cbf1, Ino2, Ino4), zinc finger (Abf1, Met31, Rsc3, Rsc30), or Myb-like (Rap1, Reb1) DNA binding domains.

We purified each from Escherichia coli as SUMO-fusion proteins thereby avoiding exposure to a eukaryotic Hsp90 homolog and then tested the capacity of each to bind to their cognate DNA element alone or in the presence of increasing levels of yeast Hsp90 (Figure 4D, 4E, and S5). With the exception of Reb1 (Figure S5B), all of the transcription factors required exposure to yeast Hsp90 in order bind to their consensus DNA motifs. Addition of Radicicol to the preformed transcription factor-DNA complexes had no apparent effect suggesting Hsp90 is only transiently needed to establish the DNA binding activities (Figure S5C). Of note, Ino2 and Ino4 work as a heterodimer and the Hsp90 effect was most apparent when both Ino2/Ino4 were present in the reaction along with a consensus DNA element (Figure 4E). Hence, Hsp90 serves a broad spectrum of transcription factors with varying types of DNA binding domains. Likely, the capacity of Hsp90 to ‘activate’ DNA binding proteins is indicative of Hsp90’s ability to mediate a late step in a protein folding pathway (i.e., these factors were isolated as soluble folded proteins from E. coli).

Hsp90-dependent gene expression changes

The wide influence of Hsp90 on both transcription factors and DNase hypersensitivity sites prompted the logical speculation that Hsp90 inactivation would trigger significant changes in gene expression. To investigate this point, we isolated RNA from cells expressing wild type or G170D Hsp90 grown at 37°C for 6 h and performed RNA-Seq. Computational analysis indicated that only 113 genes were upregulated (GFold log2≥1.5) and 152 genes were downregulated (GFold log2≤−1.5) demonstrating an unexpectedly mild influence of Hsp90 loss on gene expression (Table S6). The majority of the genes with altered expression also displayed chromatin changes by the 6 h treatment time point with the activated genes having increased chromatin accessibility and the repressed loci displaying declined access (Figure 5 and Table S7).

Figure 5. Loci displaying changes in gene expression also have altered chromatin accessibility following Hsp90 inactivation.

Figure 5.

Venn diagrams depicting the overlap between sites with altered chromatin structure (gain or loss of DHS size) at 15 min or 6 h and changed gene expression (GFold log21.5)24 is shown.

Thus, the primary outcome of Hsp90’s influence over transcription factor stability/activity was altered chromatin accessibility (Figure 1). Likely, the inherent specificity of the transcription process (i.e., higher affinity DNA binding elements being used to regulate gene activity) limits the impact on gene regulation whereas the flexibility of chromatin maintenance allows Hsp90-dependent fluctuations to be tolerated. It is plausible that continued inactivation of Hsp90 eventually leads to a full collapse of the transcription factor network, which would help explain why the chaperone is essential. However, validating this concept is unlikely given the wide client network served by Hsp90 and the likely considerable pleotropic effects on homeostasis that occur once cells are no longer able to recover from the inactivation of this chaperone, which we have avoided (Figure S1A).

DISCUSSION

Transcription factors are keystone components dictating central biological processes including chromatin architecture and gene regulation2,3. Despite decades of intensive research on transcription factors little is understood on how these critical proteins are established and maintained. Here, we provide evidence that the Hsp90 molecular chaperone broadly oversees the transcription factor protein network. Our data support a model in which Hsp90 is required for both late folding events maturing transcription factors into active DNA binding units as well as fostering steady-state polypeptide levels. Recent studies have delineated the mechanistic contributions of both Hsp90 and Hsp70 to the folding events of the p53 transcription factor25,26. Our study expands the influence of Hsp90 to include the majority of a yeast cell’s DNA binding factors, as the pattern of DNA occupancy shifted significantly following Hsp90 inactivation (Figure 2).

Historically, Hsp90 was considered a strict cytosolic molecular chaperone29. Yet, a growing body of evidence indicates that not only does Hsp90 have a presence in the nucleoplasm but also that numerous nuclear pathways are dependent upon Hsp9030 One of the more notable phenotypes associated with Hsp90 is its ability to work as a capacitor of morphological evolution31. Hsp90 silences widespread variance in morphogenic pathways and transient impairment of Hsp90 reveals these traits11. Notably, the Hsp90-buffered phenotypes map to both coding loci as well as cis-regulatory sites of the genome suggesting a role in transcription factor DNA binding32.

