Skip to main content
Journal of Environmental Health Science and Engineering logoLink to Journal of Environmental Health Science and Engineering
. 2019 Nov 8;17(2):839–846. doi: 10.1007/s40201-019-00400-y

Effect of immature and mature compost addition on petroleum contaminated soils composting: kinetics

Mahdi Farzadkia 1, Ali Esrafili 1, Mitra Gholami 1, Ali Koolivand 2,
PMCID: PMC6985388  PMID: 32030157

Abstract

Purpose

The kinetic studies and effect of amendment addition on the performance of the composting process in reduction of total petroleum hydrocarbons (TPH) from petroleum contaminated soils (PCS) were investigated in the present research.

Methods

Seven composting experiments containing various mixing ratios of PCS to unfinished compost (UC) and finished compost (FC) were set up and operated for 14 weeks. The mixing rations consisted of 1:0 (as control experiment), 1:0.3, 1:0.6, and 1:1. The initial C/N/P and moisture contents of the composting piles were adjusted to 100/5/1 and 50–55%, respectively.

Results

Results showed that 50.09–79.49% of TPH was removed in the composting experiments after 14 weeks. The highest and lowest removal rates were achieved in the ratios of 1:1 and 1:0.3, respectively. Moreover, application of UC as amendments and bulking agent is more efficient than FC. The biodecomposition of TPH was fitted to the first-order kinetic with the half lives and rate constants of 5.63–11.55 days and 0.060–0.123 d−1, respectively. The bacteria detected from the composting treatments were Staphylococcus sp., Bacillus sp., and Pseudomonas sp.

Conclusions

The study confirmed the suitability of composting process for PCS bioremediation and superiority of UC than FC as bulking agent.

Keywords: Petroleum contaminated soil, Bioremediation, Composting process, Amendments, Immature compost, Mature compost

Introduction

Various applications of petroleum has resulted in disposing considerable volume of petroleum materials into the soil [1, 2]. The main sources of soil pollution with petroleum hydrocarbons are the sludge generated from the various parts of oil refinery processes and petroleum spills occurred by accidents during pumping, transportation, and refining [3, 4]. The toxicity of petroleum contaminated soil (PCS) is of a great concern because it significantly affects the environment and human health [5, 6]. Thus, there is an urgent need to introduce treatment methods to remediate contaminated soils [7, 8].

Over the years, various physicochemical technologies have been applied for treating contaminated soils [911]. However, bioremediation methods have attracted more attention mainly because of their cheapness and effectiveness [12, 13]. In recent years, many studies have shown the capability of bioremediation strategies in degradation petroleum compounds [4, 14, 15]. In this regard, composting process has been verified to be efficient for the removal of petroleum contaminants [11, 16, 17].

The type and level of amendments and bulking agents are the parameters affecting the composting process [18, 19]. Various amendments and bulking agents such as food waste, unfinished compost (UC), and finished compost (FC) can be added to composting mixtures to supplement readily degradable organic matters, microorganisms, and nutrients [20, 21]. The application of these organic materials for contaminated soil remediation can also improve soil conditions [22]. However, these materials must be added in an adequate amount to adjust the initial level of petroleum compounds in the soil to be treated. Consequently, the ratio of contaminated soil to amendments should be adjusted because an unsuitable ratio can retard or prevent the microbial activities. Moreover, the total cost in the composting method can be lessened by adjusting the ratio of contaminated soils to the amendments and bulking materials used [4, 23].

In Iran, as a country producing high amount of crude oil in the world, there are many contaminated sites especially in the vicinity of oil refinery plants. Until now, treatment of PCS in these sites has not still solved. From an extensive literature search, we concluded that the simultaneous effects of UC and FC on the performance and kinetics of composting process for PCS remediation has not been surveyed. Thus, the novelty of the present work lies in studying the effects of adding various amounts and the types of bulking agent on the process efficiency. Therefore, this study was performed to investigate the feasibility and kinetics of composting process in PCS remediation. The study also surveyed how adding various amounts of UC and FC impacts the degradation of total petroleum hydrocarbons (TPH) during PCS composting.

Materials and methods

Preparation of PCS, UC, and FC

The PCS was picked up from an area located in the vicinity of Shazand Oil Refinery Plant in Iran. The UC was prepared from a Composting Facility (Tehran, Iran) at the middle duration of its biological decomposition. First non-putrescible items such as plastic and glass was separated and then it was cut to a length of 1–2 cm. The FC was purchased from a local market and passed through a sieve. The PCS, UC, and FC were maintained at a suitable place before starting the process.

