Skip to main content
Gut Pathogens logoLink to Gut Pathogens
. 2020 Jan 27;12:5. doi: 10.1186/s13099-020-0345-2

Colistin-resistant Escherichia coli carrying mcr-1 in food, water, hand rinse, and healthy human gut in Bangladesh

Fatema-Tuz Johura 1, Jarin Tasnim 1, Indrajeet Barman 1, Sahitya Ranjan Biswas 1, Fatema Tuz Jubyda 1, Marzia Sultana 1, Christine Marie George 2, Andrew Camilli 3, Kimberley D Seed 4, Niyaz Ahmed 1, Munirul Alam 1,
PMCID: PMC6986151  PMID: 32002025

Abstract

Background

One of the most significant public health concerns in today’s world is the persistent upsurge of infections caused by multidrug resistant bacteria. As a result, clinicians are being forced to intervene with either less effective backup drugs or ones with substantial side-effects. Colistin is a last resort antimicrobial agent for the treatment of infections caused by multi-drug resistant gram-negative bacteria.

Methods

Escherichia coli (n = 65) isolated from street food (n = 20), hand rinse (n = 15), surface water (n = 10), and healthy human stool (n = 20) were tested for colistin resistance gene mcr-1 and response to antimicrobial agents. Antimicrobial resistance genes and virulence genes were detected by employing polymerase chain reaction. DNA fingerprinting of the strains were determined by pulsed-field gel electrophoresis.

Results

Screening of E. coli allowed us to confirm colistin resistance marker gene mcr-1 in 13 strains (street food, n = 4; hand rinse, n = 2; surface water, n = 4; and stool, n = 3); and two of these E. coli strains carrying mcr-1 harbored blaTEM gene encoding extended spectrum beta lactamase. Antibiotic assay results revealed all 13 E. coli strains carrying mcr-1 to be multi-drug resistant (MDR), including to colistin. The minimum inhibitory concentration (MIC) for colistin ranged from 2 to 6 μg/ml. DNA sequencing confirmed homogeneity of the nucleotide sequence for mcr-1, but the E. coli strains were heterogenous, as confirmed by pulsed-field gel electrophoresis suggesting horizontal transmission of colistin resistance in Bangladesh.

Conclusion

Widespread dissemination of E. coli strains carrying mcr-1 encoding resistance to colistin in the present study is alarming as this is the last resort drug for the treatment of infections caused by MDR gram-negative bacteria resistant to almost all drugs used commonly.

Keywords: Colistin, mcr-1, ESBL, Multi-drug resistant (MDR), Minimum inhibitory concentration (MIC), Horizontal transmission

Background

Antimicrobial resistance (AMR) is one of the major global public health concerns of this century, which has made the effective treatment of an ever-increasing array of infectious diseases very challenging. The overuse of antibiotics in health and agriculture has put ubiquitous microbes under consistent selective pressure. As a result, only the microbes resistant to multiple antibiotics are thriving in the environment [1]. Bacteria belonging to the family Enterobacteriaceae include important pathogens that are ubiquitous in nature. The ability of Enterobacteriaceae to acquire mobile genetic elements carrying antibiotic resistance through horizontal transfer of genes has enabled this group to be the most successful in acquisition of resistance to multiple antibiotics, including the most effective next generation carbapenems [2].

In recent years there has been a tremendous increase in the incidence of critical infections in which the etiological agent is MDR gram-negative bacteria, in particular cephalosporin- and carbapenem-resistant Enterobacteriaceae. The ability to produce extended spectrum β-lactamases (ESBL) allows bacteria to be resistant to most beta-lactam antibiotics, including cephalosporin [3], an important drug of choice for treating both gram-positive and gram-negative bacterial infections. Widespread resistance to newer generations of cephalosporins is attributed largely to the spread of CTX-M type extended-spectrum β-lactamases (ESBLs) in gram-negative bacteria, especially in Escherichia coli. As a result, the rapid global dissemination of the ESBL-producing E. coli is an emerging public-health concern [4]. For ESBL and Ampicillinase C (AmpC) producers, carbapenems are the drugs of choice [5]. But dissemination of plasmid-mediated carbapenemases such as Klebsiella pneumoniae Carbapenemase (KPC) and metallo-lactamases, e.g. VIM, NDM-1 and IMP in carbapenem resistant Enterobacteriaceae (CRE) [6] left no drug to control them except for the last resort antibiotics, like colistin [7].