While the mechanism(s) driving Hsp90’s capacitor activity is yet to be delineated, several lines of evidence implicate epigenetic/genetic-related pathways33. An early report showed that Hsp90 inactivation triggered a heritable altered chromatin state noting it to be comparable to mutations in the epigenetic factor Trithorax, which was later shown to be an Hsp90-client34,35. Other mechanisms mediating the capacitor function have been proposed including roles for Hsp90 in preventing transposon-based mutagenesis, instability of repetitive DNA elements, chromosome rearrangements, aneuploidy, and other types of DNA damage27,28,33. Whether one or all of these pathways contribute to the evolutionary capacitor function is not clear. Nevertheless, each pathway is reliant upon DNA binding proteins to operate. Hence, the broad influence of Hsp90 on DNA binding factors might explain why Hsp90 has such a wide-ranging influence on genomic events including its enigmatic ability to work as an evolutionary capacitor33.

Minimally, the ability of Hsp90 to modulate numerous transcription factors can account for the extensive physical and functional distribution of the chaperone across a genome. In Drosophila melanogaster Hsp90 localizes at or near the transcription start site of approximately one-third of all genes, as shown using the chromatin immunoprecipitation assay36. In addition, Hsp90 has been observed by immunofluorescence at select DNA loci in Drosophila salivary glands where multiple copies of the genome are aligned thereby facilitating visualization. Under heat shock conditions Hsp90 localizes to the classic 93D heat shock puff in D. melanogaster, the 48B puff in D. hydei, and the Balbiani ring puffs in Chironomus thummi 37 Inhibition of transcription but not protein synthesis blocked nucleation of Hsp90 to these puffs, implying a chaperone role in transcription events37. Our demonstration that Hsp90 regulates most DNA binding proteins provides a mechanistic rationale for why Hsp90 is widely linked to transcription-associated sites.

Besides physical interactions with numerous genomic loci, Hsp90 also has been shown to have functional influences over diverse nuclear pathways30. For instance, inhibition of Hsp90 can trigger aneuploidy, and aneuploidy cells exhibit impaired Hsp90 function12,13. While these phenotypes have been ascribed, in part, to Hsp90’s role in kinetochore assembly, other defects likely contribute since the chromosome duplications are not always closely linked to centromeres38,39. Certainly a decline in any DNA binding proteins overseeing chromosome stability/counting would negatively impact ploidy. Other DNA damage response pathways are influenced by Hsp90’s capacity to maintain steady-state levels of select DNA binding proteins including BRCA1/2 and the MRE11/RAD50/NBN complex40,41,42. Whether Hsp90-dependent changes in DNA binding by these proteins influences phenotypic variation is yet to be resolved.

Despite the variety of nuclear pathways that Hsp90 modulates, our presented work raises an apparent question: if most transcription factors are affected, why is the outcome mainly on chromatin architecture as opposed to gene regulation? One potential is the direct role that Hsp90 has with the chromatin remodeling complex RSC in which the chaperone fosters the transition of the remodeler between nucleosomal targets and prolonged Hsp90 inactivation, which leads to loss of the RSC DNA binding subunit Rsc3 (Figure 4A)17. Perhaps notably, Hsp90 shares genetic and/or physical interactions with 6 of 8 yeast chromatin remodelers43,44. Alternatively, the Hsp90-dependent influence on chromatin might be more apparent since chromatin is inherently more flexible than transcription. For instance, multiple transcription factors can coordinate the same local chromatin architecture but gene promoter control is typically transcription factor-specific45. Thus, an additional plausible mechanism guarding against changes in the gene program, as the availability of transcription factors declines, is the veritable funneling of the existing proteins to the high-affinity motifs typically used to regulate promoter activities.

The ability of Hsp90 to govern the heterogeneous DNA binding protein family reveals a new level of chaperone influence on homeostasis. While it has been well appreciated that Hsp90 regulates the protein kinase network4, our presented work demonstrates that Hsp90 has an equally wide impact on proteins controlling the chromatin system. Minimally, Hsp90 fosters steady-state levels of kinases as well as maintaining these proteins in “activatable” states, which would compare to the DNA binding endpoint. Distinguishing these two large protein families would be how Hsp90 recognizes each. Many kinases are bound through a common electrostatic surface found within the amino-terminal lobe of the kinases46, whereas the transcription factors share few structural features. How Hsp90 manipulates the more physically diverse DNA binding protein family and why impairment of Hsp90 leads to such radical changes in the pattern of DNA binding factors is yet to be determined. Perhaps changes to kinase signaling are impacting transcription factors interactions thereby altering where the proteins occupy the genome. Regardless of the additional inputs prompting the change in DNA binding patterns, our work provides new insights into the physiological relevance of Hsp90 that likely have a direct bearing on how Hsp90 functions as an evolutionary capacitor and is a driver of numerous cancers33,47.