Design and operation of composting experiments

Seven non-covered cylindrical reactors (volume of 120 L) were designed and runned for 14 weeks. The composting reactors were conducted with 1:0.3, 1:0.6, and 1:1 mixing ratios (dry weight) of PCS to UC and FC (as amendments and bulking agent), as follows:

  • W1: 1:0.3 mixing ratio of PCS to UC

  • W2: 1:0.3 mixing ratio of PCS to FC

  • W3: 1:0.6 mixing ratio of PCS to UC

  • W4: 1:0.6 mixing ratio of PCS to FC

  • W5: 1:1 mixing ratio of PCS to UC

  • W6: 1:1 mixing ratio of PCS to FC

Moreover, a reactor (W7) containing only PCS was operated as control to determine the role of abiotic processes in TPH reduction. The initial concentrations of TPH in the piles were adjusted to 10,000 mg kg−1. Before the process was initiated, the contents of the experiments were thoroughly blended to reach homogeneity and increase contact between microbial populations and contaminants. The contents of the piles were turned twice a week for 40 min to provide sufficient aeration [24]. Water was used to maintain the moisture content of 50–55% (w/w). Over the composting time, moisture content was detected on-site and adjusted when necessary. KH2PO4 and NH4Cl were also used to reach the C/N/P of 100/5/1 [25] for providing suitable conditions for microbial activities.

Sampling and analytical methods

The samples for analyses of organic carbon (OC), TPH, nitrogen (N), phosphorus (P), and pH were picked up biweekly over the composting time. Prior to taking the samples, the composting materials were completely blended and then subsamples were obtained from the bottom, middle, and top of each composting reactor. After blending the subsamples, each analysis was performed.

After extracting with n-pentane, TPH was quantified with gas chromatograph (GC) (AGILENT-7890 A) equipped with flame ionization detector (FID), based on TNRCC [26]. The OC was measured by the loss-on-ignition method according to TMECC [27]. N was detected by the Kjeldahl method (4500-NC) and P was measured spectrophotometrically (4500-PC) according to APHA [28]. By drying the samples at 105 °C, the N, P, OC, and TPH were calculated on the basis of dry matter. The temperatures of both the experiments and the ambient temperature were measured daily using a sensor over the whole composting duration. The pH values of samples were determined by a pH electrode (JENWAY model 3510) according to TMECC [27]. All the tests were done in duplicate.

Bacterial isolation

After suspending the samples (1 g) in sterile double-distilled water (100 ml) and agitating in a shaker at 150 rpm, they were diluted up to10−5. Then, the dilution (100 μl) was transferred to Muller-Hinton, nutrient agar, and blood agar plates. In order to isolate Bacillus strain, the dilution (1 ml) was blended with molten mannitol-egg yolk-polymyxin agar. Then it was poured into plates and incubated at 37 °C for 24–48 h. The morphological characteristics of the colonies such as size, color, form, margin, and elevation in addition to biochemical tests and gram stain test were also evaluated.

Confirmation of the extracted isolates was performed via the PCR assay. In addition, the reaction was carried out using Bio-Rad Thermal Cycler. The universal bacterial primer 27F (forward-5’AGAGTTTGATCCTGGCTCAG −3′ and reverse-5′- TACG GYTACCTTGTTACGACTT-3′) was used in order to amplify the 16S rRNA gene. The PCR mix consisted of 1 μL (10 pmol) of each primer, 25 μL PCR Master Mix, and 2 μL template DNA in a final reaction volume of 50 μL. So as to amplify DNA, a thermal cycler was applied under the following conditions: initial denaturation for 5 min at 94 °C, 30 cycles of denaturation for 45 s at 94 °C, an annealing temperature for 50 s at 48 °C, an extension for 1 min at 68 °C, and a final extension for 7 min at 68 °C. The 2% agarose gel in Tris- Borate-EDTA (TBE) buffer was used to perform the electrophoresis of the amplified DNA fragments, with a 100 bp DNA ladder. One sample of each PCR product (amplicons) was sequenced by Bioneer Co., Korea mediated by Pishgam Co., Iran. The Chromas software and ClustalW program were also used to analyze and align the data.

Kinetics of TPH degradation

The first- and second-order kinetic models (eqs. 1–4) were applied using linear data plots of ln (C0/Ct) and 1/Ct versus time (t), respectively.