Colistin (also known as polymyxin E) is a cationic polypeptide antibiotic that interacts with the outer membrane of the gram-negative bacteria [8]. Despite colistin once being avoided due to its nephro- and neurotoxicity [9], this drug has now become a last-resort antimicrobial agent for treating life-threatening infections caused by MDR gram-negative bacteria. However, in November 2015, the first plasmid borne colistin resistance gene mcr-1, encoding a phosphoethanolamine transferase, was detected in livestock and raw meat samples as well as humans in China [10]. A recent study in Bangladesh reported mcr-1 carrying E. coli in an urban sludge sample collected from Dhaka city [11]. Although little is known about the use of colistin in the clinical management of infectious diseases, this antibiotic has been widely used in the poultry industries of Bangladesh [12]. A recent study has reported E. coli carrying mcr-3 from poultry in Moymonsingh, Bangladesh [13]. This cross-sectional study reported here was carried out in Dhaka city with the aim to understand the distribution of colistin resistant E. coli in street food and drink, water, hand rinse samples of street food-drink vendors, and stool from healthy humans.

Materials and method

Sample collection

To investigate the occurrence of colistin resistant bacteria, a total of 65 samples comprising healthy human stool (n = 20), street food and drink [n = 20; mixed fruit juice (n = 3), sugarcane juice (n = 2), Velpuri (a widely liked food item; n = 3), sliced guava mixed with pickles (n = 1), sliced pineapple mixed with pickles (n = 3), Peas cooked with spices (n = 3), and sliced cucumber (n = 5)], hand rinse samples of street food handlers (n = 15), and surface water (n = 10) were collected randomly from Dhaka city during June 2018. Human stools for healthy individuals were collected aseptically in stool collection cups and placed immediately in Cary-Blair media and transported to laboratory maintaining cold-chain. The water samples were collected using sterile 500 mL dark Nalgene bottles (Nalgene Nunc International, St. Louis, Mo.) and food samples were collected in 120 mL Whirlpak bag (NASCO WHIRL-PAK®, USA). For collection of hand rinse samples, street food handlers were asked to insert and wash their hands in 800-ml Whirl–Pak bag (NASCO WHIRL-PAK®, USA) containing 250 ml of sterile phosphate buffered saline. All samples were transported to the icddr, b laboratory in an insulated cool box (with ice packs).

Isolation of Escherichia coli

The isolation of E. coli from all samples were performed using MacConkey agar (BD Difco, USA). Stool and juice samples were directly inoculated on MacConkey agar, while food samples were homogenized and diluted in PBS before inoculation on agar plates. For hand rinse and surface water samples, water was filtered through 0.22 μm filter papers and then the membrane filters were placed on MacConkey agar plate. The inoculated plates were incubated overnight at 37 °C. Bright pink lactose-fermenting colonies were selected as presumptive E. coli, which were grown on eosin methylene blue (EMB) agar to examine for the production of green colonies with a metallic sheen, a characteristic of important diagnostic implication for the bacterium. One presumptive colony per sample was selected at random, and subjected to biochemical confirmation with API 20 E (BioMerieux, France).

Detection of colistin resistance mcr-1 gene

Bacterial DNA was obtained from all isolates by the boiling method [14]. All E. coli strains were examined for the presence of mcr-1 gene by polymerase chain reaction (PCR) using primers as described elsewhere [10]. The primer sequences and corresponding annealing temperatures used in all PCR reactions in this study are listed in Table 1.

Table 1.