EXPERIMENTAL PROCEDURES

Yeast

The utilized Saccharomyces cerevisiae strains were previously described14,48. TAP-tagged variants were produced by standard recombinant methods by introducing the fusion tag into yeast expressing either WT or G170D Hsp90 as a sole source of the chaperone49.

DNase-Seq analysis

The DNase-Seq protocol was adapted from an established method16 as described previously15. DNase I hypersensitive sites were identified with hotspot50 and DNA footprints with published programs16,20,23.

Protein purification

Recombinant Abf1, Cbf1, Ino2, Ino4, Met31, Rap1, Reb1, Rsc3, and Rsc30 were purified as His6-SUMO fusion proteins51. Yeast Hsp90 was purified as previously described52.

EMSAs

DNA binding assays used radiolabeled probes representing the indicated cognate DNA elements (20 nM) and incubated at 37°C for 30 min i n the described binding buffer53. Probe sequences were: GAAGATCACTTCTAACCAAAG (Abf1); GCGCACGTGACTACAACTGTGGCTG (Cbf1); TTAATTCACATGGAGCAGA (Ino2); TGCGGCATGTGAAAAGTATT (Ino4); GCGCACGTGACTACAACTGTGGCTG (Met31); CACACACCCACACACCACA (Rap1); GGGGAAGCGGGTAAGCTGCC (Reb1); and ACGCGCGCGCGGCCGGGCCA (Rsc3/30). Reactions were resolved on 4% native polyacrylamide IxGTG gels, dried, and imaged using a Phosphorlmager (Molecular Dynamics).

Tissue culture

The mouse fibroblast vSRC 3T3cell line was a kind gift of Dr. Leonard Neckers (NCI). The cells were cultured in Dulbecco’s modification of Eagle’s Medium with 4.5 g/L glucose, L-glutamine and sodium pyruvate supplemented with 10% heat-inactivated fetal bovine serum. Where indicated, radicicol (10 μM) or DMSO was added to 70% confluent cells, which were then incubated for 24 h.

RNA-Seq

Total RNA was isolated from yeast expressing WT or G170D Hsp90 grown in YPD medium at 37°C for 6 h (OD595=0.7) using Yeast RiboPure isolation kit (Ambion). The RNA-Seq libraries were prepared with Illumina’s TruSeq Stranded mRNA Sample Prep kit, sequenced in one lane for 101 cycles with Illumina HiSeq2000, and processed with Casava 1.8.2. The reads were trimmed with trimmomatic54, aligned to the sacCer3 reference genome (UCSC, April 2011) with STAR55, and differential gene expression was computed with GFold (V1.1.0)24.

Supplementary Material

1

Figure S1. Cell viability after long-term Hsp90 inactivation and nucleosome density effects. (A) Yeast expressing WT or G170D Hsp90 growing exponentially at 30°C were shifted to 37°C for 6 h incubation then s potted on YPD plates using 5-fold serial dilutions and the plates were grown at 30°C to assess viability. (B) The relative positions/densities of nucleosomes at the indicated sites along chromosome V were determined in yeast untreated or treated with DMSO or Radicicol (20 μM) for either 15 or 360 min, as indicated. Overlapping primer sets designed to amplify ~100 bp sections of the DNA were used in the PCR-amplification of DNA isolated from nuclei treated with Micrococcal nuclease17. The MNase mapping data were the average of three replicas and the error bars are SEM.

Figure S2. Temperature-dependent changes to chromatin features. (A) Chromatin accessibility is increased at RSC-dependent sites following short-term (15 min) inactivation of Hsp90 but the increased DNA access is lost in an Hsp90-independent manner after 6 h at 37°C. To illustrate the DNase I cleavage levels at a RSC-dependent site on Chromosome I 107,5000-120,000 is shown for samples obtained from yeast expressing WT or G170D Hsp90 incubated for 15 min or 6 h at 37°C. The Rsc3/30 footprints (red) detected with DNase2TF within this area are indicated. (B) The DNase I cleavage levels at the left telomere of Chromosome III or VIII are shown in yeast expressing WT or G170D Hsp90 incubated for 15 min or 6 h at 37°C. (C) The DNase I cleavage levels along Chromosome VII are shown in yeast expressing WT or G170D Hsp90 incubated for 15 min or 6 h at 37°C and the positions of tRNA genes or long terminal repeats (LTRs) are indicated.