For the first-order kinetic:

lnCt/C0=k1t 1
t½=ln2/k1=0.693/k1 2

For the second-order kinetic:

1/Ct=k2t+1/C0 3
t½=1/k2C0 4

Where Ct is the TPH concentrations (g kg−1) at times t and C0 is the initial TPH concentrations (g kg−1). k1 (d−1) and k2 (g kg−1d−1) are the kinetic constant of the reduction in petroleum hydrocarbons. t½ or half-life time is the time (d) required for consuming half of the initial amount of petroleum hydrocarbons.

GC procedure

A GC containing a 30 m-capillary column (CP-Sil 8CB) was used for TPH detection. The n-alkane markers nC6 (n-Hexane) and nC35 (n-Pentatriacontane) were used to establish the boiling point range boundaries. The primary temperature was adjusted at 35 °C for 2 min and then raised in the speed of 10 °C min−1 to achieve 300 °C and kept sustained for 5 min. The maximum temperature was adjusted at 325 °C (held for 5 min) to make sure that the column is clean. Forty-five minutes were spent for each test. The temperatures of detector and injection port were, respectively, 325 and 280 °C. The carrier gas was Helium (in the speed of 2.9 ml min−1) for 30 min and at 6.0 ml min−1 for the final 10 min of the run. The split ratio and actual pressure were, respectively, 25% and 11 psi. The flow rates of makeup, air, and hydrogen gas for FID were 30, 450, and 40 ml min−1, respectively.

Statistical analysis

In order to determine the relationship between the parameters, Microsoft Excel software (regression analysis) was applied. Moreover, SPSS 19.0 software for Windows was also used to perform statistical analysis. The significance level was 0.05 (p < 0.05).

Results and discussion

Characterization of UC, FC, and PCS

The characteristics of UC, FC, and PCS have been provided in Table 1. The pH of UC, FC, and PCS were suitable for microbial growth. However, the P and N levels in the UC, FC, and PCS were low in comparison with the optimal conditions required for the effective performance of composting process. It should be noted that presence of some petroleum materials in the feedstock might be a possible reason for detecting low amount of TPH in the FC and UC.

Table 1.

Physicochemical properties of IC, MC, and PCS

Parameter Unit UC FC PCS
TPH g kg−1 1.09 0.87 10.00
OC g kg−1 289.92 130.46 0.64
N g kg−1 2.94 5.71 0.04
P g kg−1 2.58 2.09 0.02
Moisture content % 49.10 28.94 6.73
pH 7.46 7.54 7.78

TPH reduction in the composting piles

Figure 1 indicates the pattern of TPH decomposition over the time. The TPH removal in the piles W1, W2, W3, W4, W5, and W6 were 57.76, 50.09, 72.37, 66.17, 79.49, and 75.70%, respectively. The short lag time of TPH removal observed in the figure is the adaptation period. In order to adapt with this new conditions, this time is necessary for the microbial populations. Following this time, the bacterial populations consumed petroleum hydrocarbons effectively. Thus, rapid TPH degradation was reached over the first 10 weeks of the process. Then, the related decomposition rates decreased gradually since the biodegradable parts of TPH are degraded first and the residual materials are highly recalcitrant over the remaining composting time [29, 30].

Fig. 1.

Fig. 1

Trend of TPH degradation over the composting time

Very low (about 3%) removal of TPH in the abiotic treatment (W7) indicated that TPH degradation was a result of microbial activities. Therefore, negligible amount of petroleum hydrocarbons was removed due to the abiotic processes such as volatilization. The temperature occurred in the piles (mesophilic range) was not adequate for volatilization. This supports the fact that biodegradation is the main process of TPH removal.

Effect of UC and FC addition

The ratio of bulking agent to PCS is of importance as it affects greatly composting economy. Moreover, the microbial population and hence the removal rates of the contaminant rises when the mixing ratio is optimum. As provided in Fig. 1, the rates of TPH removal in the treatments with the mixing ratio of 1:0.3 and 1:0.6 were lower than those with the ratio of 1:1. Thus, the mixing ratio of PCS to UC and FC is entirely effective in removal of TPH. These results accord our previous studies [25, 3133] reporting that the level of organic amendment affects greatly on the composting performance. Therefore, a low amount of PCS is preferred because a high ratio might present inhibitory effects on the native bacterial populations. Also, the composted mixture contains lower levels of petroleum contaminant (Table 2) and therefore it can be disposed of in an environmentally safe manner.

Table 2.