PCR primers used in this study

Target gene Primer Sequence Amplicon size (bp) References
mcr1 CLR5F CGGTCAGTCCGTTTGTTC 309 [10]
CLR5R CTTGGTCGGTCTGTA GGG
LT LT 450F GGCGACAGATTATACCGTGC 450 [21]
LT 450R CGGTCTCTATATTCCCTGT
STp STp186F TCTGTATTATCTTTCCCCTC 186 [22]
STp 186R ATAACATCCAGCACAGGC
STh STh5f TCACCTTTCCCTCAGGAT 160 [23]
STh6r TACAAGCAGGATTACAACAC
pCVD432 EAEC1 CTGGCGAAAGACTGTATCAT 630 [24]
EAEC2 CAATGTATAGAAATCCGCTGTT
blaCTX-M-15 CTX-M-15F CACACGTGGAATTTAGGGACT 996 [25]
CTX-M-15R GCCGTCTAAGGCGATAAACA
blaCTX-M-2 CTXM2F CGGYGCTTAAACAGAGCGAG 891 [26]
CTXM2R CCATGAATAAGCAGCTGATTGCCC
blaCTX-M-8 CTXM8F ACGCTCAACACCGCGATC 490 [26]
CTXM8R CGTGGGTTCTCGGGGATAA
blaCTX-M-9 CTXM9F GATTGACCGTATTGGGAGTTT 947 [26]
CTXM9R CGGCTGGGTAAAATAGGTCA
blaTEM TEM-R ACGCTCAGTGGAACGAAAAC 1150 [27]
TEM-F ATTCTTGAAGACGAAAGGGC
blaNDM1 NDM-1F GGTTTGGCGATCTGGTTTTC 621 [28]
NDM-1R CGGAATGGCTCATCACGATC
blaOXA-48 OXA-F GCGTGGTTAAGGATGAACAC 438 [29]
OXA-R CATCAAGTTCAACCCAACCG
blaCMY-2 CMY-2-R CCCGTTTTATGCACCCATGA 870 [30]
CMY-2-F TGGCCGTTGCCGTTATCTAC
mphA mphA-F GTGAGGAGGAGCTTCGCGAG 403 [31]
mphA-R TGCCGCAGGACTCGGAGGTC

Sequencing of mcr-1 gene

Amplified fragment of mcr-1 was sequenced using an ABI PRISM Big Dye Terminator Cycle Sequencing Reaction kit (Applied Biosystems) on an ABI PRISM 310 automated sequencer (Applied Biosystems). The raw sequences were subjected to sequence analysis software (Chromas), the sequences were then searched for homology using Basic Local Alignment Search Tool (BLAST). The partial sequences of the gene were submitted to GenBank (Accession Numbers: MN337021, MN337022, MN337023, MN337024, and MN337025).

Determination of minimum inhibitory concentration (MIC) of colistin

The mcr-1 positive strains were tested for their response to colistin by measuring the MIC by E-test (BioMerieux). The results were interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints [15]. Although broth microdilution assay is recommended by EUCAST for determining MIC, several studies have found a congruous correlation between the E-test and reference techniques [16-18].

Antimicrobial susceptibility tests

Colistin resistant strains were tested for their susceptibility to other antimicrobials following the disc diffusion method as described by Bauer et al. [19] using commercially available antibiotic discs. Eighteen commonly used antibiotics (Oxoid, UK) tested in this study include: ceftriaxone (CRO 30 µg), cephalothin (KF 30 µg), cefipime (FEP 30 µg), cefixime (CFM 5 µg), fosfomycin (FOS 50 µg), mecillinam ( MEL 25 µg), tetracycline (TE 30 µg), sulphamethoxazole-trimethoprium (SXT 25 µg), levofloxacin (LEV 5 µg), erythromycin (E 15 µg), azithromycin (AZM 15 µg), imipenem (IPM 10 µg), ampicillin (AMP 10 µg), nalidixic Acid (NA 30 µg), ciprofloxacin (CIP 5 µg), gentamicin (CN 10 µg), chloramphenicol (C 30 µg), and aztreonam (ATM 30 µg). The resistance or susceptibility profiles of the isolates were determined by measuring the inhibitory zone and comparing it with an interpretative chart to determine sensitivity to the antibiotics according to Clinical and Laboratory Standards Institute guideline [20]. E. coli ATCC 25922 was used as a positive control.