Figure S3. Total detected DNA footprints are reduced following inactivation of Hsp90 using the G170D ts variant. (A) WT and G170D DHSs after 6 h incubation at 37°C were used to computed footprints with three di fferent footprint detection programs16,20,23 at optimized thresholds (false discovery rate). The program reported in Piper et al. (2003) used adjusted parameters with footprint size adjusted as described in Hesselberth et al. (2009) and the merging of the footprints was excluded. (B) The overlap in DNA footprints revealed using the Footprinting detector algorithm16 and DNase2TF algorithm20 is shown.

Figure S4. Occupancy of consensus elements as well as all DNA footprints decreased following short-term (15 min) or long-term (6 h) loss of Hsp90. (A) The identified consensus motifs21,22 from computed footprints (DNase2TF (fdr=0.01))20 with at least 25% reduction in total motif counts in G170D compared to the respective WT sample were plotted with Cytoscape. Elements with less than 10 identified bound motifs for both WT and G170D were excluded from the analysis. Pink (middle) footprints declined for both 15 min and 6 h data, blue only at 15 min, and green only after 6 h. (B) The total number of identified DNA footprints in each DNase-Seq data set is shown as well as the number of consensus motifs21,22 and DNA footprints without known cognate binding partners.

Figure S5. Hsp90 enhances DNA binding activity of Rsc3, Rsc30, Rsc3/30 but does not influence Reb1. The DNA binding activities of recombinant purified Rsc3, Rsc30, or Rsc3/30 (70 nM) (A) or Reb1 (B) were determined by EMSA using radiolabeled cognate consensus element (20 nM) in the presence of increasing amounts of recombinant yeast Hsp90 (4, 12 and 34 μM). (C) The DNA binding activities of Abf1 (60 μM), Ino2/Ino4 (75 nM), Met31 (1 μM), and Rap1 (60 μM) were analyzed by EMSA using radiolabeled cognate consensus element (20 nM) alone or in the presence Hsp90 (12 μM). After a 10 min incubation at 22°C the indicate d reactions were supplemented with either DMSO or Radicicol (20 μM) and following a further 10 min incubation at 22°C the reactions were resolved by n ative page. For all EMSA reactions the total amount of protein was balanced with BSA.

Table S1. Characteristics of the chromatin structure upon short- and long-term Hsp90 inactivation. Total DHSs numbers, open chromatin length, average DHS length and average DHS z-score (hypersensitivity/openness) for the respective groups of DHSs in WT and G170D after 15 min or 6 h incubation at 37°C.

Table S2. Features of the chromatin structures of DHSs at subtelomeric, LTRs, or tRNA genes. An average length and z score of DHSs associated with subtelomeric, tRNA and long terminal repeats in WT and G170D after 15 min or6 hincubation at 37°C.

Table S5. The overlapping footprints for all DNase-Seq datasets. The total number of DNA footprints identified in each DNase-Seq data set is shown as well as the number and percentage of footprints overlapping with the other 3 conditions, as marked.

Table S7. Chromatin structure features of Hsp90-dependent genes. An average length and z score of DHSs associated with up- and downregulated genes in WT and G170D after 15 min or 6 h incubation at 37°C is provided.

2

Table S3. Consensus motifs detected in all DNase-Seq datasets. Total identifed consensus motifs for all 4 data sets (footprints in WT and G170D after 15 min or 6 h incubation at 37°C) are listed in order of decreasi ng frequency based upon the WT 15 min findings.

3

Table S4. DNA footprints detected within an area of Chromosome I. List of all DNA footprints identified with DNase2TF (fdr=0.01) on Chromosome I between 120,000 and 180,000 bp in WT and G170D after 15 min or 6 h incubation at 37°C, with corresponding indexes, as plotted in Figure 3A.

4

Table S6. Genes displaying Hsp90-dependent expression levels. The changes in gene expression following the 6 h loss of the Hsp90 were determined by RNA-Seq with differential expression being determined by GFold for all yeast genes log2|1.5|24.

