Skip to main content
Journal of Applied Physiology logoLink to Journal of Applied Physiology
. 2019 Nov 21;128(1):87–99. doi: 10.1152/japplphysiol.00495.2019

Effects of aging and lifelong aerobic exercise on basal and exercise-induced inflammation

Kaleen M Lavin 1, Ryan K Perkins 1, Bozena Jemiolo 1, Ulrika Raue 1, Scott W Trappe 1, Todd A Trappe 1,✉
PMCID: PMC6985808  PMID: 31751180

Abstract

Age-associated chronic basal inflammation compromises muscle mass and adaptability, but exercise training may exert an anti-inflammatory effect. This investigation assessed basal and exercise-induced inflammation in three cohorts of men: young exercisers [YE; n = 10 men; 25 ± 1 yr; maximal oxygen consumption (V̇o2max), 53 ± 3 mL·kg−1·min−1; quadriceps area, 78 ± 3 cm2; means ± SE], old healthy nonexercisers (OH; n = 10; 75 ± 1 yr; V̇o2max, 22 ± 1 mL·kg−1·min−1; quadriceps area, 56 ± 3 cm2), and lifelong exercisers with an aerobic training history of 53 ± 1 yr (LLE; n = 21; 74 ± 1 yr; V̇o2max, 34 ± 1 mL·kg−1·min−1; quadriceps area, 67 ± 2 cm2). Resting serum IL-6, TNF-α, C-reactive protein, and IGF-1 levels were measured. Vastus lateralis muscle biopsies were obtained at rest (basal) and 4 h after an acute exercise challenge (3 × 10 repetitions, 70% 1-repetition maximum) to assess gene expression of cytokines [IL-6, TNF-α, IL-1β, IL-10, IL-4, interleukin-1 receptor antagonist (IL-1Ra), and transforming growth factor-β (TGF-β)], chemokines [IL-8 and monocyte chemoattractant protein-1 (MCP-1)], cyclooxygenase enzymes [cyclooxygenase-1 and -2 (COX-1 and COX-2, respectively), prostaglandin E2 synthases [microsomal prostaglandin E synthase 1 (mPGES-1) and cytosolic prostaglandin E2 synthase (cPGES)] and receptors [prostaglandin E2 receptor EP3 and EP4 subtypes (EP3 and EP4, respectively), and macrophage markers [cluster of differentiation 16b (CD16b) and CD163], as well as basal macrophage abundance (CD68+ cells). Aging led to higher (P ≤ 0.05) circulating IL-6 and skeletal muscle COX-1, mPGES-1, and CD163 expression. However, LLE had significantly lower serum IL-6 levels (P ≤ 0.05 vs. OH) and a predominantly anti-inflammatory muscle profile [higher IL-10 (P ≤ 0.05 vs. YE), TNF-α, TGF-β, and EP4 levels (P ≤ 0.05 vs. OH)]. In OH only, acute exercise increased expression of proinflammatory factors TNF-α, TGF-β, and IL-8 (P ≤ 0.05). LLE had postexercise gene expression similar to YE, except lower IL-10 (P ≤ 0.10), mPGES-1, and EP3 expression (P ≤ 0.05). Thus, although aging led to a proinflammatory profile within blood and muscle, lifelong exercise partially prevented this and generally preserved the acute inflammatory response to exercise seen in young exercising men. Lifelong exercise may positively impact muscle health throughout aging by promoting anti-inflammation in skeletal muscle.

NEW & NOTEWORTHY This study assessed a unique population of lifelong aerobic exercising men and demonstrated that their activity status exerts an anti-inflammatory effect in skeletal muscle and circulation. Furthermore, we provide evidence that the inflammatory response to acute exercise is dysregulated by aging but preserved with lifelong exercise, which might improve skeletal muscle resilience to unaccustomed loading and adaptability into late life.

Keywords: acute exercise, inflammaging, inflammation, lifelong exercise, skeletal muscle

INTRODUCTION

Chronic low-grade inflammation throughout aging (“inflammaging”) threatens functional capacity, independence, and quality of life in older individuals (20, 21). Inflammaging has also been associated with sarcopenia, muscle atrophy, and accompanying functional deficits in older adults (66, 67, 85), likely through its negative impact on muscle protein balance (33, 70, 84). Further supporting this connection, chronic anti-inflammatory drug consumption in older adults appears beneficial for muscle mass and performance (6, 32, 39).

Skeletal muscle plays an important role in inflammatory signaling: factors such as cytokines, prostaglandins, and chemokines can be both released (37, 52, 55) and taken up (51, 84) by muscle at rest and following exercise. Aging has been shown to alter these factors in skeletal muscle (35, 56), which may contribute to poor communication with inflammatory cells (e.g., macrophages), dysregulated protein balance, and impaired resolution of inflammation following a stimulus, such as muscle loading. In aging individuals, exaggerated or sustained inflammation following exercise may contribute to suboptimal muscle adaptations (17, 38, 68). Our laboratory previously found that older adults taking anti-inflammatory drugs throughout resistance training demonstrated superior muscle growth over placebo (78, 80), suggesting that chronic low-grade muscle inflammation may dysregulate the exercise response and interfere with adaptation. Thus, to reverse age-related muscle mass losses, basal inflammation may need to be controlled (1), or exercise training prescriptions may need to be designed to overcome the basal inflammatory burden (3, 65). Resistance exercise in particular is a potent antisarcopenic stimulus that targets both slow-twitch (oxidative, type I) and fast-twitch (glycolytic, type II) muscle fibers (31, 80), the latter of which are a notable casualty of the aging process (50).

However, although short-term training studies have demonstrated reductions in basal systemic inflammation in older adults (4), this finding is not universal within muscle (17, 81). Thus, rather than attempt to reverse age-related declines in muscle health, the optimal exercise strategy might seek to prevent them. Recent research has examined the impact of lifelong exercise (adherence to a structured exercise program throughout the adult life span into and beyond retirement age; 13, 24). Previous studies have demonstrated superior cardiovascular health and skeletal muscle mass in lifelong aerobic exercisers compared with age-matched nonexercising control subjects (12, 41, 76). Though limited, evidence from 50–65-yr-old populations suggests that these benefits are accompanied by a more favorable circulating inflammatory profile (42, 43) and an improved molecular environment within muscle (64). Thus, the aims of this investigation were to examine skeletal muscle to assess the basal inflammatory profile and inflammatory response to an acute resistance exercise challenge in lifelong exercisers, young exercisers, and old healthy nonexercisers. These objectives were met with a comprehensive analysis of 23 targets related to inflammation in muscle, macrophages, and circulation.

METHODS

Subjects

Old lifelong exercisers (LLE, n = 21 men), old healthy nonexercisers (OH, n = 10), and young exercisers (YE, n = 10) were included in this investigation (Table 1). Subjects were recruited from the greater Muncie, Indiana, area by newspaper advertisements, mailed flyers, and personal interaction. More extensive subject characteristics and more details regarding the recruitment and screening process, along with cardiovascular and skeletal muscle profiles, are presented by our research team elsewhere (13, 24). Enrolled individuals were free from acute or chronic illness (cardiac, pulmonary, liver, or kidney abnormalities, cancer, uncontrolled hypertension, and insulin- or noninsulin-dependent diabetes or other known metabolic disorders), free from orthopedic limitations (including any artificial joints), and did not smoke or participate in other forms of tobacco use. The study was approved by the Institutional Review Board of Ball State University. All study procedures, risks, and benefits were explained to the subjects before they gave written consent to participate.

Table 1.

Subject characteristics

Lifelong Exercisers
YE Combined LLE-P LLE-F OH
n 10 21 14 7 10
Age, yr 25 ± 1* 74 ± 1 74 ± 1 75 ± 2 75 ± 1
Height, cm 181 ± 2 180 ± 2 179 ± 2 182 ± 3 177 ± 2
Weight, kg 75 ± 3 79 ± 2 77 ± 2 83 ± 5 88 ± 3*
BMI, kg/m2 23 ± 1 24 ± 1 24 ± 1 25 ± 1 28 ± 1*
Body fat, % 18 ± 2* 24 ± 1† 22 ± 1‡ 27 ± 1 32 ± 1
V̇o2max, mL·kg−1·min−1 53 ± 3* 34 ± 1† 38 ± 1‡ 27 ± 2 22 ± 1
Quadriceps size, cm2 78 ± 3* 67 ± 2† 68 ± 2 65 ± 3 56 ± 3
Quadriceps strength, N·m 210 ± 12* 165 ± 6† 166 ± 8 163 ± 10 134 ± 9
Quadriceps power, W 699 ± 30* 370 ± 19 365 ± 13 377 ± 50 318 ± 42
Handgrip strength, kg 51 ± 3 46 ± 2 48 ± 3 43 ± 2 44 ± 1
Steps per day 9,404 ± 635 9,560 ± 619 9,369 ± 725 10,006 ± 1,265 5,813 ± 488*

Values are means ± SE; n = no. of subjects. Additional cardiovascular and skeletal muscle data, as well as details of body fat (dual-energy X-ray absorptiometry), maximal oxygen consumption (V̇o2max), muscle size (MRI) and function, and steps-per-day measurements are presented by us elsewhere (13, 24). BMI, body mass index; LLE-F, lifelong exercisers-Fitness; LLE-P, lifelong exercisers-Performance; OH, old healthy nonexercisers; YE, young exercisers.

*

P ≤ 0.05 vs. main groups;

†

P ≤ 0.05 vs. OH;

‡

P ≤ 0.05 LLE-P vs. LLE-F.

Exercise history of the subjects was carefully evaluated using a comprehensive questionnaire and confirmed through personal interviews (Table 2). The LLE cohort consisted primarily of cyclists and runners who reported ~50 yr of structured exercise. LLE trained ~5 days and ~7 h per week. Exercise history of LLE subjects was extensively reviewed for frequency, duration, intensity, and athletic achievements. As such, two clear LLE subgroups emerged: one group that participated in lower-intensity training for physical fitness (Fitness, LLE-F; n = 7) and another group that trained more vigorously and often participated in competitive events (Performance, LLE-P; n = 14).

Table 2.