Detection of virulence gene

Colistin resistant E. coli isolates were tested for the presence of genes for ETEC-specific heat-labile toxin (lt) and heat stable toxin (STp, STh), EAEC virulence plasmid pCVD432 by PCR.

Detection of genes associated with ESBL carbapenem and macrolide resistance

The colistin resistant E. coli strains were targeted to detect ESBL genes (blaCTX-M-15, blaCTX-M-2-group, blaCTX-M-8-group, blaCTX-M-9-group, bla TEM), carbapenemase genes (blaNDM-1 blaOXA -48, bla CMY-2), and macrolide resistance gene (mphA) by PCR.

Pulsed-field gel electrophoresis (PFGE)

mcr-1+ E. coli strains were analyzed using pulsed-field gel electrophoresis (PFGE) according to standard protocols [32]. The fingerprint patterns were typed according to banding similarity and dissimilarity, using the dice similarity coefficient and unweighted-pair group method employing average linkage (UPGMA) clustering, as recommended by the manufacturer. The results were graphically represented as dendrograms.

Results and discussion

A total 65 E. coli were isolated by culture methods from street food (n = 20), hand rinse (n = 15), surface water (n = 10), and healthy human stool (n = 20). The genomic DNA of these strains were subjected to PCR using specific primers for the colistin resistance gene mcr-1 [10]. Of the 65 E. coli strains tested, 13 (20%) (Street food; 4, hand rinse; 2, surface water; 4, and healthy human gut; 3) carried a 309 bp amplicon specific for the mcr-1 gene (Table 2). The 309 bp fragments of mcr-1 from five representative E. coli strains from healthy human stool (n = 2), water (n = 1), hand rinse (n = 1), and street food (n = 1) were subjected to nucleotide sequencing (Genbank Accession No. MN337021, MN337022, MN337023, MN337024, and MN337025). Although it was not possible in this study to cover the full-length sequence of the gene, BLAST homology search demonstrated the nucleotide sequences to be identical to that of the corresponding mcr-1 portion reported earlier from E. coli strains (Genbank Accession No. KP347127, NG056412, CP015913, KY770023, and KY550358). These previously reported sequences were found in E.coli isolated from animal and water sources of China, Japan, USA, Brazil and South America. E. coli carrying mcr-1 has been reported in recent years from urban sludge samples from Bangladesh [11]. The data in the present study show how rapidly the colistin resistant E. coli carrying mcr-1 has been disseminating, as those were found from street foods, hand rinse samples of the street food vendors, and healthy human gut in Dhaka, a densely populated city of Bangladesh. Although the study was limited to Dhaka, the results may be indicative of the prevalence and spread of the colistin resistant E. coli throughout Bangladesh.

Table 2.

MIC value and drug resistance pattern of colistin resistant mcr-1 carrying E. coli (n = 13) strains

Source No. of isolates mcr-1 MIC of colistin (μg/ml) Resistance pattern
Street drink (sugarcane juice) 1  +  4 KF, CFM, CRO, TE, SXT, LEV, E, AZM, AMP, NA, CN, CIP, ATM
Street drink (sugarcane juice) 1  +  4 KF, TE, SXT, LEV, E, AMP, NA, CIP.CN
Street drink (mixed fruit juice) 1  +  3 TE, SXT, E, AMP, CN
Street drink (mixed fruit juice) 1  +  6 KF, TE, SXT, E, AZM, AMP, CN, NA
Hand rinse 1  +  4 TE, SXT, E, AMP, NA
Hand rinse 1  +  2 KF, TE, SXT, LEV, E, AMP, NA, CIP, C
Surface water 1  +  3 TE, SXT, E, AMP, NA
Surface water 1  +  4 TE, SXT, AZM, E, AMP, NA
Surface water 1  +  4 KF, TE, SXT, LEV, E, AZM, AMP, NA, CN, CIP, C
Surface water 1  +  4 KF, TE, AMP,
Healthy human stool 2  +  4 KF, TE, SXT, LEV, E, AZM, AMP, NA, CIP, CN
Healthy human stool 1  +  3 KF, TE, SXT, E, AMP, CN