Residual TPH in the composting experiments over the composting time

Composting time (week) Residual TPH (g kg−1)
W1 W2 W3 W4 W5 W6
0 7.94 7.89 6.66 6.58 5.55 5.44
2 7.52 7.64 6.04 6.14 4.53 4.72
4 7.06 7.34 4.96 5.12 3.42 3.55
6 6.27 6.54 3.89 4.04 2.74 2.88
8 5.00 5.34 2.81 3.25 2.05 2.37
10 4.06 4.48 2.20 2.60 1.64 1.76
12 3.47 4.12 1.99 2.37 1.31 1.50
14 3.36 3.94 1.84 2.23 1.14 1.32

One of the parameters influencing the degradation of petroleum hydrocarbons is the type of the amendments and bulking agent used. Accordingly, the application of various types of organic amendments has yielded different degradation rates of target contaminants in the composting process [29, 34]. In the present study, UC and FC were used as amendments and bulking agent to promote the efficiency of TPH biodegradation. The results indicated that there were significant differences (P < 0.05) in TPH removal for the experiments containing various types of amendments and bulking agent. The UC amended experiments presented the higher removal rates of petroleum hydrocarbons than those amended by FC. This could be due to the fact that UC appears to have more microbial activity than FC. Other studies have also reported that as the amendment materials contain different amounts of OC, nutrients, and microorganisms, they present various removal rates of target contaminants [35, 36].

Relationship of TPH degradation with temperature elevation and OC consumption

The results of regression analysis (Fig. 2a) indicated that there were linear correlations for OC consumption versus TPH degradation for all the composting experiments. The correlation equations presented in the figure are useful in predicting TPH degradation in a real facility of composting. As illustrated in Fig. 3, the levels of both OC and TPH had a downward trend over the process duration. When the bulking agent as a organic carbon source is preferred over petroleum hydrocarbons, TPH biodegradation may be inhibited [34]. The elevation of OC/TPH ratio indicated that TPH removal was higher than OC reduction. Therefore, the UC and FC used in the present study as the amendment and bulking agent were not competing carbon sources. Figure 2b shows correlations between temperature increase and TPH removal. Elevation of temperature is due to the biological decomposition of petroleum compounds which release heat. In turn, higher temperatures can promote enzyme kinetics and thus increase the removal of TPH [19, 37].

Fig. 2.

Fig. 2

Relationship of TPH reduction with OC consumption and temperature elevation

Fig. 3.

Fig. 3

Trend of OC and OC/TPH changes over the composting time

Microbial kinetics and populations

In order to better understand the decomposition of petroleum materials in a composting process, analysis of microbial kinetics and populations is helpful [29, 35]. Table 3 presents the calculated values for the first-and second-order kinetics. The R values showed that the kinetic of TPH removal was fitted well to the first-order model. Various studies have also reported that the kinetic of TPH biodegradation corresponds to the first-order models [25, 29, 35]. The half-lives and rate constants of TPH removal in the composting piles were found to be 5.63–11.55 days and 0.060–0.123 d−1, respectively. The first-order rate constant values computed in the present study was lower than those reported by Koolivand et al. [25] and higher than those reported by Gomez and Sartaj [38]. This difference is due to the fact that the values of rate constant are dependent on a few parameters including the amount and type of amendments and bulking agents being used, contaminant nature, and bioremediation method [37, 39].

Table 3.

Kinetic analyses of TPH degradation in the composting experiments

Composting experiments First order model Second order model
Rate constant, k1 (d−1) Half-life, t1/2 (d) R2 Rate constant, k2 (g kg−1d−1) Half-life, t1/2 (d) R2
W1 0.073 9.49 0.9504 0.014 8.99 0.9110
W2 0.060 11.55 0.9427 0.010 12.67 0.9194
W3 0.111 6.24 0.9809 0.032 4.69 0.9522
W4 0.094 7.37 0.9844 0.024 6.33 0.9642
W5 0.123 5.63 0.9985 0.049 3.68 0.9624
W6 0.111 6.24 0.9951 0.041 4.49 0.9616

Staphylococcus sp., Bacillus sp., and Pseudomonas sp. were the bacteria identified from the composting experiments. Bacterial isolates identified by 16SrDNA sequence showed that the sequence presented top matches of >99% to sequences of this genus.