Exercise training histories

Lifelong Exercisers
YE Combined LLE-P LLE-F OH
Total training, yr 5 ± 1* 53 ± 1 53 ± 1 53 ± 3
Competitive focus Yes Yes No
Lifetime average
    Frequency, days/wk 4.5 ± 0.2 4.4 ± 0.2 4.6 ± 0.3
    Duration, h/wk 7.3 ± 0.5 7.6 ± 0.7 6.6 ± 0.9
    Intensity 2.0 ± 0.1 2.1 ± 0.1† 1.8 ± 0.1
Current decade
    Frequency, days/wk 5.1 ± 0.2 4.7 ± 0.3 4.5 ± 0.3 4.9 ± 0.7
    Duration, h/wk 7.0 ± 0.7 8.1 ± 1.1 8.5 ± 1.4 7.4 ± 1.9
    Intensity 2.8 ± 0.1* 2.0 ± 0.1 2.2 ± 0.1† 1.5 ± 0.2

Values are means ± SE. Competitive focus indicates whether exercise training for the purpose of competition was currently or once a primary goal for the majority of the group. Lifetime average reflects current decade exercise habits for young exercisers (YE). Levels of self-reported training intensity were as follows: 1 (light), 2 (moderate), and 3 (hard). In the case that a subject reported >1 training intensity level, values were weighted and averaged (e.g., 80% of training at a 2 and 20% of training at a 3 resulted in an overall intensity of 2.2). More detailed exercise training histories are presented by us elsewhere (24). LLE-F, lifelong exercisers-Fitness; LLE-P, lifelong exercisers-Performance; OH, old healthy nonexercisers.

*

P ≤ 0.05 vs. lifelong exercisers combined;

†

P ≤ 0.05 LLE-P vs. LLE-F.

Serum Inflammatory Markers

A resting, fasted blood draw was taken for measurement of circulating inflammatory markers. Samples were analyzed (LabCorp, Muncie, IN) for serum C-reactive protein (latex immunoturbidimetry), IL-6 and TNF-α (enzyme-linked immunosorbent assay), and IGF-1 (immunochemiluminometric assay).

Acute Exercise Trial and Skeletal Muscle Biopsies

Subjects completed a resistance exercise challenge of the knee extensors, consisting of 3 sets of 10 repetitions at 70% 1-repetition maximum, with 2-min rest between each set. When completed chronically, this acute exercise stimulus elicits significant increases in muscle size and strength in young and old individuals (61, 68, 75, 77, 88). Muscle biopsies (5) of the vastus lateralis were obtained before and 4 h after the resistance exercise challenge. This postexercise time point reflects an optimal time for interrogating expression of numerous intramuscular regulators of muscle adaptation, including cytokine activity (37, 58–60, 62, 89). All biopsies were obtained in the fasted state (≥10 h), after at least 30 min of supine rest. Subjects remained in the laboratory and rested quietly during the 4-h postexercise period. Subjects also refrained from structured exercise and aspirin consumption for 72 h, alcohol consumption for 24 h, and caffeine the morning of the trial.

Following each muscle biopsy, excess blood, visible fat, and connective tissue were removed, and a portion of the muscle (~20 mg) to be used for mRNA analysis was immediately frozen and then stored in liquid nitrogen. Prior to analysis, the muscle was transferred to 0.5 mL of RNAlater-ICE (Ambion, Austin, TX) and stored at −20°C until analysis. A portion of the muscle to be used for immunohistochemistry was oriented longitudinally in a mounting medium (tragacanth gum; Sigma, St. Louis, MO) atop a cork, frozen in isopentane cooled in liquid nitrogen, and subsequently stored in liquid nitrogen until analysis.

Gene Expression Measurements

Inflammatory factors listed in Table 3 were assessed in vastus lateralis skeletal muscle homogenates using real-time quantitative polymerase chain reaction (qPCR). Muscle mRNA analyses were completed on all 41 subjects for basal expression (i.e., preexercise) and on 39 subjects for expression 4 h postexercise (i.e., 2 individuals did not undergo the postexercise biopsy: 1 from LLE and 1 from OH).

Table 3.

Nomenclature, gene information, and mRNA primer characteristics

Common Name Gene Symbol Accession No. Sequence (5′→3′) Amplicon Size, bp mRNA Region, bp Annealing Temperature, °C
Proinflammatory cytokines
IL-1β IL1B NM_000576.2 GGATATGGAGCAACAAGTGGTG
CGCAGGACAGGTACAGATTCT
113 661–773 61
TNF-α TNF NM_000594.3 CCCAGGCAGTCAGATCATCTTCTCGAA
CTGGTTATCTCTCAGCTCCACGCCATT
149 390–538 60
Anti-inflammatory cytokines
IL-10 IL10 NM_000572.2 GGCGCTGTCATCGATTTCTTCC
GGCTTTGTAGATGCCTTTCTCTTG
101 430–530 60
IL-4 IL4 NM_000589.3b TCTTCCTGCTAGCATGTGCC
TGTTACGGTCAACTCGGTGC
128 100–227 60
IL-1Ra IL1RN NM_173842.2c AGCTGGAGGCAGTTAACATCA
ACTCAAAACTGGTGGTGGGG
102 375–476 60
Pleiotropic cytokines
IL-6 IL6 NM_000600.4 CTATGAACTCCTTCTCCACAAGCGCCTT
GGGGCGGCTACATCTTTGGAATCTT
127 61–187 60
TGF-β TGFB1 NM_000660.6 ACCAACTATTGCTTCAGCTCCA
GAAGTTGGCATGGTAGCCCT
120 1,683–1,802 60
PGE2/COX pathway components
COX-1v1a PTGS1 NM_000962 CCCAGGAGTACAGCTACGAGCAGTTCTT
CCAGCAATCTGGCGAGAGAAGGCAT
101 1,327–1,427 60
COX-1v2a PTGS1 NM_080591 GTCCAGTTCCAATACCGCAACCGCAT
CCACCGATCTTGAAGGAGTCAGGCAT
92 1,237–1,328 60
COX-2 PTGS2 NM_000963.3 TTGCTGGCAGGGTTGCTGGTGGTA
CATCTGCCTGCTCTGGTCAATGGAA
86 1,381–1,466 60
cPGES PTGES3 NM_006601.6 AGGCCCGCCCACCAGTTCGC
AGTCCCTTCGATCGTACCACTTTGCAG
82 254–335 60
mPGES-1 PTGES NM_004878.4 CGGAAGAAGGCCTTTGCCAACC
GGGTAGATGGTCTCCATGTCGTTCC
125 171–295 60
EP3 PTGER3 NM_198715.2d CTGGTCTCCGCTCCTGATAA
TTCAGTGAAGCCAGGCGAAC
132 1,113–1,244 60
EP4 PTGER4 NM_000958.2 GCTCGTGGTGCGAGTATTCGTCAACC
TCCAGGGGTCTAGGATGGGGTTCA
122 1,453–1,574 60
Chemokines and macrophage surface markers
IL-8 CXCL8 NM_000584.3 GCTCTGTGTGAAGGTGCAGTTTTGCCAA
GGCGCAGTGTGGTCCACTCTCAAT
135 153–287 60
MCP-1 CCL2 NM_002982.3 GCAATCAATGCCCCAGTCAC
CTTGAAGATCACAGCTTCTTTGGG
123 152–274 60
CD16b FCGR3B NM_001271037.1 CCAGGCCTCGAGCTACTTCA
TGCCAAACCGATATGGACTTCT
121 441–561 60
CD163 CD163 NM_004244.5e CCCAGTGAGTTCAGCCTTTA
TCAGCAGCAGTCTTAGGAATC
140 3,600–3,739 60

Top sequence reflects the forward primer, and bottom sequence reflects the reverse primer. CD16b, cluster of differentiation 16b [Fc fragment of IgG receptor IIIb (FCGR3B)]; COX-1, cyclooxygenase-1 [prostaglandin-endoperoxide synthase 1 (PTGS1)]; COX-2, cyclooxygenase-2 [prostaglandin-endoperoxide synthase 2 (PTGS2)]; cPGES, cytosolic prostaglandin E2 synthase [prostaglandin E synthase 3 (PTGES3)]; EP3, prostaglandin E2 receptor EP3 subtype [prostaglandin E receptor 3 (PTGER3)]; EP4, prostaglandin E2 receptor EP4 subtype [prostaglandin E receptor 4 (PTGER4)]; IL-1Ra, interleukin-1 receptor antagonist (IL1RN); IL-8, interleukin-8 [C-X-C motif chemokine ligand 8 (CXCL8)]; MCP-1, monocyte chemoattractant protein-1 [C-C motif chemokine ligand 2 (CCL2)]; mPGES-1, microsomal prostaglandin E synthase 1 [prostaglandin E synthase (PTGES)]; TGF-β, transforming growth factor-β [transforming growth factor-β1 (TGFB1)].

a

One primer was designed for each variant (v) of COX-1 based on our previous research (87);

b

Primers detect variant 1 isoform 1 (NM_000589.3);

c

Primers detect all variants: variant 1 isoform 1 (NM_173842.2), variant 2 isoform 2 (NM_173841.2), variant 3 isoform 3 (NM_000577.4), variant 4 isoform 4 (NM_173843.2), and variant 5 isoform 4 (NM_001318914.1);

d

Primer detects variant 4 isoform 4 (NM_198714.1), variant 5 isoform 5 (NM_198715.2), variant 6 isoform 6 (NM_198716.1), variant 7 isoform 7 (NM_198717.1), variant 8 isoform 8 (NM_198718.1), variant 9 isoform 4 (NM_198719.1), and variant 11 isoform 4 (NM_001126044.1);

e

Primer detects both variant 1 isoform a (NM_004244.5) and variant 2 isoform b (NM_203416.3).

Total RNA extraction and quality check.

Total RNA was extracted in TRI Reagent RT (Molecular Research Center, Cincinnati, OH). The quality and integrity (RNA integrity number = 8.34 ± 0.05, mean ± SE) of extracted RNA (94.24 ± 3.97 ng/µL) were evaluated using an RNA 6000 Nano LabChip kit on an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) as previously described (29, 78).

Real-time polymerase chain reaction.

Oligo(dT) primed first-strand cDNA was synthesized (96–144 ng of total RNA, depending on magnitude of target gene expression) using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA). For each target, quantification of mRNA levels was performed in duplicate in a 72-well Rotor-Gene Q Centrifugal Real-Time Cycler (Qiagen, Germantown, MD). Ribosomal protein lateral stalk subunit P0 (RPLP0) was selected as a housekeeping/reference gene, as previously done in human muscle (48). RPLP0 expression was similar among the three groups at baseline [threshold cycle (CT), 19.02 ± 0.03] and stable after exercise (CT, 19.01 ± 0.03). All primers used in this study were mRNA specific (on different exons and/or crossing over an intron) and designed for qPCR [Vector NTI Advance 9 software (Invitrogen) and Primer Design Tool (Entrez) National Center for Biotechnology Information Primer-Basic Local Alignment Search Tool (BLAST) program] using SYBR Green chemistry (29). Primers details are presented in Table 3. A melting-curve analysis was generated for all PCR runs to validate that only one product was present. For each run, a serial dilution curve was made using cDNA from a known amount (500–2,000 ng) of human skeletal muscle RNA (Ambion) or from human muscle samples collected in our laboratory. The amplification calculated by the Rotor-Gene software was specific and highly efficient (efficiency = 1.02 ± 0.01; R2 = 0.98 ± 0.00; slope = 3.29 ± 0.03). Basal gene expression among YE, LLE, and OH was compared using the 2−ΔCT (arbitrary units) method. Gene expression before and after the resistance exercise challenge was compared using the 2−ΔΔCT (fold change) relative quantification method, as previously described (36, 37, 70, 81). On the basis of the principle of the calculation, it was determined that the preexercise value and the associated variability should be very close to 1 for each group. In the present study, this was true of all genes analyzed, and preexercise 2−ΔΔCT values were not statistically different among the three groups or between subgroups (P > 0.05). Therefore, to simplify interpretation, preexercise expression for each gene is graphically represented as a dotted line at 1.0-fold.