CFM cefixime, KF cephalothin, CRO ceftriaxone, TE tetracycline, SXT sulphamethoxazole/trimethoprium, LEV levofloxacin, E erythromycin, AZM azithromycin, AMP ampicillin, NA nalidixic acid, CN gentamicin, CIP ciprofloxacin, ATM aztreonam, C chloramphenicol

Escherichia coli strains carrying mcr-1 were found to be resistant to colistin in the present study. The MIC value was determined to range from 2 to 6 μg/ml. Using the Kirby–Bauer disk diffusion assay, we showed that these colistin resistant E. coli strains were MDR with resistance varying from 3 to 13 different antibiotics. Among the 13 mcr-1 carrying E. coli strains, 100% (13/13) were resistant to tetracycline and ampicillin, 92% (12/13) resistant to erythromycin and sulphamethoxazole-trimethoprium, 77% (10/13) resistant to nalidixic acid, 69% (9/13) resistant to cephalothin, 62% (8/13) resistant to gentamycin, 46% (6/13) resistant to levofloxacin, azithromycin and ciprofloxacin, 15% (2/13) resistant to chloramphenicol, and 8% (1/13) resistant to cefixime, ceftriaxone and aztreonam. All of the mcr-1 carrying E. coli strains were sensitive to fosfomycin, mecillinam, imipenem, and cefipime. Only one strain was resistant to 3rd generation cephalosporins (cefixime and ceftriaxone). The widespread occurrence of colistin resistant MDR E. coli is alarming for a densely populated country like Bangladesh where morbidity and mortality due to infectious diseases are prevalent [12, 33]. Transmission control of colistin resistant bacteria warrant urgent attention, although further studies would be required to comprehend the transmission from community to clinical settings.

We tested all of the mcr-1 positive E. coli strains for the presence of other important antimicrobial resistance marker genes. Of the 13 mcr-1 carrying E. coli strains, only two isolated from street food and healthy human gut harbored the ESBL gene blaTEM. Also, eight E. coli strains isolated from street food (n = 3), surface water (n = 2) and healthy human gut (n = 3) had the macrolide resistance gene mphA, which reflects the higher percentage of erythromycin and azithromycin resistance within the isolates (Table 3). Although we have not tested the strains for plasmid carriage, ESBL and mcr-1 genes can co-exist on the same plasmid and therefore could facilitate dissemination of colistin resistance [34]. The E. coli strains carrying mcr-1 were heterogenous genetically, as confirmed by PFGE (Fig. 1), suggesting horizontal transmission of the antimicrobial resistance genes. None of the mcr-1 carrying E. coli strains in the present study are believed to be pathogenic as they did not carry any of the virulence and related genes namely LT, STp, STh and pcvd432 plasmid. Nonetheless, the occurrence of colistin resistant bacteria in the human gut was important as they could serve as a reservoir for future transfer to pathogenic strains.

Table 3.

Virulence and resistance genes profile of mcr-1 carrying E. coli

Source No. of isolates Virulence gene profile Resistance gene profile
LT STp STh pcvd 432 blaOXA-48 blaCMY-2 blaNDM-1 blaTEM bla CTX-M-15 bla CTX-M-2 blaCTX-M-8 blaCTX-M-9 mphA
Street food (sugarcane juice) 1  +   + 
Street food (sugarcane juice) 1
Street food (mixed fruit juice) 2  + 
Hand rinse 2
Surface water 2  + 
Surface water 2
Healthy human gut 1  +   + 
Healthy human gut 2  + 

Fig. 1.

Fig. 1

Dendrogram showing genomic relatedness of mcr-1 carrying E. coli strains. Pulsed-field gel electrophoresis (PFGE) patterns of XbaI-digested genomic DNA of representative mcr-1 carrying E. coli strains isolated from healthy human gut, water, street food and hand rinse of street food vendors. The dendrogram was prepared by the BioNeumeric software (Applied Maths) using dice similarity coefficient and unweighted-pair group method employing average linkage of the PFGE images of the E. coli strains. The scale bar at the top (left) indicates similarity coefficient (%).