Change of temperature

The values of temperature, as one of the most important parameters used for composting monitoring, were recorded everyday over the whole composting time. Figure 4 shows the similar patterns of temperature changes for the all composting treatments. The temperature in the experiments W1, W2, W3, W4, W5, and W6 peaked on days 29, 37, 23, 28, 19, and 26, respectively. The average and maximum temperatures in the treatments W1, W2, W3, W4, W5, and W6 were 34.33 and 39.00, 31.35 and 37.00, 38.05 and 42.00, 36.55 and 40.50, 38.42 and 42.50, 36.80 and 41.00 °C, respectively. Due to the activity and metabolism of microbial populations involved in petroleum hydrocarbons degradation, the temperature of the composting experiments increases [40]. The effect of temperature enhancement is more solubility of target contaminants which are less bioavailable at lower temperatures. Moreover, toxic and biorefractory compounds are decomposed by thermophilic microorganisms and thus easier biodegradable molecules are produced [41]. Accordingly, the temperatures in the experiments W3, W5 and W6 presenting more TPH removal were higher than those in the other treatments. The mean rate of temperature increase for the treatments W1, W2, W3, W4, W5, and W6 were 0.46, 0.38, 0.73, 0.65, 0.92, and 0.72 °C day −1, respectively. The rate of TPH transformation affects the rate of temperature increase [19, 37]. Accordingly, the treatments W3, W5, and W6 which had the higher removal rates of TPH presented the higher increase rates of temperature. From the highest temperature onwards, it gradually began to drop because of a decrease in the microbial consumption of petroleum hydrocarbons.

Fig. 4.

Fig. 4

Trend of temperature changes over the composting time

Changes in pH and nutrients

As can be seen from Table 4, all the treatments presented a similar pattern of pH changes over the composting time. First, the pH values dropped, and then gradually increased to reach at a relatively constant level. A decline in pH values is owing to the degradation of petroleum compounds which may generate organic acids. Moreover, the pH increase is because of the microbial degradation of generated organic acids and the subsequent release of ammonium [29]. The lowest values of pH occurred in the piles W1, W2, W3, W4, W5, and W6 were 6.89, 6.93, 6.53, 6.77, 6.45, and 6.61, respectively. The higher removal of TPH results in the lower pH in the composting piles. Accordingly, the pH values measured in the experiments W3, W5, and W6 were lower than those in other treatments. A pH of 6.5–8.5 can supports well the microbial populations involved in degradation of petroleum hydrocarbons [34]. In our study, the pH values measured in the composting experiments were within the suitable range needed for microbial activities.

Table 4.

The changes in values of pH, N and P over the composting time

Parameter Composting time (week) Composting experiments
W1 W2 W3 W4 W5 W6
pH 0 7.71 7.72 7.66 7.69 7.62 7.66
2 7.50 7.61 7.13 7.33 7.01 7.20
4 7.28 7.49 6.81 7.10 6.69 6.89
6 6.93 7.17 6.53 6.83 6.45 6.72
8 6.89 6.95 6.57 6.77 6.55 6.61
10 6.98 6.93 6.85 6.85 6.84 6.74
12 7.12 7.02 7.05 6.98 7.03 6.95
14 7.18 7.10 7.08 7.04 7.04 7.01
N (g kg−1) 0 3.59 1.75 5.64 2.65 7.41 3.42
2 3.47 1.70 4.98 2.44 7.00 3.26
4 3.17 1.64 4.60 2.33 6.36 3.11
6 2.96 1.52 4.30 2.12 5.65 3.08
8 2.78 1.47 4.11 1.92 5.32 2.80
10 2.52 1.31 3.80 1.84 5.26 2.60
12 2.31 1.28 3.63 1.75 5.20 2.53
14 2.26 1.24 3.51 1.66 4.95 2.48
P (g kg−1) 0 0.72 0.35 1.13 0.53 1.48 0.68
2 0.69 0.34 0.95 0.49 1.39 0.63
4 0.66 0.32 0.87 0.47 1.22 0.61
6 0.64 0.32 0.81 0.45 1.19 0.54
8 0.63 0.31 0.80 0.45 1.14 0.53
10 0.62 0.30 0.78 0.42 1.12 0.48
12 0.62 0.29 0.74 0.40 1.05 0.47
14 0.61 0.28 0.72 0.40 1.00 0.47

Table 4 also presents the changes of nutrients in the composting experiments. The changes of N and P values over the composting time are because of their consumption by microorganisms which need N and P for hydrocarbons biodegradation. The entrance of N and P into the leachate stream is the main reason for declining their contents in the composting mixtures [34, 42].

Conclusions

The PCS was treated using the windrow composting process. The microbial populations in the composting piles (Staphylococcus sp., Bacillus sp., and Pseudomonas sp.) were able to decompose petroleum hydrocarbons. Compared to FC, application of UC as amendment resulted in higher degradation of TPH. In order to attain the better performance of composting process, it is necessary to optimize the mixing ratio of PCS to amendment materials. The results indicated the effectiveness of composting process for PCS remediation.