Immunohistochemistry

For histochemical detection of skeletal muscle macrophages, transverse sections (7 µm) for histochemical analysis were cut on a microtome-cryostat (HM 525; Microm, Walldorf, Germany) at −20°C. Prior to staining, sections were air-dried in a humidified chamber for 30 min and then fixed in cold (−20°C) acetone for 10 min and rehydrated in PBS for 5 min. Endogenous peroxidase activity was quenched with 0.3% peroxide. Sections were incubated in anti-cluster of differentiation 68 (CD68) primary antibody (1:100 dilution in PBS, M0718; Dako, Carpinteria, CA) at 4°C overnight (15 h) in a humidified chamber. Sections were treated using HistoStain Kit (Invitrogen, Frederick, MD), visualized using aminoethyl carbazole (AEC) single solution substrate (Invitrogen), and then counterstained with hematoxylin (Gill no. 3; Sigma) for 30 s. All analyses included a CD68 negative control (no primary antibody during incubation) and an internal positive control [skeletal muscle biopsy obtained following a damaging exercise protocol similar to those shown to elicit macrophage infiltration (87)]. Positive and negative control slides were included in all analyses. A sample image from a lifelong exercise subject is shown in Fig. 1. Macrophage abundance is represented as CD68+ cells per 100 fibers [the number of CD68+ cells relative to the number of muscle fibers assessed (109 ± 4 fibers per subject), multiplied by a factor of 100] and CD68+ cell density [number of CD68+ cells in an analyzed area of muscle (645,271 ± 6,721 µm2 per subject)]. All measurements were completed by two independent investigators and averaged to represent each sample.

Fig. 1.

Fig. 1.

Representative cross section from vastus lateralis skeletal muscle of a lifelong exerciser. Arrows indicate immunohistochemically stained cluster of differentiation 68-positive (CD68+) cells (red); hematoxylin-stained nuclei appear purple.

Statistical Analyses

Data were analyzed with a one-way analysis of variance (ANOVA) to compare subject characteristics, training histories, serum inflammatory factor levels, macrophage parameters, and basal gene expression (2−ΔCT method) among the three main groups (YE, LLE, and OH) and between LLE subgroups (LLE-F and LLE-P). A two-way ANOVA (group × time) was completed to evaluate gene expression (2−ΔΔCT method) in response to exercise among the three main groups and LLE subgroups. Follow-up one-way ANOVAs were used to compare basal gene expression and postexercise expression levels between YE and both old groups combined (LLE and OH). Post hoc comparisons were made with Tukey’s test. Significance was accepted at P ≤ 0.05. Data are presented as means ± SE.

RESULTS

Basal Circulating Inflammatory Factors

Serum concentrations of inflammatory factors are shown in Table 4. IL-6 levels were lower (P ≤ 0.05) in young exerciser (YE) and lifelong exerciser (LLE) men than in old healthy nonexerciser (OH) men. Serum TNF-α and C-reactive protein (CRP) levels were not different among groups (P > 0.05). Both LLE and OH had 43% lower (P ≤ 0.05) IGF-1 levels than YE. However, the Performance subgroup (LLE-P) had higher (P ≤ 0.05) IGF-1 levels (+23%) than the Fitness subgroup (LLE-F). IL-6, TNF-α, and CRP levels were not different (P > 0.05) between LLE-F and LLE-P.

Table 4.

Basal serum concentrations of inflammatory factors and intramuscular macrophage abundance

Lifelong Exercisers
YE Combined LLE-P LLE-F OH
Serum inflammatory factors
IL-6, pg/mL 0.9 ± 0.1 2.0 ± 0.2† 2.1 ± 0.2 1.8 ± 0.4 3.9 ± 1.2*
TNF-α, pg/mL 1.7 ± 0.2 1.7 ± 0.1 1.6 ± 0.1 1.9 ± 0.3 1.3 ± 0.2
CRP, mg/L 0.6 ± 0.2 0.8 ± 0.1 0.8 ± 0.1 0.9 ± 0.3 0.8 ± 0.1
IGF-1, ng/mL 204 ± 14 116 ± 5* 124 ± 6‡ 101 ± 5 117 ± 12*
Intramuscular macrophage abundance
CD68+, cells per 100 fibers 7.8 ± 1.4 8.0 ± 0.7 8.3 ± 0.8 7.3 ± 1.4 6.8 ± 1.1
CD68+, cells/mm2 13.0 ± 2.4 12.8 ± 1.2 13.4 ± 1.5 11.2 ± 2.0 11.7 ± 2.0

Values are means ± SE. CD68, cluster of differentiation 68; CRP, C-reactive protein; LLE-F, lifelong exercisers-Fitness; LLE-P, lifelong exercisers-Performance; OH, old healthy nonexercisers; YE, young exercisers.

*

P ≤ 0.05 vs. YE;

†

P ≤ 0.05 vs. OH;

‡

P ≤ 0.05 LLE-P vs. LLE-F.

Basal Muscle Macrophage Abundance

Skeletal muscle macrophage parameters also appear in Table 4. CD68+ cells per 100 fibers and CD68+ cell density were similar (P > 0.05) across all three groups and between the LLE subgroups.

Basal Skeletal Muscle Inflammation

Basal muscle cytokine expression among YE, LLE, and OH is presented in Fig. 2A (proinflammatory) and Fig. 3A (anti-inflammatory). TNF-α expression tended (P ≤ 0.10) to be lower in OH than in YE (−55%) and was significantly lower (P ≤ 0.05) than in LLE (−62%). LLE also had higher expression (P ≤ 0.05) of anti-inflammatory IL-10 (+130% vs. YE) and transforming growth factor-β (TGF-β; +66% vs. OH). As shown in the LLE subgroup summary (Table 5), higher (P ≤ 0.05) gene expression in LLE-F than in LLE-P may have contributed to these findings in TNF-α (+59%) and TGF-β (+48%). No differences were found in expression of IL-6, IL-1β, IL-4, or interleukin-1 receptor antagonist (IL-1Ra).

Fig. 2.

Fig. 2.

Basal expression (A) and exercise-induced fold change in expression (B) of proinflammatory cytokines in vastus lateralis skeletal muscle homogenate of young exercisers (YE), lifelong exercisers (LLE), and old healthy nonexercisers (OH). The dashed line at 1.0-fold represents the preexercise fold change for each group, derived from the comparative threshold cycle (2−ΔΔCT) calculation (see methods). AU, arbitrary units; TNF-α, tumor necrosis factor-α. ‡P ≤ 0.05 vs. OH, †P ≤ 0.10 vs. YE, **P ≤ 0.05 vs. preexercise.

Fig. 3.

Fig. 3.

Basal expression (A) and exercise-induced fold change in expression (B) of anti-inflammatory cytokines in vastus lateralis skeletal muscle homogenate of young exercisers (YE), lifelong exercisers (LLE), and old healthy nonexercisers (OH). The dashed line at 1.0-fold represents the preexercise fold change for each group, derived from the comparative threshold cycle (2−ΔΔCT) calculation (see methods). AU, arbitrary units; IL-1Ra, interleukin-1 receptor antagonist; TGF-β, transforming growth factor-β. *P ≤ 0.05 vs. YE, ‡P ≤ 0.05 vs. OH, †P ≤ 0.10 vs. YE, **P ≤ 0.05 vs. preexercise.

Table 5.

Basal gene expression in LLE subgroups

LLE-P LLE-F
Proinflammatory cytokines
IL-6 0.16 ± 0.03 0.17 ± 0.04
TNF-α* 0.21 ± 0.03 0.33 ± 0.06
IL-1β 0.88 ± 0.14 0.66 ± 0.12
Anti-inflammatory cytokines
IL-10 0.24 ± 0.04 0.19 ± 0.04
IL-4 0.87 ± 0.17 0.59 ± 0.32
IL-1Ra 0.83 ± 0.16 1.46 ± 0.60
TGF-β* 60.3 ± 3.7 89.3 ± 16.2
PGE2/COX pathway components
COX-1v1 2.71 ± 0.22 2.90 ± 0.27
COX-1v2 4.89 ± 0.43 5.94 ± 0.60
COX-2† 0.22 ± 0.03 0.13 ± 0.03
cPGES 214 ± 17 225 ± 22
mPGES-1 3.97 ± 0.62 4.75 ± 0.76
EP3 3.36 ± 0.90 4.02 ± 0.83
EP4 9.54 ± 0.58 9.03 ± 0.51
Chemokines and macrophage markers
IL-8 0.22 ± 0.04 0.23 ± 0.05
MCP-1 51.3 ± 5.2 53.5 ± 14.7
CD16b 2.56 ± 0.29 3.02 ± 1.28
CD163 54.1 ± 7.0 41.3 ± 5.9

Values are group means ± SE and are in arbitrary units. LLE, lifelong exercisers; LLE-F, lifelong exercisers-Fitness; LLE-P, lifelong exercisers-Performance. CD, cluster of differentiation; COX-1v1 and COX-1v2, cyclooxygenase-1 variants 1 and 2, respectively; COX-2, cyclooxygenase-2; cPGES, cytosolic prostaglandin E2 synthase; EP3 and EP4, prostaglandin E2 receptor EP3 and EP4 subtypes, respectively; IL-1Ra, interleukin-1 receptor antagonist; MCP-1, monocyte chemoattractant protein-1; mPGES-1, microsomal prostaglandin E synthase 1; TGF-β, transforming growth factor-β.

*

P ≤ 0.05 between groups;

†

P ≤ 0.10 between groups.

Within the PGE2/cyclooxygenase (COX) pathway, expression of both COX-1 variant 2 (COX-1v2; Fig. 4A, +37%) and microsomal prostaglandin E synthase 1 (mPGES-1; Fig. 5A, +69%) was higher (P ≤ 0.05) in the older cohorts (LLE and OH combined) than in YE. The downstream anti-inflammatory receptor prostaglandin E2 receptor EP4 subtype (EP4) was differentially expressed across the groups (Fig. 5A), with higher (P ≤ 0.05) expression in LLE (+21%) and lower (P ≤ 0.05) expression in OH (−37%) compared with YE. COX-1v1, COX-2, cytosolic prostaglandin E2 synthase (cPGES), and EP3 expression was not different across the groups (P > 0.05). The LLE-P subgroup showed a trend (P ≤ 0.10) for higher expression of COX-2 (+69% vs. LLE-F), although no differences (P > 0.05) were found for COX-1, cPGES, mPGES-1, EP3, or EP4 (Table 5).