Conclusion

The usefulness of colistin, a last-resort antibiotic for the treatment of MDR gram-negative bacterial infections, is being compromised as shown by the recent identification of the mobile colistin resistance gene, mcr-1 [10]. The mcr-1 gene has spread to most continents, and has been detected in various bacterial isolates from animals, human and the environment, including E. coli, Klebsiella pneumoniae, Enterobacter cloacae and Enterobacter aerogenes [35]. In Bangladesh, colistin resistant E. coli carrying mcr-1 was reported earlier from urban sludge samples [11]. Here in this study, colistin resistant E. coli carrying mcr-1 gene was found from water, street food, hand rinse samples of street food vendors, and healthy human gut samples in Bangladesh. This is alarming and sheds light on the potential health risk that colistin resistant E. coli could pose to millions of people in Bangladesh as colistin is a last resort antibiotic for the treatment of MDR gram-negative bacterial infections.

Acknowledgements

International Centre for Diarrheal Disease Research, Bangladesh acknowledges the following donors: the Governments of Bangladesh, Canada, Sweden and United Kingdom for providing core/unrestricted support.

Authors’ contributions

FTJ and MA participated in the conception and design of the study. FTJ, JT, IB, SRB, FTJ and MS performed the laboratory work. FTJ and MA analyzed the data and wrote the manuscript. CMG, AC, KDS, and NA contributed to the analysis and helped in writing the manuscript. All authors read and approved the final manuscript.

Funding

This research study was supported jointly by International Centre for Diarrheal Disease Research, Bangladesh, NIH Grant 1R01AI39129-01 and the National Institutes of Infectious Diseases (NIID), Japan.

Availability of data and materials

Sequence data that support the findings of this study have been deposited in GenBank with the primary accession codes MN337021, MN337022, MN337023, MN337024, and MN337025.

Ethics approval and consent to participate

Ethical approval and consent to participate was obtained from the ethical committee of International Center for Diarrheal Disease Research, Bangladesh (icddr, b).