Acknowledgements

Authors would like to acknowledge Iran University of Medical Sciences for supporting and funding [Grant Number 92-02-27-23546] this research.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Varjani SJ. Microbial degradation of petroleum hydrocarbons. Bioresour Technol. 2017;223:277–286. doi: 10.1016/j.biortech.2016.10.037. [DOI] [PubMed] [Google Scholar]
  • 2.Han T, Zhao Z, Bartlam M, Wang Y. Combination of biochar amendment and phytoremediation for hydrocarbon removal in petroleum-contaminated soil. Environ Sci Pollut Res. 2016;23(21):21219–21228. doi: 10.1007/s11356-016-7236-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.McWatters RS, Wilkins D, Spedding T, Hince G, Raymond B, Lagerewskij G, et al. On site remediation of a fuel spill and soil reuse in Antarctica. Sci Total Environ. 2016;571:963–973. doi: 10.1016/j.scitotenv.2016.07.084. [DOI] [PubMed] [Google Scholar]
  • 4.Chen M, Xu P, Zeng G, Yang C, Huang D, Zhang J. Bioremediation of soils contaminated with polycyclic aromatic hydrocarbons, petroleum, pesticides, chlorophenols and heavy metals by composting: applications, microbes and future research needs. Biotechnol Adv. 2015;33(6):745–755. doi: 10.1016/j.biotechadv.2015.05.003. [DOI] [PubMed] [Google Scholar]
  • 5.Zabbey N, Sam K, Onyebuchi AT. Remediation of contaminated lands in the Niger Delta, Nigeria: prospects and challenges. Sci Total Environ. 2017;586:952–965. doi: 10.1016/j.scitotenv.2017.02.075. [DOI] [PubMed] [Google Scholar]
  • 6.Farzadkia M, Dehghani M, Moafian M. The effects of Fenton process on the removal of petroleum hydrocarbons from oily sludge in Shiraz oil refinery, Iran. J Environ Health Sci Eng. 2014; 14;12(1):31. [DOI] [PMC free article] [PubMed]
  • 7.Yu Y, Zhang W, Chen G, Gao Y, Wang J. Preparation of petroleum-degrading bacterial agent and its application in remediation of contaminated soil in Shengli oil field. China Environ Sci Pollut Res. 2014;21(13):7929–7937. doi: 10.1007/s11356-014-2707-0. [DOI] [PubMed] [Google Scholar]
  • 8.Martinkosky L, Barkley J, Sabadell G, Gough H, Davidson S. Earthworms (Eisenia fetida) demonstrate potential for use in soil bioremediation by increasing the degradation rates of heavy crude oil hydrocarbons. Sci Total Environ. 580:734–43. [DOI] [PubMed]
  • 9.Suja F, Rahim F, Taha MR, Hambali N, Razali MR, Khalid A, et al. Effects of local microbial bioaugmentation and biostimulation on the bioremediation of total petroleum hydrocarbons (TPH) in crude oil contaminated soil based on laboratory and field observations. Int Biodeterior Biodegrad. 2014;90:115–122. doi: 10.1016/j.ibiod.2014.03.006. [DOI] [Google Scholar]
  • 10.Mattei P, Cincinelli A, Martellini T, Natalini R, Pascale E, Renella G. Reclamation of river dredged sediments polluted by PAHs by co-composting with green waste. Sci Total Environ:566–567–7–574. [DOI] [PubMed]
  • 11.Koolivand A, Naddafi K, Nabizadeh R, Jafari A, Nasseri S, Yunesian M, Yaghmaeian K, Alimohammadi M. Application of hydrogen peroxide and Fenton as pre-and post-treatment steps for composting of bottom sludge from crude oil storage tanks. Pet Sci Technol. 2014;32(13):1562–1568. doi: 10.1080/10916466.2012.697961. [DOI] [Google Scholar]
  • 12.Morillo E, Villaverde J. Advanced technologies for the remediation of pesticide-contaminated soils. Sci Total Environ. 2017;586:576–597. doi: 10.1016/j.scitotenv.2017.02.020. [DOI] [PubMed] [Google Scholar]
  • 13.Talaiekhozani A, Jafarzadeh N, Fulazzaky MA, Talaie MR, Beheshti M. Kinetics of substrate utilization and bacterial growth of crude oil degraded by Pseudomonas aeruginosa. J Environ Health Sci Eng. 2015;24;13(1):64. [DOI] [PMC free article] [PubMed]