Fig. 4.

Fig. 4.

Basal expression (A) and exercise-induced fold change in expression (B) of cyclooxygenase (COX) enzymes in vastus lateralis skeletal muscle homogenate of young exercisers (YE), lifelong exercisers (LLE), and old healthy nonexercisers (OH). The dashed line at 1.0-fold represents the preexercise fold change for each group, derived from the comparative threshold cycle (2−ΔΔCT) calculation (see methods). AU, arbitrary units; v1, variant 1; v2, variant 2. *P ≤ 0.05 vs. YE, **P ≤ 0.05 vs. preexercise.

Fig. 5.

Fig. 5.

Basal expression (A) and exercise-induced fold change in expression (B) of PGE2/cyclooxygenase (COX) pathway components in vastus lateralis skeletal muscle homogenate of young exercisers (YE), lifelong exercisers (LLE), and old healthy nonexercisers (OH). The dashed line at 1.0-fold represents the preexercise fold change for each group, derived from the comparative threshold cycle (2−ΔΔCT) calculation (see methods). AU, arbitrary units; cPGES, cytosolic prostaglandin E2 synthase; EP3 and EP4, prostaglandin E2 receptor EP3 and EP4 subtypes, respectively; mPGES-1, microsomal prostaglandin E synthase 1. *P ≤ 0.05 vs. YE, ‡P ≤ 0.05 vs. OH, †P ≤ 0.10 vs. YE, **P ≤ 0.05 vs. preexercise.

Basal expression of chemokines IL-8 and monocyte chemoattractant protein-1 (MCP-1) was similar (P > 0.05) among the three groups (Fig. 6A) and between the LLE subgroups (Table 5). LLE (+98%) and OH (+125%) each had significantly higher (P ≤ 0.05) expression of CD163 than YE (Fig. 6A), and there was no difference between LLE subgroups (Table 5). No differences (P > 0.05) were found in expression of CD16b (Fig. 6A and Table 5).

Fig. 6.

Fig. 6.

Basal expression (A) and exercise-induced fold change in expression (B) of chemokines and macrophage surface markers in vastus lateralis skeletal muscle homogenate of young exercisers (YE), lifelong exercisers (LLE), and old healthy nonexercisers (OH). The dashed line at 1.0-fold represents the preexercise fold change for each group, derived from the comparative threshold cycle (2−ΔΔCT) calculation (see methods). AU, arbitrary units; CD, cluster of differentiation; MCP-1, monocyte chemoattractant protein 1. *P ≤ 0.05 vs. YE, †P ≤ 0.10 vs. YE and LLE, **P ≤ 0.05 vs. preexercise, §P ≤ 0.10 vs. preexercise.

Effects of Acute Resistance Exercise

After resistance exercise, expression of TNF-α was significantly elevated (P ≤ 0.05) only in the OH group (2.1-fold; Fig. 2B). There was a trend for a larger increase in IL-6 expression in the older groups (P ≤ 0.10), likely explained by a 1.4-fold increase in LLE. IL-1β expression was unaffected by exercise across the groups (P > 0.05). For the anti-inflammatory genes (Fig. 3B), IL-10 expression tended to be higher (P ≤ 0.10) after exercise in YE (2.0-fold) compared with LLE. Exercise led to a 1.7-fold increase (P ≤ 0.05) in TGF-β expression in OH, and TGF-β expression in LLE was significantly lower than in OH postexercise (1.2-fold). IL-1Ra expression was unchanged (P > 0.05) after exercise. IL-4 expression was also unchanged (P > 0.05) across the three groups, although the LLE subgroups (Table 6) showed a 2.5-fold change after exercise (P ≤ 0.05, main effect). No differences (P > 0.05) were found between the LLE subgroups for expression of any cytokines postexercise (Table 6).

Table 6.

Change in gene expression in LLE subgroups

Time Point LLE-P LLE-F
Proinflammatory cytokines
IL-6 Pre 1.24 ± 0.21 1.25 ± 0.32
Post 1.55 ± 0.28 1.23 ± 0.23
TNF-α Pre 1.08 ± 0.12 1.12 ± 0.19
Post 1.25 ± 0.14 0.94 ± 0.11
IL-1β Pre 1.20 ± 0.21 1.10 ± 0.21
Post 0.95 ± 0.13 1.23 ± 0.26
Anti-inflammatory cytokines
IL-10 Pre 1.22 ± 0.24 1.10 ± 0.21
Post 0.88 ± 0.13 1.23 ± 0.25
IL-4 Pre 1.31 ± 0.28 1.84 ± 1.01
Post* 2.55 ± 0.62 2.45 ± 0.88
IL-1Ra Pre 1.23 ± 0.25 1.37 ± 0.57
Post 1.22 ± 0.12 0.76 ± 0.15
TGF-β Pre 1.03 ± 0.07 1.09 ± 0.20
Post 1.35 ± 0.16 1.00 ± 0.12
PGE2/COX pathway components
COX-1v1 Pre 1.05 ± 0.90 1.03 ± 0.90
Post 0.94 ± 0.09 0.82 ± 0.11
COX-1v2 Pre 1.05 ± 0.11 1.03 ± 0.10
Post† 0.91 ± 0.10 0.78 ± 0.11
COX-2 Pre 1.20 ± 0.20 1.21 ± 0.26
Post* 1.58 ± 0.22 2.15 ± 0.28
cPGES Pre 1.04 ± 0.08 1.03 ± 0.10
Post 1.17 ± 0.06 1.08 ± 0.10
mPGES-1 Pre 1.21 ± 0.23 1.09 ± 0.18
Post* 0.70 ± 0.11 0.80 ± 0.12
EP3 Pre 1.52 ± 0.51 1.63 ± 0.34
Post 1.75 ± 0.22 1.62 ± 0.16
EP4 Pre 1.02 ± 0.06 1.01 ± 0.06
Post 1.11 ± 0.08 1.10 ± 0.11
Chemokines and macrophage markers
IL-8 Pre 1.28 ± 0.28 1.20 ± 0.27
Post† 1.18 ± 0.18 0.53 ± 0.11
MCP-1 Pre 1.07 ± 0.12 1.17 ± 0.32
Post 1.30 ± 0.13 1.32 ± 0.20
CD16b Pre 1.09 ± 0.13 1.48 ± 0.63
Post† 1.68 ± 0.23 1.64 ± 0.48
CD163 Pre 1.08 ± 0.14 1.05 ± 0.15
Post* 1.28 ± 0.21 1.57 ± 0.26

Values are means ± SE and represent fold change from preexercise. LLE, lifelong exercisers; LLE-F, lifelong exercisers-Fitness; LLE-P, lifelong exercisers-Performance; Post, postexercise; Pre, preexercise. CD, cluster of differentiation; COX-1v1 and COX-1v2, cyclooxygenase-1 variants 1 and 2, respectively; COX-2, cyclooxygenase-2; cPGES, cytosolic prostaglandin E2 synthase; EP3 and EP4, prostaglandin E2 receptor EP3 and EP4 subtypes, respectively; IL-1Ra, interleukin-1 receptor antagonist; MCP-1, monocyte chemoattractant protein-1; mPGES-1, microsomal prostaglandin E synthase 1; TGF-β, transforming growth factor-β.

*

P ≤ 0.05 vs. preexercise;

†

P ≤ 0.10 vs. preexercise.

Expression of COX-1v1 and COX-1v2 was unchanged with exercise in YE, LLE, and OH (Fig. 4B) and in both LLE subgroups (Table 6). There was a trend (P ≤ 0.10, main effect) for the LLE subgroups to have decreased expression of COX-1v2 following exercise (Table 6). Conversely, exercise increased (P ≤ 0.05, main effect) expression of COX-2 in the three groups and the LLE subgroups (~1.9-fold).

Downstream PGE2/COX pathway components were differentially responsive to exercise across the groups (Fig. 5B). cPGES expression tended to be higher (P ≤ 0.10) after exercise in the aging cohorts combined (1.1-fold) than in YE. LLE had lower (P ≤ 0.05) expression of mPGES-1 (0.8-fold) compared with YE (1.5-fold) following exercise, which was supported by an overall decrease (P ≤ 0.05, main effect) in the LLE subgroups (Table 6). Exercise led to a 3.4-fold increase (P ≤ 0.05) in EP3 expression in YE, and LLE had lower (P ≤ 0.05) EP3 expression than YE postexercise (1.5-fold). EP4 expression increased after exercise for all three groups (P ≤ 0.05, main effect). Expression of cPGES, EP3, and EP4 was not different (P > 0.05) between the subgroups (Table 6).

Postexercise skeletal muscle IL-8 expression (Fig. 6B) tended to be higher (P ≤ 0.10) in OH (2.2-fold) than in YE (0.9-fold) or LLE (1.0-fold). With the LLE subgroups, IL-8 expression tended (P ≤ 0.10, main effect) to decrease overall, primarily driven by a 0.5-fold change in the LLE-F subgroup (Table 6). MCP-1 expression tended to increase overall after exercise (P ≤ 0.10, main effect), but YE showed a significantly (P ≤ 0.05) greater response (1.8-fold increase) than the older groups (1.3-fold increase). Muscle macrophage surface markers CD16b and CD163 (Fig. 6B and Table 6) both approached (P ≤ 0.10, main effect) or attained (P ≤ 0.05, main effect) significantly higher expression after exercise across all groups.

DISCUSSION

This study examined the influences of aging and lifelong exercise on inflammation in circulation and skeletal muscle at baseline and after acute resistance exercise. This investigation arose given the negative impact of chronic basal inflammation on muscle size and function in older individuals (66, 67, 85), along with the established anti-inflammatory benefits of exercise training (4, 42, 43). Findings from this study show that aging led to a proinflammatory profile within the blood and muscle. Lifelong exercise partially protected against this effect and favored a generally anti-inflammatory profile within muscle. A resistance exercise bout was chosen to provide a potent antisarcopenic stimulus and present an unaccustomed exercise challenge to all groups. Our laboratory has historically been interested in resistance training as a tool to combat sarcopenia in aging adults. The present study builds on this tenet, along with previous work from us (78, 80, 81) and others (18, 38) showing that skeletal muscle inflammation may preclude optimal adaptations. We provide evidence that highly aerobically trained older adults display a preserved response to exercise, which may indicate they are better prepared to adapt to resistance training. Further research is needed to understand whether this advantage persists into the ninth decade of life, where exercise adaptations appear to be blunted (23, 61, 68).