Consent for publication

Yes.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Aslam B, Wang W, Arshad MI, Khurshid M, Muzammil S, Rasool MH, Nisar MA, Alvi RF, Aslam MA, Qamar MU, Salamat MK. Antibiotic resistance: a rundown of a global crisis. Infect Drug Resist. 2018;11:1645. doi: 10.2147/IDR.S173867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lerminiaux NA, Cameron AD. Horizontal transfer of antibiotic resistance genes in clinical environments. Can J Microbiol. 2018;65(1):34–44. doi: 10.1139/cjm-2018-0275. [DOI] [PubMed] [Google Scholar]
  • 3.Smet A, Martel A, Persoons D, Dewulf J, Heyndrickx M, Catry B, Herman L, Haesebrouck F, Butaye P. Diversity of extended-spectrum β-lactamases and class C β-lactamases among cloacal Escherichia coli isolates in Belgian broiler farms. Antimicrob Agents Chemother. 2008;52(4):1238–1243. doi: 10.1128/AAC.01285-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Pitout JD, Laupland KB. Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis. 2008;8(3):159–166. doi: 10.1016/S1473-3099(08)70041-0. [DOI] [PubMed] [Google Scholar]
  • 5.Rodríguez-Baño J, Gutiérrez-Gutiérrez B, Machuca I, Pascual A. Treatment of infections caused by extended-spectrum-beta-lactamase-, AmpC-, and carbapenemase-producing Enterobacteriaceae. Clin Microbiol Rev. 2018;31(2):e00079–e117. doi: 10.1128/CMR.00079-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Pfeifer Y, Cullik A, Witte W. Resistance to cephalosporins and carbapenems in gram-negative bacterial pathogens. Int J Med Microbiol. 2010;300(6):371–379. doi: 10.1016/j.ijmm.2010.04.005. [DOI] [PubMed] [Google Scholar]
  • 7.Nation RL, Li J. Colistin in the 21st century. Current Opin Infect Dis. 2009;22(6):535–543. doi: 10.1097/QCO.0b013e328332e672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Baron S, Hadjadj L, Rolain JM, Olaitan AO. Molecular mechanisms of polymyxin resistance: knowns and unknowns. Int J Antimicrob Agents. 2016;48(6):583–591. doi: 10.1016/j.ijantimicag.2016.06.023. [DOI] [PubMed] [Google Scholar]
  • 9.Koch-Weser JA, Sidel VW, Federman EB, Kanarek P, Finer DC, Eaton AE. Adverse effects of sodium colistimethate: manifestations and specific reaction rates during 317 courses of therapy. Ann Intern Med. 1970;72(6):857–868. doi: 10.7326/0003-4819-72-6-857. [DOI] [PubMed] [Google Scholar]
  • 10.Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu LF. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016;16(2):161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
  • 11.Islam A, Rahman Z, Monira S, Rahman MA, Camilli A, George CM, Ahmed N, Alam M. Colistin resistant Escherichia coli carrying mcr-1 in urban sludge samples: Dhaka, Bangladesh. Gut Pathog. 2017;9(1):77. doi: 10.1186/s13099-017-0227-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Islam KS, Shiraj-Um-Mahmuda S, Hazzaz-Bin-Kabir M. Antibiotic usage patterns in selected broiler farms of Bangladesh and their public health implications. J Public Health Dev Countries. 2016;2(3):276–284. [Google Scholar]
  • 13.Sobur MA, Ievy S, Haque ZF, Nahar A, Zaman SB, Rahman MT. Emergence of colistin-resistant Escherichia coli in poultry, house flies, and pond water in Mymensingh, Bangladesh. J Adv Vet Anim Res. 2019;6(1):50–53. doi: 10.5455/javar.2019.f311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Šeputienė V, Povilonis J, Ružauskas M, Pavilonis A, Sužiedėlienė E. Prevalence of trimethoprim resistance genes in Escherichia coli isolates of human and animal origin in Lithuania. J Med Microbiol. 2010;59(3):315–322. doi: 10.1099/jmm.0.015008-0. [DOI] [PubMed] [Google Scholar]
  • 15.European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters: version 6.0. (2016). https://www.eucast.org/feadmin/src/media/PDFs/EUCAST_fes/Breakpoint_tables/v_6.0_Breakpoint_table.pdfAccessed 15 Mar 2016
  • 16.Behera B, Mathur P, Das A, Kapil A, Gupta B, Bhoi S, Farooque K, Sharma V, Misra MC. Evaluation of susceptibility testing methods for polymyxin. Int J Infect Dis. 2010;14(7):e596–601. doi: 10.1016/j.ijid.2009.09.001. [DOI] [PubMed] [Google Scholar]
  • 17.Lo-Ten-Foe JR, de Smet AM, Diederen BM, Kluytmans JA, van Keulen PH. Comparative evaluation of the VITEK 2, disk diffusion, Etest, broth microdilution, and agar dilution susceptibility testing methods for colistin in clinical isolates, including heteroresistant Enterobacter cloacae and Acinetobacter baumannii strains. Antimicrob Agents Chemother. 2007;51(10):3726–3730. doi: 10.1128/AAC.01406-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Maalej SM, Meziou MR, Rhimi FM, Hammami A. Comparison of disc diffusion, Etest and agar dilution for susceptibility testing of colistin against Enterobacteriaceae. Lett Appl Microbiol. 2011;53(5):546–551. doi: 10.1111/j.1472-765X.2011.03145.x. [DOI] [PubMed] [Google Scholar]