  • 14.Wu M, Li W, Dick WA, Ye X, Chen K, Kost D, Chen L. Bioremediation of hydrocarbon degradation in a petroleum contaminated soil and microbial population and activity determination. Chemosphere. 2017;169:124–130. doi: 10.1016/j.chemosphere.2016.11.059. [DOI] [PubMed] [Google Scholar]
  • 15.Zhang X, Liu X, Wang Q, Chen X, Li H, Wei J, Xu G. Diesel degradation potential of endophytic bacteria isolated from Scirpus triqueter. Int Biodeterior Biodegrad. 2014;87:99–105. doi: 10.1016/j.ibiod.2013.11.007. [DOI] [Google Scholar]
  • 16.Zhang Y, Guan Y, Shi Q. Simulating the dynamics of polycyclic aromatic hydrocarbon (PAH) in contaminated soil through composting by COP-compost model. Environ Sci Pollut Res. 2015;22(4):3004–3012. doi: 10.1007/s11356-014-3563-7. [DOI] [PubMed] [Google Scholar]
  • 17.Asgari A, Nabizadeh R, Mahvi AH, Nasseri S, Dehghani MH, Nazmara S, et al. Biodegradation of total petroleum hydrocarbons from acidic sludge produced by re-refinery industries of waste oil using in-vessel composting. J Environ Health Sci Eng. 2017; 27;15(1):3. [DOI] [PMC free article] [PubMed]
  • 18.Kasinski S, Slota M, Markowski M, Kaminska A. Municipal waste stabilization in a reactor with an integrated active and passive aeration system. Waste Manag. 2016;50:31–38. doi: 10.1016/j.wasman.2016.02.012. [DOI] [PubMed] [Google Scholar]
  • 19.Ma J, Yang Y, Dai X, Chen Y, Deng H, Zhou H, Guo S, Yan G. Effects of adding bulking agent, inorganic nutrient and microbial inocula on biopile treatment for oil-field drilling waste. Chemosphere. 2016;150:17–23. doi: 10.1016/j.chemosphere.2016.01.123. [DOI] [PubMed] [Google Scholar]
  • 20.Rossini-Oliva S, Mingorance M, Peña A. Effect of two different composts on soil quality and on the growth of various plant species in a polymetallic acidic mine soil. Chemosphere. 2017;168:183–190. doi: 10.1016/j.chemosphere.2016.10.040. [DOI] [PubMed] [Google Scholar]
  • 21.Zazouli MA, Asgharnia H, Yazdani Cherati J, Ziaee Hezarjeribi H, Ahmadnezhad A. Evaluation of cow manure effect as bulking agent on concentration of heavy metals in municipal sewage sludge vermicomposting. JMUMS. 2015;25(124):152–169. [Google Scholar]
  • 22.Lukić B, Huguenot D, Panico A, Fabbricino M, van Hullebusch ED, Esposito G. Importance of organic amendment characteristics on bioremediation of PAH-contaminated soil. Environ Sci Pollut Res. 2016;23(15):15041–15052. doi: 10.1007/s11356-016-6635-z. [DOI] [PubMed] [Google Scholar]
  • 23.Sayara T, Sarrà M, Sánchez A. Optimization and enhancement of soil bioremediation by composting using the experimental design technique. Biodegradation. 2010;21(3):345–356. doi: 10.1007/s10532-009-9305-8. [DOI] [PubMed] [Google Scholar]
  • 24.Koolivand A, Godini K, Saeedi R, Abtahi H, Ghamari F. Oily sludge biodegradation using a new two-phase composting method: kinetics studies and effect of aeration rate and mode. Process Biochem. 2018;79:127–134. doi: 10.1016/j.procbio.2018.12.003. [DOI] [Google Scholar]
  • 25.Koolivand A, Rajaei MS, Ghanadzadeh MJ, Saeedi R, Abtahi H, Godini K. Bioremediation of storage tank bottom sludge by using a two-stage composting system: effect of mixing ratio and nutrients addition. Bioresour Technol. 235: 240–249. [DOI] [PubMed]
  • 26.TNRCC . Revision 03. Texas Natural Resource Conservation: Commission; 2001. Total petroleum hydrocarbons, method 1005. [Google Scholar]
  • 27.TMECC . Test methods for the examination of composting and compost. 2002. [Google Scholar]
  • 28.APHA (American Public Health Association) Standard methods for the examination of water and wastewater. Washington, DC, USA: APHA-AWWA-WEF; 2011. [Google Scholar]
  • 29.Nwankwegu AS, Orji MU, Onwosi CO. Studies on organic and in-organic biostimulants in bioremediation of diesel-contaminated arable soil. Chemosphere. 2016;162:148–156. doi: 10.1016/j.chemosphere.2016.07.074. [DOI] [PubMed] [Google Scholar]