Basal Inflammatory Profile

The impressive and unique training history of the lifelong exercisers (LLE) resulted in an anti-inflammatory muscle environment, which complements findings of higher levels of anti-inflammatory factors in circulation of older exercise-trained individuals (28, 43). Relative to OH, higher basal levels of IL-10 (+43%) and TGF-β (+66%) in LLE likely contribute to suppression of the transcription and signaling activity of proinflammatory factors. For example, IL-10 and TGF-β have regulatory relationships with the proinflammatory cytokine TNF-α (7, 15), which may explain the tendency of these cytokines to track together in the present study. Both YE and LLE had higher basal expression of TNF-α than OH, suggesting that exercise training increases its expression. Other studies have also demonstrated higher TNF-α expression in trained compared with untrained individuals, including circulation of older men (41) and skeletal muscle of young men (51). Likewise, short-term (12 wk) resistance training in older adults leads to elevated expression of muscle TNF-α, along with a number of other cytokines (81). The typically proteolytic effects of TNF-α are likely moderated in trained individuals as a result of the overall anti-inflammatory profile.

Despite lower expression of muscle TNF-α, OH had circulating TNF-α levels similar to the other groups. IL-6 was similarly expressed in muscle across the three groups but highest in the circulation of OH. Other studies have also shown an apparent disconnect between muscle and circulating inflammation (44, 72). Thus, assuming that muscle cytokine mRNA is translated and released into circulation similarly across the groups, a source other than muscle [e.g., a differential circulating immune cell population (19) or proinflammatory effects of greater adipose tissue mass (47) in OH] likely contributed to the observed patterns in circulating IL-6 and TNF-α levels. Nevertheless, the deleterious effects of inflammation on skeletal muscle were apparent in a negative association between circulating IL-6 levels and quadriceps muscle cross-sectional area across the groups (Fig. 7). Large-scale studies (66, 67, 85) have often reported similar relationships, positing that sarcopenia may be a long-term consequence of the negative impact of IL-6 on muscle protein metabolism (9, 25, 84). Lifelong exercise apparently exerts a positive influence on this trend, preventing the age-related increase in circulating IL-6 levels and thereby partially attenuating the decrease in whole muscle mass (13). Overall reductions in muscle mass in both older groups might also be related to the age-related decrease in circulating IGF-1. This factor is known to promote anabolism and reduce cytokine production in skeletal muscle (34). Despite a minimally protective effect of higher lifelong training intensity in LLE-P compared with LLE-F, lifelong aerobic exercise was not able to rescue the decline of IGF-1 levels.

Fig. 7.

Fig. 7.

Association between serum interleukin-6 (IL-6) and quadriceps muscle cross-sectional area (CSA) in young exerciser (YE), lifelong exerciser (LLE), and old healthy nonexerciser (OH) men. This finding is in agreement with the work of others suggesting a negative impact of circulating inflammation on skeletal muscle (41, 66, 67, 85).

Aging may also be accompanied by an increased capacity for production of PGE2 in skeletal muscle (35). Produced in the COX pathway, this lipid-based inflammatory mediator can promote protein breakdown (63) and activate proinflammatory signaling within muscle (70). Fittingly, long-term use of COX-inhibiting drugs may aid in combatting sarcopenia (32) and skeletal muscle dysfunction during inflammatory conditions (6, 39) in older adults. In the present study, there was an overall effect of aging (LLE and OH combined) in increasing the expression of several components of the PGE2/COX pathway. Most apparently, aging increased expression of COX-1 and the PGE2-specific synthase mPGES-1. EP3, a proinflammatory receptor for PGE2 (22, 46), followed a similar though nonsignificant pattern (+74% in OH vs. YE). Comparable to previous findings at the protein level in sarcopenic muscle (35), the OH group had lower expression of EP4, a purportedly anti-inflammatory PGE2 receptor. Existing data in human tissues other than skeletal muscle have demonstrated that PGE2 signaling through EP4 may enhance IL-10 activity (14), reduce chemokine production (74), and inhibit maturation of IL-1β (69). Therefore, age-related increases in proinflammatory flux through the PGE2/COX pathway could have consequences for regulation of muscle mass (32), protein turnover, and exercise adaptations (78–80).

Despite an apparent age-related increase in PGE2/COX pathway expression, LLE had higher expression of EP4. The effect of training on increasing expression of this receptor is supported in the literature (81). Given its anti-inflammatory roles, higher EP4 expression in LLE muscle could negatively regulate proinflammatory activity at rest and during periods of heightened PGE2 availability (e.g., exercise). High basal expression of EP4, along with several anti-inflammatory cytokines, generally supports the idea that lifelong exercise fosters an anti-inflammatory profile, potentially as a positive adaptation to long-term aerobic training.

Subdivision of the LLE group provided insight into the effects of lifetime training intensity on basal inflammation. Within LLE, higher-intensity training in LLE-P reduced basal expression of TNF-α and TGF-β, further supporting the idea that these likely modulate one another’s activity. Higher training intensity also led to upregulation of COX-2. Although not typically measurable at the protein level in healthy human muscle (35, 87), COX-2 expression can be induced during challenging inflammatory conditions (57). Thus, higher expression of COX-2 may indicate an adaptation to intense muscular exercise for many decades in the LLE-P group. Likewise, short-term training has been shown to lead to increased basal muscle COX-2 expression in older adults (78). Despite this potential for heightened COX pathway activity in LLE-P, any increased PGE2 production would likely result in a downstream anti-inflammatory response due to high EP4 expression in both LLE subgroups.

To provide insight into the capacity of muscle for intercellular signaling with inflammatory cells, basal macrophage abundance and gene expression of muscle chemokines and macrophage surface markers were assessed. Heightened basal expression of chemokines or elevated macrophage abundance in skeletal muscle could indicate the presence of unresolved inflammation (73). Interestingly, a general nonsignificant pattern for reduction in muscle chemokine expression was observed in OH (IL-8, −53%, and MCP-1, −24%, vs. YE), with LLE partially mitigating these effects. Both older groups had higher basal expression of anti-inflammatory (M2) macrophage surface marker CD163. However, because no differences in intramuscular macrophage abundance were detected among the groups, higher CD163 receptor density for a given number of resident macrophages might indicate heightened capacity for CD163-mediated signaling. Given its established roles in anti-inflammatory signal transduction and cytokine production (10, 53), CD163 may partially contribute to the overall anti-inflammatory profile of the LLE muscle. However, this relationship was not seen in OH, which may suggest the presence of regulatory defects between muscle and inflammatory cells (56). Such dysfunctions could contribute to impaired ability to resolve exercise-induced inflammation and create a resting environment that favors muscle atrophy in OH.

Response to Acute Resistance Exercise

Recent evidence suggests that failure to resolve inflammation after exercise may partially limit adaptability to short-term training in older adults (38, 78, 79). We sought insight into this phenomenon by examining the response to an exercise bout previously shown to lead to adaptations when completed chronically (75, 78). The present investigation found an exaggerated response for TNF-α and TGF-β in OH muscle. TNF-α may engage proteolytic pathways within the muscle (e.g., NF-κB and MAPK; 30), and the pleiotropic nature of TGF-β may contribute to chemotaxis of inflammatory cells or aid in tissue repair following mechanical stress (26, 86). Thus, it appears that the bout of muscle loading presented a challenge to the OH muscle, whereas both YE and LLE had adapted through exercise training to better tolerate the exercise stress.

Furthermore, increased expression of cPGES in OH, coupled with higher basal expression of COX pathway components, could enable greater PGE2 production following exercise. Previous work has demonstrated that PGE2 leads to transcription of inflammatory and proteolytic factors within muscle (70). Thus, in combination with elevated postexercise expression of muscle cytokines, elevated PGE2 production capacity within OH muscle could lead to heightened activity of and cross talk between inflammatory signaling pathways. Failure to resolve this might contribute to a sustained proinflammatory environment after exercise. This may partially explain why COX-inhibiting drugs have successfully modulated inflammation and enhanced muscle growth in older adults undergoing resistance training (79, 80).

Production of skeletal muscle chemokines IL-8 and MCP-1 is often increased after exercise to recruit inflammatory cells to the site of insult (16). Given the role of IL-8 in signaling with inflammatory cells (2), the exercise-induced increase in IL-8 levels seen in only OH further suggests that the untrained aging muscle was less prepared than muscle in the trained groups to tolerate the exercise stress. This may be problematic, since other investigations have demonstrated that aging may impair the responsiveness of inflammatory cells after exercise (11, 56). The present study did not demonstrate a difference in postexercise macrophage surface marker gene expression across groups. However, both older groups had lower expression of MCP-1 compared with YE after exercise. Thus, although aging may preserve the ability of resident macrophages to respond to exercise, there may be an age-related disconnect or delay in the ability to recruit more macrophages to aid in resolution of exercise-induced inflammation within muscle tissue. In OH, impairments in intercellular communication might lead to a sustained cytokine environment and contribute to longer-duration impairments in protein balance following exercise.

Only LLE showed a modest elevation (1.4-fold) in IL-6 after exercise. The fact that no change in IL-6 expression was seen in the other groups is not an uncommon finding (38, 83). However, our laboratory has previously demonstrated a dramatic increase in muscle IL-6 expression (791-fold) 4 h following an exercise bout identical to the present study (37). These differences may be due to the familiarity of the stimulus to the resistance-trained subjects in the previous study (37). In support of this, muscle samples from this previous time course investigation were reanalyzed using the present qPCR conditions and confirmed the different findings between these studies. IL-6 is often highly upregulated following endurance exercise (≥1 h; 49, 71) because of its important roles in intracellular and intercellular inflammatory signaling and glucose metabolism (27). Thus, the apparently higher sensitivity of LLE muscle to transcribe IL-6 after exercise may be a product of their decades of aerobic training and/or the pleiotropic nature of IL-6. A better understanding of the capacity of highly trained muscle to mount an inflammatory response might be gained by examining time points outside of the present 4-h window or by imposing a different exercise stimulus (e.g., longer duration or more familiar activity). This could also provide insight into the effect of lifelong training intensity, as the present investigation did not demonstrate any effect of training intensity on IL-6 or any other genes measured following acute exercise.

Some responses in LLE suggest that a heightened threshold may have been established as an adaptation to repeated exposure to the stress of exercise. For example, IL-10, EP3, and mPGES-1 expression was lower after exercise in LLE than in YE, indicating a blunted response. The potent effects of IL-10 in reducing proinflammatory cytokine transcription and signaling (8, 45) are implicated in resolution of acute inflammation. Although no data exist on the typical response to exercise for EP3 and mPGES-1, these proinflammatory PGE2/COX pathway components may be involved in PGE2 signaling after exercise to aid in muscle protein turnover necessary for remodeling (54, 82). Further research is necessary to clarify whether differences in postexercise gene expression contribute to differences in responsiveness to a resistance exercise regimen between young and lifelong exercisers.