Highlights.

  • Chromatin accessibility is Hsp90-dependent

  • Hsp90 governs the transcription factor network controlling chromatin status

  • Hsp90 mediates a late folding step required for transcription factor DNA binding activity

  • Hsp90 supports the steady-state stability of transcription factor proteins

ACKNOWLEDGEMENTS

We thank to Zeno-Dan Barcutean for the help with computer programing. We are also grateful to UIUC IT Department for their help in maintaining our server and bioinformatic programs. Supported for the work was through the Public Service grant GM118306.

Footnotes

COMPETING INTERESTS STATEMENTS

The authors have no conflicts of interest.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain

REFERENCES

  • 1.Venkatesh S & Workman J (2015). Histone exchange, chromatin structure and the regulation of transcription. Nat. Rev. Mol. Cell Biol. 16, 178–189. [DOI] [PubMed] [Google Scholar]
  • 2.Voss T & Hager G (2014). Dynamic regulation of transcriptional states by chromatin and transcription factors. Nat. Rev. Genet. 15, 69–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lambert S et al. (2018). The Human Transcription Factors. Cell 172, 650–665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Schopf F, Biebl M & Buchner J (2017). The HSP90 chaperone machinery. Nat. Rev. Mol. Cell Biol. 18, 345–360. [DOI] [PubMed] [Google Scholar]
  • 5.Stavreva D, Muller W, Hager G, Smith C & McNally J (2004). Rapid Glucocorticoid Receptor Exchange at a Promoter Is Coupled to Transcription and Regulated by Chaperones and Proteasomes. Mol. Cell. Biol. 24, 2682–2697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shaknovich R, Shue G & Kohtz D (1992). Conformational activation of a basic helix-loop-helix protein (MyoD1) by the C-terminal region of murine HSP90 (HSP84). Mol. Cell. Biol. 12, 5059–5068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Antonsson C, Arulampalam V, Whitelaw M, Pettersson S & Poellinger L (1995). Constitutive Function of the Basic Helix-Loop-Helix/PAS Factor Arnt. J. Biol. Chem. 270, 13968–13972. [DOI] [PubMed] [Google Scholar]
  • 8.Shue G & Kohtz D (1994). Structural and functional aspects of basic helixloop-helix protein folding by heat-shock protein 90. J. Biol. Chem. 269, 2707–2711. [PubMed] [Google Scholar]
  • 9.Müller P, Ceskova P & Vojtesek B (2004). Hsp90 Is Essential for Restoring Cellular Functions of Temperature-sensitive p53 Mutant Protein but Not for Stabilization and Activation of Wild-type p53. J. Biol. Chem. 280, 6682–6691. [DOI] [PubMed] [Google Scholar]
  • 10.Walerych D et al. (2004). Hsp90 Chaperones Wild-type p53 Tumor Suppressor Protein. J. Biol. Chem. 279, 48836–48845. [DOI] [PubMed] [Google Scholar]
  • 11.Rutherford S & Lindquist S (1998). Hsp90 as a capacitor for morphological evolution. Nature 396, 336–342. [DOI] [PubMed] [Google Scholar]
  • 12.Chen G, Bradford W, Seidel C & Li R (2012). Hsp90 stress potentiates rapid cellular adaptation through induction of aneuploidy. Nature 482, 246–250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Oromendia A, Dodgson S & Amon A (2012). Aneuploidy causes proteotoxic stress in yeast. Genes & Development 26, 2696–2708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Nathan D & Lindquist S (1995). Mutational analysis of Hsp90 function: interactions with a steroid receptor and a protein kinase. Mol. Cell. Biol. 15, 3917–3925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zelin E, Zhang Y, Toogun O, Zhong S & Freeman B (2012). The p23 Molecular chaperone and GCN5 acetylase jointly modulate protein-DNA dynamics and open chromatin status. Mol. Cell 48, 459–470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hesselberth J et al. (2009). Global mapping of protein-DNA interactions in vivo by digital genomic footprinting. Nature Methods 6, 283–289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Echtenkamp F et al. (2016). Hsp90 and p23 molecular chaperones control chromatin architecture by maintaining the functional pool of the RSC chromatin remodeler. Mol. Cell 64, 888–899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ai W, Bertram P, Tsang C, Chan T & Zheng X (2002). Regulation of Subtelomeric Silencing during Stress Response. Mol. Cell 10, 1295–1305. [DOI] [PubMed] [Google Scholar]