  • 19.Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45(4):493–496. doi: 10.1093/ajcp/45.4_ts.493. [DOI] [PubMed] [Google Scholar]
  • 20.CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 26th ed. CLSI supplement M100S. Wayne, PA: Clinical and Laboratory Standards Institute; 2016.
  • 21.Aranda KR, Fagundes-Neto U, Scaletsky IC. Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin Microbiol. 2004;42(12):5849–5853. doi: 10.1128/JCM.42.12.5849-5853.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Schultsz C, Pool GJ, Van Ketel R, De Wever B, Speelman P, Dankert J. Detection of enterotoxigenic Escherichia coli in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR. J Clin Microbiol. 1994;32(10):2393–2397. doi: 10.1128/JCM.32.10.2393-2397.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bölin I, Wiklund G, Qadri F, Torres O, Bourgeois AL, Savarino S, Svennerholm AM. Enterotoxigenic Escherichia coli with STh and STp genotypes is associated with diarrhea both in children in areas of endemicity and in travelers. J Clin Microbiol. 2006;44(11):3872–3877. doi: 10.1128/JCM.00790-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Schmidt H, Knop C, Franke S, Aleksic S, Heesemann J, Karch H. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol. 1995;33(3):701–705. doi: 10.1128/JCM.33.3.701-705.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sidjabat HE, Paterson DL, Adams-Haduch JM, Ewan L, Pasculle AW, Muto CA, Tian GB, Doi Y. Molecular epidemiology of CTX-M-producing Escherichia coli isolates at a tertiary medical center in western Pennsylvania. Antimicrob Agents Chemother. 2009;53(11):4733–4739. doi: 10.1128/AAC.00533-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ryoo NH, Kim EC, Hong SG, Park YJ, Lee K, Bae IK, Song EH, Jeong SH. Dissemination of SHV-12 and CTX-M-type extended-spectrum β-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. J Antimicrob Chemother. 2005;56(4):698–702. doi: 10.1093/jac/dki324. [DOI] [PubMed] [Google Scholar]
  • 27.Sáenz Y, Brinas L, Domínguez E, Ruiz J, Zarazaga M, Vila J, Torres C. Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob Agents Chemother. 2004;48(10):3996–4001. doi: 10.1128/AAC.48.10.3996-4001.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sheikh AF, Rostami S, Jolodar A, Tabatabaiefar MA, Khorvash F, Saki A, Shoja S, Sheikhi R. Detection of metallo-beta lactamases among carbapenem-resistant Pseudomonas aeruginosa. Jundishapur J Microbiol. 2014;7(11):e12289. doi: 10.5812/jjm.12289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Abdulla AA, Al-Dahmoshi HO, Abed TA, Muttaleb WH. Characterization of multidrug resistant carbapenemases-producing Escherichia coli and Klebsiella pneumoniae isolates from urinary tract infection. J Chem Pharm Sci. 2016;9(3):1116–1120. [Google Scholar]
  • 30.Torkan S, Khamesipour F, Anyanwu MU. Detection of virulence and antibacterial resistance genes in Salmonella isolates from diarrhoeic dogs in Iran. Rev Med Vet. 2015;1(166):221–228. [Google Scholar]
  • 31.Nguyen MC, Woerther PL, Bouvet M, Andremont A, Leclercq R, Canu A. Escherichia coli as reservoir for macrolide resistance genes. Emerg Infect Dis. 2009;15(10):1648. doi: 10.3201/eid1510.090696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, Barrett TJ. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157: H7, Salmonella, and Shigella for PulseNet. Foodbourne Pathog Dis. 2006;3(1):59–67. doi: 10.1089/fpd.2006.3.59. [DOI] [PubMed] [Google Scholar]
  • 33.Rahman Z, Islam A, Rashid MU, Johura FT, Monira S, Watanabe H, Ahmed N, Camilli A, Alam M. Existence of a novel qepA variant in quinolone resistant Escherichia coli from aquatic habitats of Bangladesh. Gut Pathog. 2017;9(1):58. doi: 10.1186/s13099-017-0207-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Dandachi I, Chabou S, Daoud Z, Rolain JM. Prevalence and Emergence of extended-spectrum cephalosporin-, carbapenem-and colistin-resistant gram negative bacteria of animal origin in the Mediterranean Basin. Front Microbiol. 2018 doi: 10.3389/fmicb.2018.02299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Skov RL, Monnet DL. Plasmid-mediated colistin resistance (mcr-1 gene): three months later, the story unfolds. Eurosurveillance. 2016;21(9):30155. doi: 10.2807/1560-7917.ES.2016.21.9.30155. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Sequence data that support the findings of this study have been deposited in GenBank with the primary accession codes MN337021, MN337022, MN337023, MN337024, and MN337025.


Articles from Gut Pathogens are provided here courtesy of BMC

RESOURCES