Summary

This study supports the recent evidence that exercise training is anti-inflammatory. Although aging contributes to the elevation of proinflammatory factors in blood and muscle, lifelong aerobic exercise training partially reduces these effects and promotes an overall anti-inflammatory profile. Lifelong training intensity appears to have a minimal effect on this pattern. Future studies may expand on these findings in a muscle fiber type-specific manner, given that slow- and fast-twitch muscle fibers may have differential inflammatory profiles in healthy young muscle (35, 55, 80). Aging also results in an altered inflammatory response to acute exercise, which may have implications for the ability to increase muscle mass and handle a loading stress. However, this effect is largely rescued by lifelong exercise, with no additional influence of lifelong training intensity. Thus, further investigation into whether lifelong aerobic exercise improves skeletal muscle adaptability to resistance training (i.e., size and strength gains) would provide considerable insight. Additionally, further work is needed to establish whether LLE-induced patterns in the inflammatory profile of older skeletal muscle at baseline and following exercise mirror differences between young exercisers and young untrained individuals. Combined with previous studies on basal inflammation in individuals with a shorter training history (40, 41), this would provide further insight into whether an individual’s age, training status, and/or duration of training interact to provide the anti-inflammatory benefits observed here. The results of the present study help to understand the long-term benefits of exercise for avoidance of a chronic inflammatory state that may contribute to poor health and functional decline in aging adults.

GRANTS

This research was supported by National Institutes of Health Grant AG-038576.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

K.M.L., R.K.P., B.J., U.R., S.W.T., and T.A.T. conceived and designed research; K.M.L., R.K.P., B.J., U.R., S.W.T., and T.A.T. performed experiments; K.M.L., R.K.P., B.J., and T.A.T. analyzed data; K.M.L., R.K.P., B.J., U.R., S.W.T., and T.A.T. interpreted results of experiments; K.M.L., R.K.P., and T.A.T. prepared figures; K.M.L., R.K.P., and T.A.T. drafted manuscript; K.M.L., R.K.P., B.J., U.R., S.W.T., and T.A.T. edited and revised manuscript; K.M.L., R.K.P., B.J., U.R., S.W.T., and T.A.T. approved final version of manuscript.

ACKNOWLEDGMENTS

We thank all study participants as well as staff and graduate students who assisted with this project. In particular, we acknowledge Andrew M. Jones for assistance with macrophage data collection.