  • 19.Curcio M, Lutz S & Lesage P (2015). The Ty1 LTR-retrotransposon of budding yeast, Saccharomyces cerevisiae. Microbiology Spectrum 3, 1–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sung M, Guertin M, Baek S & Hager G (2014). DNase footprint signatures are dictated by factor dynamics and DNA sequence. Mol. Cell 56, 275–285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.van Helden J (2003). Regulatory sequence analysis tools. Nucleic Acids Res. 31, 3593–3596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sandelin A, Alkema W, Engstrom P, Wasserman W & Lenhard B (2004). JASPAR: an open-access database for eukaryotic transcription factor binding profiles. Nucleic Acids Res. 32, D91–D94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Piper J et al. (2013). Wellington: A novel method for the accurate identification of digital genomic footprints from DNase-seq data. Nucleic Acids Res. 41, e201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Feng J et al. (2012). GFOLD: A generalized fold change for ranking differentially expressed genes from RNA-seq data. Bioinformatics 28, 2782–2788. [DOI] [PubMed] [Google Scholar]
  • 25.Dahiya V, Agam G, Lawatscheck J, Rutz DA, Lamb DC, & Buchner J (2019). Coordinated Conformational Processing of the Tumor Suppressor Protein p53 by the Hsp70 and Hsp90 Chaperone Machineries. Molecular cell, 74(4), 816–830. [DOI] [PubMed] [Google Scholar]
  • 26.Boysen M, Kityk R, & Mayer MP (2019). Hsp70-and Hsp90-mediated regulation of the conformation of p53 DNA binding domain and p53 cancer variants. Molecular cell, 74(4), 831–843. [DOI] [PubMed] [Google Scholar]
  • 27.Specchia V et al. (2010). Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature, 463(7281), 662. [DOI] [PubMed] [Google Scholar]
  • 28.Hummel B, Hansen EC, Yoveva A, Aprile-Garcia F, Hussong R, & Sawarkar R (2017). The evolutionary capacitor HSP90 buffers the regulatory effects of mammalian endogenous retroviruses. Nature structural & molecular biology, 24(3), 234. [DOI] [PubMed] [Google Scholar]
  • 29.Pratt W & Dittmar K (1998). Studies with Purified Chaperones Advance the Understanding of the Mechanism of Glucocorticoid Receptor-hsp90 Heterocomplex Assembly. Trends Endocrinol. Metab. 9, 244–252. [DOI] [PubMed] [Google Scholar]
  • 30.Gvozdenov Z, Kolhe J & Freeman B (2019). The Nuclear and DNA-Associated Molecular Chaperone Network. Cold Spring Harbor Perspect. Biol:a034009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lindquist S (2009). Protein folding sculpting evolutionary change. Cold Spring Harb. Symp. Quantitative Biology 74, 103–108. [DOI] [PubMed] [Google Scholar]
  • 32.Jarosz D & Lindquist S (2010). Hsp90 and environmental stress transform the adaptive value of natural genetic variation. Science 330, 1820–1824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zabinsky R et al. (2019) A stress response that allows highly mutated eukaryotic cells to survive and proliferate. Preprint at https://doi.org/10/1101/515460. [Google Scholar]
  • 34.Sollars V et al. (2002). Evidence for an epigenetic mechanism by which Hsp90 acts as a capacitor for morphological evolution. Nature Genetics 33, 70–74. [DOI] [PubMed] [Google Scholar]
  • 35.Tariq M, Nussbaumer U, Chen Y, Beisel C & Paro R (2009). Trithorax requires Hsp90 for maintenance of active chromatin at sites of gene expression. Proc. Natl. Acad. Sci. U.S.A. 106, 1157–1162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sawarkar R, Sievers C & Paro R (2012). Hsp90 globally targets paused RNA polymerase to regulate gene expression in response to environmental stimuli. Cell 149, 807–818. [DOI] [PubMed] [Google Scholar]
  • 37.Morcillo G, Diez J, Carbajal M & Tanguay R (1993). HSP90 associates with specific heat shock puffs (hsr omega) in polytene chromosomes of Drosophila and Chironomus. Chromosoma 102, 648–659. [DOI] [PubMed] [Google Scholar]