  • 30.Yanto DHY, Tachibana S. Potential of fungal co-culturing for accelerated biodegradation of petroleum hydrocarbons in soil. J Hazard Mater. 2014;278:454–463. doi: 10.1016/j.jhazmat.2014.06.039. [DOI] [PubMed] [Google Scholar]
  • 31.Koolivand A, Naddafi K, Nabizadeh R, Nasseri S, Jafari AJ, Yunesian M, Yaghmaeian K. Degradation of petroleum hydrocarbons from bottom sludge of crude oil storage tanks using in-vessel composting followed by oxidation with hydrogen peroxide and Fenton. J Mater Cycles Waste Manage. 2013;15(3):321–327. doi: 10.1007/s10163-013-0121-1. [DOI] [Google Scholar]
  • 32.Koolivand A, Naddafi K, Nabizadeh R, Nasseri S, Jafari AJ, Yunesian M, Yaghmaeian K, Nazmara S. Biodegradation of petroleum hydrocarbons of bottom sludge from crude oil storage tanks by in-vessel composting. Toxicol Environ Chem. 2013;95(1):101–109. doi: 10.1080/02772248.2012.753073. [DOI] [Google Scholar]
  • 33.Koolivand A, Naddafi K, Nabizadeh R, Saeedi R. Optimization of combined in-vessel composting process and chemical oxidation for remediation of bottom sludge of crude oil storage tanks. Environ Technol. 2018;39(20):2597–2603. doi: 10.1080/09593330.2017.1362037. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang L, Sun X. Influence of bulking agents on physical, chemical, and microbiological properties during the two-stage composting of green waste. Waste Manag. 2016;48:115–126. doi: 10.1016/j.wasman.2015.11.032. [DOI] [PubMed] [Google Scholar]
  • 35.Wang SY, Kuo YC, Hong A, Chang YM, Kao CM. Bioremediation of diesel and lubricant oil-contaminated soils using enhanced landfarming system. Chemosphere. 2016;164:558–567. doi: 10.1016/j.chemosphere.2016.08.128. [DOI] [PubMed] [Google Scholar]
  • 36.Zhang Y, Zhu Y-G, Houot S, Qiao M, Nunan N, Garnier P. Remediation of polycyclic aromatic hydrocarbon (PAH) contaminated soil through composting with fresh organic wastes. Environ Sci Pollut Res. 2011;18(9):1574–1584. doi: 10.1007/s11356-011-0521-5. [DOI] [PubMed] [Google Scholar]
  • 37.Kulikowska D. Kinetics of organic matter removal and humification progress during sewage sludge composting. Waste Manag. 2016;49:196–203. doi: 10.1016/j.wasman.2016.01.005. [DOI] [PubMed] [Google Scholar]
  • 38.Gomez F, Sartaj M. Field scale ex-situ bioremediation of petroleum contaminated soil under cold climate conditions. Int Biodeterior Biodegrad. 2013;85:375–382. doi: 10.1016/j.ibiod.2013.08.003. [DOI] [Google Scholar]
  • 39.He XS, Xi BD, Zhang ZY, Gao RT, Tan WB, Cui DY. Insight into the evolution, redox, and metal binding properties of dissolved organic matter from municipal solid wastes using two-dimensional correlation spectroscopy. Chemosphere. 2014;117:701–707. doi: 10.1016/j.chemosphere.2014.09.060. [DOI] [PubMed] [Google Scholar]
  • 40.Cui E, Wu Y, Zuo Y, Chen H. Effect of different biochars on antibiotic resistance genes and bacterial community during chicken manure composting. Bioresour Technol. 2016;203:11–17. doi: 10.1016/j.biortech.2015.12.030. [DOI] [PubMed] [Google Scholar]
  • 41.Fountoulakis M, Terzakis S, Georgaki E, Drakopoulou S, Sabathianakis I, Kouzoulakis M, Manios T. Oil refinery sludge and green waste simulated windrow composting. Biodegradation. 2009;20(2):177–189. doi: 10.1007/s10532-008-9211-5. [DOI] [PubMed] [Google Scholar]
  • 42.Zhang Q, Zhu L, Su J, Wang J, Xie H, Wang J, Wang F. Impacts of nitrogen and phosphorus on atrazine-contaminated soil remediation and detoxification by Arthrobacter sp. strain HB-5. Environ Earth Sci. 2014;71(3):1465–1471. doi: 10.1007/s12665-013-2551-4. [DOI] [Google Scholar]

Articles from Journal of Environmental Health Science and Engineering are provided here courtesy of Springer

RESOURCES