REFERENCES

  • 1.Alturki M, Beyer I, Mets T, Bautmans I. Impact of drugs with anti-inflammatory effects on skeletal muscle and inflammation: a systematic literature review. Exp Gerontol 114: 33–49, 2018. doi: 10.1016/j.exger.2018.10.011. [DOI] [PubMed] [Google Scholar]
  • 2.Baggiolini M, Clark-Lewis I. Interleukin-8, a chemotactic and inflammatory cytokine. FEBS Lett 307: 97–101, 1992. doi: 10.1016/0014-5793(92)80909-Z. [DOI] [PubMed] [Google Scholar]
  • 3.Bamman MM, Ferrando AA, Evans RP, Stec MJ, Kelly NA, Gruenwald JM, Corrick KL, Trump JR, Singh JA. Muscle inflammation susceptibility: a prognostic index of recovery potential after hip arthroplasty? Am J Physiol Endocrinol Metab 308: E670–E679, 2015. doi: 10.1152/ajpendo.00576.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Beavers KM, Brinkley TE, Nicklas BJ. Effect of exercise training on chronic inflammation. Clin Chim Acta 411: 785–793, 2010. doi: 10.1016/j.cca.2010.02.069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bergström J. Muscle electrolytes in man. Scand J Clin Lab Invest 14: 1–110, 1962. [Google Scholar]
  • 6.Beyer I, Bautmans I, Njemini R, Demanet C, Bergmann P, Mets T. Effects on muscle performance of NSAID treatment with piroxicam versus placebo in geriatric patients with acute infection-induced inflammation. A double blind randomized controlled trial. BMC Musculoskelet Disord 12: 292, 2011. doi: 10.1186/1471-2474-12-292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bitzer M, von Gersdorff G, Liang D, Dominguez-Rosales A, Beg AA, Rojkind M, Böttinger EP. A mechanism of suppression of TGF-β/SMAD signaling by NF-κB/RelA. Genes Dev 14: 187–197, 2000. [PMC free article] [PubMed] [Google Scholar]
  • 8.Bogdan C, Vodovotz Y, Nathan C. Macrophage deactivation by interleukin 10. J Exp Med 174: 1549–1555, 1991. doi: 10.1084/jem.174.6.1549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Braun DA, Fribourg M, Sealfon SC. Cytokine response is determined by duration of receptor and signal transducers and activators of transcription 3 (STAT3) activation. J Biol Chem 288: 2986–2993, 2013. doi: 10.1074/jbc.M112.386573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Buechler C, Ritter M, Orsó E, Langmann T, Klucken J, Schmitz G. Regulation of scavenger receptor CD163 expression in human monocytes and macrophages by pro- and antiinflammatory stimuli. J Leukoc Biol 67: 97–103, 2000. doi: 10.1002/jlb.67.1.97. [DOI] [PubMed] [Google Scholar]
  • 11.Cannon JG, Orencole SF, Fielding RA, Meydani M, Meydani SN, Fiatarone MA, Blumberg JB, Evans WJ. Acute phase response in exercise: interaction of age and vitamin E on neutrophils and muscle enzyme release. Am J Physiol Regul Integr Comp Physiol 259: R1214–R1219, 1990. doi: 10.1152/ajpregu.1990.259.6.R1214. [DOI] [PubMed] [Google Scholar]
  • 12.Carrick-Ranson G, Hastings JL, Bhella PS, Fujimoto N, Shibata S, Palmer MD, Boyd K, Livingston S, Dijk E, Levine BD. The effect of lifelong exercise dose on cardiovascular function during exercise. J Appl Physiol (1985) 116: 736–745, 2014. doi: 10.1152/japplphysiol.00342.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Chambers TL, Burnett TR, Raue U, Lee GA, Finch WH, Graham BM, Trappe TA, Trappe SW. Skeletal muscle size, function, and adiposity with lifelong aerobic exercise. J Appl Physiol. doi: 10.1152/japplphysiol.00426.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cheon H, Rho YH, Choi SJ, Lee YH, Song GG, Sohn J, Won NH, Ji JD. Prostaglandin E2 augments IL-10 signaling and function. J Immunol 177: 1092–1100, 2006. doi: 10.4049/jimmunol.177.2.1092. [DOI] [PubMed] [Google Scholar]
  • 15.Clarke CJ, Hales A, Hunt A, Foxwell BM. IL-10-mediated suppression of TNF-α production is independent of its ability to inhibit NFκB activity. Eur J Immunol 28: 1719–1726, 1998. doi: 10.1002/(SICI)1521-4141(199805)28:05<1719:AID-IMMU1719>3.0.CO;2-Q. [DOI] [PubMed] [Google Scholar]
  • 16.Della Gatta PA, Cameron-Smith D, Peake JM. Acute resistance exercise increases the expression of chemotactic factors within skeletal muscle. Eur J Appl Physiol 114: 2157–2167, 2014. doi: 10.1007/s00421-014-2936-4. [DOI] [PubMed] [Google Scholar]
  • 17.Della Gatta PA, Garnham AP, Peake JM, Cameron-Smith D. Effect of exercise training on skeletal muscle cytokine expression in the elderly. Brain Behav Immun 39: 80–86, 2014. doi: 10.1016/j.bbi.2014.01.006. [DOI] [PubMed] [Google Scholar]
  • 18.Dennis RA, Zhu H, Kortebein PM, Bush HM, Harvey JF, Sullivan DH, Peterson CA. Muscle expression of genes associated with inflammation, growth, and remodeling is strongly correlated in older adults with resistance training outcomes. Physiol Genomics 38: 169–175, 2009. doi: 10.1152/physiolgenomics.00056.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Duggal NA, Pollock RD, Lazarus NR, Harridge S, Lord JM. Major features of immunesenescence, including reduced thymic output, are ameliorated by high levels of physical activity in adulthood. Aging Cell 17: e12750, 2018. doi: 10.1111/acel.12750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ferrucci L, Corsi A, Lauretani F, Bandinelli S, Bartali B, Taub DD, Guralnik JM, Longo DL. The origins of age-related proinflammatory state. Blood 105: 2294–2299, 2005. doi: 10.1182/blood-2004-07-2599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Franceschi C, Bonafè M, Valensin S, Olivieri F, De Luca M, Ottaviani E, De Benedictis G. Inflamm-aging. An evolutionary perspective on immunosenescence. Ann N Y Acad Sci 908: 244–254, 2000. doi: 10.1111/j.1749-6632.2000.tb06651.x. [DOI] [PubMed] [Google Scholar]
  • 22.Goulet JL, Pace AJ, Key ML, Byrum RS, Nguyen M, Tilley SL, Morham SG, Langenbach R, Stock JL, McNeish JD, Smithies O, Coffman TM, Koller BH. E-prostanoid-3 receptors mediate the proinflammatory actions of prostaglandin E2 in acute cutaneous inflammation. J Immunol 173: 1321–1326, 2004. doi: 10.4049/jimmunol.173.2.1321. [DOI] [PubMed] [Google Scholar]
  • 23.Greig CA, Gray C, Rankin D, Young A, Mann V, Noble B, Atherton PJ. Blunting of adaptive responses to resistance exercise training in women over 75y. Exp Gerontol 46: 884–890, 2011. doi: 10.1016/j.exger.2011.07.010. [DOI] [PubMed] [Google Scholar]
  • 24.Gries KJ, Raue U, Perkins RK, Lavin KM, Overstreet BS, D’Acquisto LJ, Graham B, Finch WH, Kaminsky LA, Trappe TA, Trappe S. Cardiovascular and skeletal muscle health with lifelong exercise. J Appl Physiol (1985) 125: 1636–1645, 2018. doi: 10.1152/japplphysiol.00174.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Haddad F, Zaldivar F, Cooper DM, Adams GR. IL-6-induced skeletal muscle atrophy. J Appl Physiol (1985) 98: 911–917, 2005. doi: 10.1152/japplphysiol.01026.2004. [DOI] [PubMed] [Google Scholar]
  • 26.Heinemeier K, Langberg H, Kjaer M. Exercise-induced changes in circulating levels of transforming growth factor-β-1 in humans: methodological considerations. Eur J Appl Physiol 90: 171–177, 2003. doi: 10.1007/s00421-003-0881-8. [DOI] [PubMed] [Google Scholar]
  • 27.Helge JW, Stallknecht B, Pedersen BK, Galbo H, Kiens B, Richter EA. The effect of graded exercise on IL-6 release and glucose uptake in human skeletal muscle. J Physiol 546: 299–305, 2003. doi: 10.1113/jphysiol.2002.030437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Jankord R, Jemiolo B. Influence of physical activity on serum IL-6 and IL-10 levels in healthy older men. Med Sci Sports Exerc 36: 960–964, 2004. doi: 10.1249/01.MSS.0000128186.09416.18. [DOI] [PubMed] [Google Scholar]
  • 29.Jemiolo B, Trappe S. Single muscle fiber gene expression in human skeletal muscle: validation of internal control with exercise. Biochem Biophys Res Commun 320: 1043–1050, 2004. doi: 10.1016/j.bbrc.2004.05.223. [DOI] [PubMed] [Google Scholar]
  • 30.Kandarian SC, Jackman RW. Intracellular signaling during skeletal muscle atrophy. Muscle Nerve 33: 155–165, 2006. doi: 10.1002/mus.20442. [DOI] [PubMed] [Google Scholar]
  • 31.Kosek DJ, Kim JS, Petrella JK, Cross JM, Bamman MM. Efficacy of 3 days/wk resistance training on myofiber hypertrophy and myogenic mechanisms in young vs. older adults. J Appl Physiol (1985) 101: 531–544, 2006. doi: 10.1152/japplphysiol.01474.2005. [DOI] [PubMed] [Google Scholar]
  • 32.Landi F, Marzetti E, Liperoti R, Pahor M, Russo A, Martone AM, Colloca G, Capoluongo E, Bernabei R. Nonsteroidal anti-inflammatory drug (NSAID) use and sarcopenia in older people: results from the ilSIRENTE study. J Am Med Dir Assoc 14: 626.e9–626.e13, 2013. doi: 10.1016/j.jamda.2013.04.012. [DOI] [PubMed] [Google Scholar]
  • 33.Lang CH, Frost RA, Vary TC. Regulation of muscle protein synthesis during sepsis and inflammation. Am J Physiol Endocrinol Metab 293: E453–E459, 2007. doi: 10.1152/ajpendo.00204.2007. [DOI] [PubMed] [Google Scholar]
  • 34.Lee WJ. IGF-I exerts an anti-inflammatory effect on skeletal muscle cells through down-regulation of TLR4 signaling. Immune Netw 11: 223–226, 2011. doi: 10.4110/in.2011.11.4.223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liu SZ, Jemiolo B, Lavin KM, Lester BE, Trappe SW, Trappe TA. Prostaglandin E2/cyclooxygenase pathway in human skeletal muscle: influence of muscle fiber type and age. J Appl Physiol (1985) 120: 546–551, 2016. doi: 10.1152/japplphysiol.00396.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25: 402–408, 2001. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 37.Louis E, Raue U, Yang Y, Jemiolo B, Trappe S. Time course of proteolytic, cytokine, and myostatin gene expression after acute exercise in human skeletal muscle. J Appl Physiol (1985) 103: 1744–1751, 2007. doi: 10.1152/japplphysiol.00679.2007. [DOI] [PubMed] [Google Scholar]
  • 38.Merritt EK, Stec MJ, Thalacker-Mercer A, Windham ST, Cross JM, Shelley DP, Craig Tuggle S, Kosek DJ, Kim JS, Bamman MM. Heightened muscle inflammation susceptibility may impair regenerative capacity in aging humans. J Appl Physiol (1985) 115: 937–948, 2013. doi: 10.1152/japplphysiol.00019.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mets T, Bautmans I, Njemini R, Lambert M, Demanet C. The influence of celecoxib on muscle fatigue resistance and mobility in elderly patients with inflammation. Am J Geriatr Pharmacother 2: 230–238, 2004. doi: 10.1016/j.amjopharm.2004.12.007. [DOI] [PubMed] [Google Scholar]
  • 40.Mikkelsen UR, Agergaard J, Couppé C, Grosset JF, Karlsen A, Magnusson SP, Schjerling P, Kjaer M, Mackey AL. Skeletal muscle morphology and regulatory signalling in endurance-trained and sedentary individuals: the influence of ageing. Exp Gerontol 93: 54–67, 2017. doi: 10.1016/j.exger.2017.04.001. [DOI] [PubMed] [Google Scholar]
  • 41.Mikkelsen UR, Couppé C, Karlsen A, Grosset JF, Schjerling P, Mackey AL, Klausen HH, Magnusson SP, Kjær M. Life-long endurance exercise in humans: circulating levels of inflammatory markers and leg muscle size. Mech Ageing Dev 134: 531–540, 2013. doi: 10.1016/j.mad.2013.11.004. [DOI] [PubMed] [Google Scholar]
  • 42.Minuzzi LG, Chupel MU, Rama L, Rosado F, Muñoz VR, Gaspar RC, Kuga GK, Furtado GE, Pauli JR, Teixeira AM. Lifelong exercise practice and immunosenescence: master athletes cytokine response to acute exercise. Cytokine 115: 1–7, 2019. doi: 10.1016/j.cyto.2018.12.006. [DOI] [PubMed] [Google Scholar]
  • 43.Minuzzi LG, Rama L, Bishop NC, Rosado F, Martinho A, Paiva A, Teixeira AM. Lifelong training improves anti-inflammatory environment and maintains the number of regulatory T cells in masters athletes. Eur J Appl Physiol 117: 1131–1140, 2017. doi: 10.1007/s00421-017-3600-6. [DOI] [PubMed] [Google Scholar]
  • 44.Moldoveanu AI, Shephard RJ, Shek PN. Exercise elevates plasma levels but not gene expression of IL-1β, IL-6, and TNF-α in blood mononuclear cells. J Appl Physiol (1985) 89: 1499–1504, 2000. doi: 10.1152/jappl.2000.89.4.1499. [DOI] [PubMed] [Google Scholar]
  • 45.Moore KW, O’Garra A, Malefyt RW, Vieira P, Mosmann TR. Interleukin-10. Annu Rev Immunol 11: 165–190, 1993. doi: 10.1146/annurev.iy.11.040193.001121. [DOI] [PubMed] [Google Scholar]
  • 46.Morimoto K, Shirata N, Taketomi Y, Tsuchiya S, Segi-Nishida E, Inazumi T, Kabashima K, Tanaka S, Murakami M, Narumiya S, Sugimoto Y. Prostaglandin E2-EP3 signaling induces inflammatory swelling by mast cell activation. J Immunol 192: 1130–1137, 2014. doi: 10.4049/jimmunol.1300290. [DOI] [PubMed] [Google Scholar]
  • 47.Mraz M, Haluzik M. The role of adipose tissue immune cells in obesity and low-grade inflammation. J Endocrinol 222: R113–R127, 2014. doi: 10.1530/JOE-14-0283. [DOI] [PubMed] [Google Scholar]