  • 38.Stemmann O, Neidig A, Kocher T, Wilm M & Lechner J (2002). Hsp90 enables Ctf13p/Skp1p to nucleate the budding yeast kinetochore. Proc. Natl. Acad. Sci. U.S.A. 99, 8585–8590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Davies A & Kaplan K (2010). Hsp90-Sgt1 and Skp1 target human Mis12 complexes to ensure efficient formation of kinetochore-microtubule binding sites. J. Cell Biol. 189, 261–274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Dote H, Burgan W, Camphausen K & Tofilon P (2006). Inhibition of Hsp90 Compromises the DNA Damage Response to Radiation. Cancer Research 66, 9211–9220. [DOI] [PubMed] [Google Scholar]
  • 41.Stecklein S et al. (2012). BRCA1 and HSP90 cooperate in homologous and non-homologous DNA double-strand-break repair and G2/M checkpoint activation. Proc. Natl. Acad. Sci. U.S.A. 109, 13650–13655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.van den Tempel N et al. (2019). On the Mechanism of Hyperthermia-Induced BRCA2 Protein Degradation. Cancers 11, 97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhao R & Houry W (2005). Hsp90: a chaperone for protein folding and gene regulation. Biochemistry and Cell Biology 83, 703–710. [DOI] [PubMed] [Google Scholar]
  • 44.McClellan A et al. (2007). Diverse Cellular Functions of the Hsp90 Molecular Chaperone Uncovered Using Systems Approaches. Cell 131, 121–135. [DOI] [PubMed] [Google Scholar]
  • 45.Cosma M, Tanaka T & Nasmyth K (1999). Ordered Recruitment of Transcription and Chromatin Remodeling Factors to a Cell Cycle- and Developmentally Regulated Promoter. Cell 97, 299–311. [DOI] [PubMed] [Google Scholar]
  • 46.Citri A et al. (2006). Hsp90 Recognizes a Common Surface on Client Kinases. The Journal of Biological Chemistry 281,14361–14369. [DOI] [PubMed] [Google Scholar]
  • 47.Calderwood S & Neckers L (2016). Hsp90 in Cancer: Transcriptional Roles in the Nucleus. Adv. Cancer Res. 129, 89–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ghaemmaghami S et al. (2003). Global analysis of protein expression in yeast. Nature 425, 737–741. [DOI] [PubMed] [Google Scholar]
  • 49.Longtine M et al. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953–961. [DOI] [PubMed] [Google Scholar]
  • 50.John S et al. (2011). Chromatin accessibility pre-determines glucocorticoid receptor binding patterns. Nature Genetics 43, 264–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Butt T, Edavettal S, Hall J & Mattern M (2005). SUMO fusion technology for difficult-to-express proteins. Protein Expression and Purification 43, 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Toogun O, DeZwaan D & Freeman B (2007). The Hsp90 Molecular Chaperone Modulates Multiple Telomerase Activities. Mol. Cell. Biol. 28, 457–467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lopes J & Henry S (1991). Interaction of trans and cis regulatory elements in the INO1 promoter of Saccharomyces cerevisiae. Nucleic Acids Res. 19, 3987–3994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Bolger A, Lohse M & Usadel B (2014). Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Dobin A et al. (2013). STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Figure S1. Cell viability after long-term Hsp90 inactivation and nucleosome density effects. (A) Yeast expressing WT or G170D Hsp90 growing exponentially at 30°C were shifted to 37°C for 6 h incubation then s potted on YPD plates using 5-fold serial dilutions and the plates were grown at 30°C to assess viability. (B) The relative positions/densities of nucleosomes at the indicated sites along chromosome V were determined in yeast untreated or treated with DMSO or Radicicol (20 μM) for either 15 or 360 min, as indicated. Overlapping primer sets designed to amplify ~100 bp sections of the DNA were used in the PCR-amplification of DNA isolated from nuclei treated with Micrococcal nuclease17. The MNase mapping data were the average of three replicas and the error bars are SEM.