  • 48.Murach K, Raue U, Wilkerson B, Minchev K, Jemiolo B, Bagley J, Luden N, Trappe S. Single muscle fiber gene expression with run taper. PLoS One 9: e108547, 2014. doi: 10.1371/journal.pone.0108547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Nieman DC, Davis JM, Henson DA, Gross SJ, Dumke CL, Utter AC, Vinci DM, Carson JA, Brown A, McAnulty SR, McAnulty LS, Triplett NT. Muscle cytokine mRNA changes after 2.5 h of cycling: influence of carbohydrate. Med Sci Sports Exerc 37: 1283–1290, 2005. doi: 10.1249/01.mss.0000175054.99588.b1. [DOI] [PubMed] [Google Scholar]
  • 50.Nilwik R, Snijders T, Leenders M, Groen BB, van Kranenburg J, Verdijk LB, van Loon LJ. The decline in skeletal muscle mass with aging is mainly attributed to a reduction in type II muscle fiber size. Exp Gerontol 48: 492–498, 2013. doi: 10.1016/j.exger.2013.02.012. [DOI] [PubMed] [Google Scholar]
  • 51.Olesen J, Biensø RS, Meinertz S, van Hauen L, Rasmussen SM, Gliemann L, Plomgaard P, Pilegaard H. Impact of training status on LPS-induced acute inflammation in humans. J Appl Physiol (1985) 118: 818–829, 2015. doi: 10.1152/japplphysiol.00725.2014. [DOI] [PubMed] [Google Scholar]
  • 52.Pedersen BK, Steensberg A, Schjerling P. Muscle-derived interleukin-6: possible biological effects. J Physiol 536: 329–337, 2001. doi: 10.1111/j.1469-7793.2001.0329c.xd. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Philippidis P, Mason JC, Evans BJ, Nadra I, Taylor KM, Haskard DO, Landis RC. Hemoglobin scavenger receptor CD163 mediates interleukin-10 release and heme oxygenase-1 synthesis: antiinflammatory monocyte-macrophage responses in vitro, in resolving skin blisters in vivo, and after cardiopulmonary bypass surgery. Circ Res 94: 119–126, 2004. doi: 10.1161/01.RES.0000109414.78907.F9. [DOI] [PubMed] [Google Scholar]
  • 54.Phillips SM, Tipton KD, Aarsland A, Wolf SE, Wolfe RR. Mixed muscle protein synthesis and breakdown after resistance exercise in humans. Am J Physiol Endocrinol Metab 273: E99–E107, 1997. doi: 10.1152/ajpendo.1997.273.1.E99. [DOI] [PubMed] [Google Scholar]
  • 55.Plomgaard P, Penkowa M, Pedersen BK. Fiber type specific expression of TNF-alpha, IL-6 and IL-18 in human skeletal muscles. Exerc Immunol Rev 11: 53–63, 2005. [PubMed] [Google Scholar]
  • 56.Przybyla B, Gurley C, Harvey JF, Bearden E, Kortebein P, Evans WJ, Sullivan DH, Peterson CA, Dennis RA. Aging alters macrophage properties in human skeletal muscle both at rest and in response to acute resistance exercise. Exp Gerontol 41: 320–327, 2006. doi: 10.1016/j.exger.2005.12.007. [DOI] [PubMed] [Google Scholar]
  • 57.Rabuel C, Renaud E, Brealey D, Ratajczak P, Damy T, Alves A, Habib A, Singer M, Payen D, Mebazaa A. Human septic myopathy: induction of cyclooxygenase, heme oxygenase and activation of the ubiquitin proteolytic pathway. Anesthesiology 101: 583–590, 2004. doi: 10.1097/00000542-200409000-00006. [DOI] [PubMed] [Google Scholar]
  • 58.Raue U, Jemiolo B, Yang Y, Trappe S. TWEAK-Fn14 pathway activation after exercise in human skeletal muscle: insights from two exercise modes and a time course investigation. J Appl Physiol (1985) 118: 569–578, 2015. doi: 10.1152/japplphysiol.00759.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Raue U, Slivka D, Jemiolo B, Hollon C, Trappe S. Myogenic gene expression at rest and after a bout of resistance exercise in young (18–30 yr) and old (80–89 yr) women. J Appl Physiol (1985) 101: 53–59, 2006. doi: 10.1152/japplphysiol.01616.2005. [DOI] [PubMed] [Google Scholar]
  • 60.Raue U, Slivka D, Jemiolo B, Hollon C, Trappe S. Proteolytic gene expression differs at rest and after resistance exercise between young and old women. J Gerontol A Biol Sci Med Sci 62: 1407–1412, 2007. doi: 10.1093/gerona/62.12.1407. [DOI] [PubMed] [Google Scholar]
  • 61.Raue U, Slivka D, Minchev K, Trappe S. Improvements in whole muscle and myocellular function are limited with high-intensity resistance training in octogenarian women. J Appl Physiol (1985) 106: 1611–1617, 2009. doi: 10.1152/japplphysiol.91587.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Raue U, Trappe TA, Estrem ST, Qian HR, Helvering LM, Smith RC, Trappe S. Transcriptome signature of resistance exercise adaptations: mixed muscle and fiber type specific profiles in young and old adults. J Appl Physiol (1985) 112: 1625–1636, 2012. doi: 10.1152/japplphysiol.00435.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Rodemann HP, Goldberg AL. Arachidonic acid, prostaglandin E2 and F2α influence rates of protein turnover in skeletal and cardiac muscle. J Biol Chem 257: 1632–1638, 1982. [PubMed] [Google Scholar]
  • 64.Sailani MR, Halling JF, Møller HD, Lee H, Plomgaard P, Pilegaard H, Snyder MP, Regenberg B. Lifelong physical activity is associated with promoter hypomethylation of genes involved in metabolism, myogenesis, contractile properties and oxidative stress resistance in aged human skeletal muscle. Sci Rep 9: 3272, 2019. doi: 10.1038/s41598-018-37895-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Sardeli AV, Tomeleri CM, Cyrino ES, Fernhall B, Cavaglieri CR, Chacon-Mikahil MP. Effect of resistance training on inflammatory markers of older adults: a meta-analysis. Exp Gerontol 111: 188–196, 2018. doi: 10.1016/j.exger.2018.07.021. [DOI] [PubMed] [Google Scholar]
  • 66.Schaap LA, Pluijm SM, Deeg DJ, Harris TB, Kritchevsky SB, Newman AB, Colbert LH, Pahor M, Rubin SM, Tylavsky FA, Visser M; Health ABC Study . Higher inflammatory marker levels in older persons: associations with 5-year change in muscle mass and muscle strength. J Gerontol A Biol Sci Med Sci 64A: 1183–1189, 2009. doi: 10.1093/gerona/glp097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Schaap LA, Pluijm SM, Deeg DJ, Visser M. Inflammatory markers and loss of muscle mass (sarcopenia) and strength. Am J Med 119: 526.e9–526.e17, 2006. doi: 10.1016/j.amjmed.2005.10.049. [DOI] [PubMed] [Google Scholar]
  • 68.Slivka D, Raue U, Hollon C, Minchev K, Trappe S. Single muscle fiber adaptations to resistance training in old (>80 yr) men: evidence for limited skeletal muscle plasticity. Am J Physiol Regul Integr Comp Physiol 295: R273–R280, 2008. doi: 10.1152/ajpregu.00093.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Sokolowska M, Chen LY, Liu Y, Martinez-Anton A, Qi HY, Logun C, Alsaaty S, Park YH, Kastner DL, Chae JJ, Shelhamer JH. Prostaglandin E2 inhibits NLRP3 inflammasome activation through EP4 receptor and intracellular cyclic AMP in human macrophages. J Immunol 194: 5472–5487, 2015. doi: 10.4049/jimmunol.1401343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Standley RA, Liu SZ, Jemiolo B, Trappe SW, Trappe TA. Prostaglandin E2 induces transcription of skeletal muscle mass regulators interleukin-6 and muscle RING finger-1 in humans. Prostaglandins Leukot Essent Fatty Acids 88: 361–364, 2013. doi: 10.1016/j.plefa.2013.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Steensberg A, Keller C, Starkie RL, Osada T, Febbraio MA, Pedersen BK. IL-6 and TNF-α expression in, and release from, contracting human skeletal muscle. Am J Physiol Endocrinol Metab 283: E1272–E1278, 2002. doi: 10.1152/ajpendo.00255.2002. [DOI] [PubMed] [Google Scholar]
  • 72.Steensberg A, van Hall G, Osada T, Sacchetti M, Saltin B, Klarlund Pedersen B. Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced increase in plasma interleukin-6. J Physiol 529: 237–242, 2000. doi: 10.1111/j.1469-7793.2000.00237.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Sugimoto MA, Sousa LP, Pinho V, Perretti M, Teixeira MM. Resolution of inflammation: what controls its onset? Front Immunol 7: 160, 2016. doi: 10.3389/fimmu.2016.00160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Takayama K, García-Cardena G, Sukhova GK, Comander J, Gimbrone MA Jr, Libby P. Prostaglandin E2 suppresses chemokine production in human macrophages through the EP4 receptor. J Biol Chem 277: 44147–44154, 2002. doi: 10.1074/jbc.M204810200. [DOI] [PubMed] [Google Scholar]
  • 75.Trappe S, Godard M, Gallagher P, Carroll C, Rowden G, Porter D. Resistance training improves single muscle fiber contractile function in older women. Am J Physiol Cell Physiol 281: C398–C406, 2001. doi: 10.1152/ajpcell.2001.281.2.C398. [DOI] [PubMed] [Google Scholar]
  • 76.Trappe S, Hayes E, Galpin A, Kaminsky L, Jemiolo B, Fink W, Trappe T, Jansson A, Gustafsson T, Tesch P. New records in aerobic power among octogenarian lifelong endurance athletes. J Appl Physiol (1985) 114: 3–10, 2013. doi: 10.1152/japplphysiol.01107.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Trappe S, Williamson D, Godard M, Porter D, Rowden G, Costill D. Effect of resistance training on single muscle fiber contractile function in older men. J Appl Physiol (1985) 89: 143–152, 2000. doi: 10.1152/jappl.2000.89.1.143. [DOI] [PubMed] [Google Scholar]
  • 78.Trappe TA, Carroll CC, Dickinson JM, LeMoine JK, Haus JM, Sullivan BE, Lee JD, Jemiolo B, Weinheimer EM, Hollon CJ. Influence of acetaminophen and ibuprofen on skeletal muscle adaptations to resistance exercise in older adults. Am J Physiol Regul Integr Comp Physiol 300: R655–R662, 2011. doi: 10.1152/ajpregu.00611.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Trappe TA, Liu SZ. Effects of prostaglandins and COX-inhibiting drugs on skeletal muscle adaptations to exercise. J Appl Physiol (1985) 115: 909–919, 2013. doi: 10.1152/japplphysiol.00061.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Trappe TA, Ratchford SM, Brower BE, Liu SZ, Lavin KM, Carroll CC, Jemiolo B, Trappe SW. COX inhibitor influence on skeletal muscle fiber size and metabolic adaptations to resistance exercise in older adults. J Gerontol A Biol Sci Med Sci 71: 1289–1294, 2016. doi: 10.1093/gerona/glv231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Trappe TA, Standley RA, Jemiolo B, Carroll CC, Trappe SW. Prostaglandin and myokine involvement in the cyclooxygenase-inhibiting drug enhancement of skeletal muscle adaptations to resistance exercise in older adults. Am J Physiol Regul Integr Comp Physiol 304: R198–R205, 2013. doi: 10.1152/ajpregu.00245.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Trappe TA, White F, Lambert CP, Cesar D, Hellerstein M, Evans WJ. Effect of ibuprofen and acetaminophen on postexercise muscle protein synthesis. Am J Physiol Endocrinol Metab 282: E551–E556, 2002. doi: 10.1152/ajpendo.00352.2001. [DOI] [PubMed] [Google Scholar]
  • 83.Tsintzas K, Stephens FB, Snijders T, Wall BT, Cooper S, Mallinson J, Verdijk LB, van Loon LJ. Intramyocellular lipid content and lipogenic gene expression responses following a single bout of resistance type exercise differ between young and older men. Exp Gerontol 93: 36–45, 2017. doi: 10.1016/j.exger.2017.03.018. [DOI] [PubMed] [Google Scholar]
  • 84.van Hall G, Steensberg A, Fischer C, Keller C, Møller K, Moseley P, Pedersen BK. Interleukin-6 markedly decreases skeletal muscle protein turnover and increases nonmuscle amino acid utilization in healthy individuals. J Clin Endocrinol Metab 93: 2851–2858, 2008. doi: 10.1210/jc.2007-2223. [DOI] [PubMed] [Google Scholar]
  • 85.Visser M, Pahor M, Taaffe DR, Goodpaster BH, Simonsick EM, Newman AB, Nevitt M, Harris TB. Relationship of interleukin-6 and tumor necrosis factor-α with muscle mass and muscle strength in elderly men and women: the Health ABC Study. J Gerontol A Biol Sci Med Sci 57: M326–M332, 2002. doi: 10.1093/gerona/57.5.M326. [DOI] [PubMed] [Google Scholar]
  • 86.Wahl SM, Hunt DA, Wakefield LM, McCartney-Francis N, Wahl LM, Roberts AB, Sporn MB. Transforming growth factor type β induces monocyte chemotaxis and growth factor production. Proc Natl Acad Sci USA 84: 5788–5792, 1987. doi: 10.1073/pnas.84.16.5788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Weinheimer EM, Jemiolo B, Carroll CC, Harber MP, Haus JM, Burd NA, LeMoine JK, Trappe SW, Trappe TA. Resistance exercise and cyclooxygenase (COX) expression in human skeletal muscle: implications for COX-inhibiting drugs and protein synthesis. Am J Physiol Regul Integr Comp Physiol 292: R2241–R2248, 2007. doi: 10.1152/ajpregu.00718.2006. [DOI] [PubMed] [Google Scholar]
  • 88.Williamson DL, Gallagher PM, Carroll CC, Raue U, Trappe SW. Reduction in hybrid single muscle fiber proportions with resistance training in humans. J Appl Physiol (1985) 91: 1955–1961, 2001. doi: 10.1152/jappl.2001.91.5.1955. [DOI] [PubMed] [Google Scholar]
  • 89.Yang Y, Creer A, Jemiolo B, Trappe S. Time course of myogenic and metabolic gene expression in response to acute exercise in human skeletal muscle. J Appl Physiol (1985) 98: 1745–1752, 2005. doi: 10.1152/japplphysiol.01185.2004. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Applied Physiology are provided here courtesy of American Physiological Society

RESOURCES