Figure S2. Temperature-dependent changes to chromatin features. (A) Chromatin accessibility is increased at RSC-dependent sites following short-term (15 min) inactivation of Hsp90 but the increased DNA access is lost in an Hsp90-independent manner after 6 h at 37°C. To illustrate the DNase I cleavage levels at a RSC-dependent site on Chromosome I 107,5000-120,000 is shown for samples obtained from yeast expressing WT or G170D Hsp90 incubated for 15 min or 6 h at 37°C. The Rsc3/30 footprints (red) detected with DNase2TF within this area are indicated. (B) The DNase I cleavage levels at the left telomere of Chromosome III or VIII are shown in yeast expressing WT or G170D Hsp90 incubated for 15 min or 6 h at 37°C. (C) The DNase I cleavage levels along Chromosome VII are shown in yeast expressing WT or G170D Hsp90 incubated for 15 min or 6 h at 37°C and the positions of tRNA genes or long terminal repeats (LTRs) are indicated.

Figure S3. Total detected DNA footprints are reduced following inactivation of Hsp90 using the G170D ts variant. (A) WT and G170D DHSs after 6 h incubation at 37°C were used to computed footprints with three di fferent footprint detection programs16,20,23 at optimized thresholds (false discovery rate). The program reported in Piper et al. (2003) used adjusted parameters with footprint size adjusted as described in Hesselberth et al. (2009) and the merging of the footprints was excluded. (B) The overlap in DNA footprints revealed using the Footprinting detector algorithm16 and DNase2TF algorithm20 is shown.

Figure S4. Occupancy of consensus elements as well as all DNA footprints decreased following short-term (15 min) or long-term (6 h) loss of Hsp90. (A) The identified consensus motifs21,22 from computed footprints (DNase2TF (fdr=0.01))20 with at least 25% reduction in total motif counts in G170D compared to the respective WT sample were plotted with Cytoscape. Elements with less than 10 identified bound motifs for both WT and G170D were excluded from the analysis. Pink (middle) footprints declined for both 15 min and 6 h data, blue only at 15 min, and green only after 6 h. (B) The total number of identified DNA footprints in each DNase-Seq data set is shown as well as the number of consensus motifs21,22 and DNA footprints without known cognate binding partners.

Figure S5. Hsp90 enhances DNA binding activity of Rsc3, Rsc30, Rsc3/30 but does not influence Reb1. The DNA binding activities of recombinant purified Rsc3, Rsc30, or Rsc3/30 (70 nM) (A) or Reb1 (B) were determined by EMSA using radiolabeled cognate consensus element (20 nM) in the presence of increasing amounts of recombinant yeast Hsp90 (4, 12 and 34 μM). (C) The DNA binding activities of Abf1 (60 μM), Ino2/Ino4 (75 nM), Met31 (1 μM), and Rap1 (60 μM) were analyzed by EMSA using radiolabeled cognate consensus element (20 nM) alone or in the presence Hsp90 (12 μM). After a 10 min incubation at 22°C the indicate d reactions were supplemented with either DMSO or Radicicol (20 μM) and following a further 10 min incubation at 22°C the reactions were resolved by n ative page. For all EMSA reactions the total amount of protein was balanced with BSA.

Table S1. Characteristics of the chromatin structure upon short- and long-term Hsp90 inactivation. Total DHSs numbers, open chromatin length, average DHS length and average DHS z-score (hypersensitivity/openness) for the respective groups of DHSs in WT and G170D after 15 min or 6 h incubation at 37°C.

Table S2. Features of the chromatin structures of DHSs at subtelomeric, LTRs, or tRNA genes. An average length and z score of DHSs associated with subtelomeric, tRNA and long terminal repeats in WT and G170D after 15 min or6 hincubation at 37°C.

Table S5. The overlapping footprints for all DNase-Seq datasets. The total number of DNA footprints identified in each DNase-Seq data set is shown as well as the number and percentage of footprints overlapping with the other 3 conditions, as marked.

Table S7. Chromatin structure features of Hsp90-dependent genes. An average length and z score of DHSs associated with up- and downregulated genes in WT and G170D after 15 min or 6 h incubation at 37°C is provided.

2

Table S3. Consensus motifs detected in all DNase-Seq datasets. Total identifed consensus motifs for all 4 data sets (footprints in WT and G170D after 15 min or 6 h incubation at 37°C) are listed in order of decreasi ng frequency based upon the WT 15 min findings.

3

Table S4. DNA footprints detected within an area of Chromosome I. List of all DNA footprints identified with DNase2TF (fdr=0.01) on Chromosome I between 120,000 and 180,000 bp in WT and G170D after 15 min or 6 h incubation at 37°C, with corresponding indexes, as plotted in Figure 3A.

4

Table S6. Genes displaying Hsp90-dependent expression levels. The changes in gene expression following the 6 h loss of the Hsp90 were determined by RNA-Seq with differential expression being determined by GFold for all yeast genes log2|1.5|24.

RESOURCES