Skip to main content
3 Biotech logoLink to 3 Biotech
. 2020 Jan 28;10(2):76. doi: 10.1007/s13205-020-2063-3

Color characteristics, pigment accumulation and biosynthetic analyses of leaf color variation in herbaceous peony (Paeonia lactiflora Pall.)

Yuhan Tang 1,2, Ziwen Fang 2, Mi Liu 2, Daqiu Zhao 2, Jun Tao 1,2,✉
PMCID: PMC6987280  PMID: 32051809

Abstract

Herbaceous peony (Paeonia lactiflora Pall.) is one of the color-leaved ornamental spring plants, with graceful appearance and splendid color. However, the underlying mechanism of this coloration variation from purple to green has not been studied in P. lactiflora. In th study, the leaves in purple, purple–green, and green stages were compared in terms of anatomical, physiological, and molecular. We found that the variation of leaf color from purple to green was mainly determined by the change in pigments distributed in the leaf surface. Physiological experiments showed a significant increase in chlorophyll contents and a notable reduction in anthocyanin contents in leaves from the purple to green stages. We further found that the anthocyanin biosynthesis-related dihydroflavonol 4-reductase (DFR) gene and anthocyanin synthase (ANS) gene as well as chlorophyll biosynthesis-related glutamyl-tRNA reductase (HEMA) gene showed a decreased trend in leaves from purple to green stages, whereas the chlorophyll degradation-related chlorophyll b reductase (NYC) gene showed a rising trend. Alteration of DFR and ANS gene expression might reduce anthocyanin accumulation, whereas increased HEMA gene expression would enhance chlorophyll biosynthesis and reduced NYC gene expression would inhibit chlorophyll degradation. Consequently, reduction in anthocyanins and enhanced deposition of chlorophylls resulted in leaf coloration variation from purple to green in P. lactiflora, which could improve our understanding of its mechanism for further studies.

Electronic supplementary material

The online version of this article (10.1007/s13205-020-2063-3) contains supplementary material, which is available to authorized users.

Keywords: Herbaceous peony, Anthocyanins, Chlorophylls, Gene expression

Introduction

For ornamental plants, leaf color is a key trait gaining increasing attention for its great ornamental value. Color-leaved plants play an important role in landscaping for their unique leaf color. The leaf color in plants is mainly determined by leaf pigments comprising chlorophylls, carotenoids, and anthocyanins. Chlorophylls, produced in chloroplasts, are the vital photosynthetic pigment of leaves (Yang et al. 2015). Leaves appearing green, mainly account for high concentrations of chlorophyll, which is relevant to chlorophyll biosynthesis and degradation. Carotenoids are an important class of natural pigments that are ubiquitous in the yellow, orange—red, or red pigments of plants (Su et al. 2014). Anthocyanins are a natural type of water-soluble pigment widely found in plants, ranging in a red to blue color in leaves (Carlson and Holsinger 2010). Furthermore, successful leaf color alteration from purple to green by genetic transformation using several genes that are involved in anthocyanin biosynthesis has already been reported in crab apple (Malus spectabili) (Tian et al. 2015) and apple (Malus sp.) (Szankowski et al. 2009).

Recently, studies related to leaf coloration have focused on fall-color trees and leaf color mutants. For example, Field et al. (2001) reported that chlorophyll degradation was accompanied with enormous anthocyanin accumulation, leading to red-colored maple leaves during the late developmental stages. Leaf color mutants occur due to chlorophyll-deficiency, leading to green-deficient leaf color mutations such as yellow—green, light-green, or yellow leaf color in crops (Liu et al. 2018a; Zhang et al. 2018), vegetables (Liu et al. 2018b), and ornamental plants (Yu et al. 2016; Li et al. 2015). However, few studies have concentrated on spring color-leaved trees with leaf color alterations from purple to green.

Herbaceous peony (Paeonia lactiflora Pall.) is a traditional Chinese ornamental plant and has nowadays been developed as an emerging high-end cut-flower. It enjoys the high reputation of ‘two of the most beautiful flowers’ with peony (Paeonia suffruticosa Andr.) due to its graceful appearance and splendid color. To improve its ornamental characteristics and quality, studies have focused on floral coloration (Zhao et al. 2016), floral shape (Wu et al. 2018), tolerance to abiotic and biotic stress (Gong et al. 2015; Hao et al. 2016), and inflorescence stem mechanical strength (Zhao et al. 2019; Tang et al. 2019); however, leaf coloration has not been taken into consideration. Paeonia lactiflora is one of the color-leaved ornamental spring plants, which has purple leaves at the early developmental stage and green leaves at the late developmental stage. This trait has brought high value to P. lactiflora. However, the mechanism underlying this coloration variation from purple to green has not been studied in P. lactiflora. If we could clarify the shift mechanism involved, it would be possible to inhibit the color transformation and to cultivate P. lactiflora with purple phenotype, which may contribute to higher commercial value.

In this study, we compared the leaves of P. lactiflora at three different leaf developmental stages including purple, purple–green, and green coloration in terms of color indices, structure, and pigment content. Furthermore, we isolated and sequenced the genes involved in leaf coloration and validated the expression of these genes using quantitative real-time polymerase chain reaction (qRT-PCR). Our results revealed the variation of color characteristics, pigment accumulation, and biosynthesis in leaves from purple, purple–green, and green in P. lactiflora.

Materials and methods

Plant materials

Paeonia lactiflora cv. ‘Zilan Xijin’ grown in the field of the germplasm repository of Yangzhou University, Jiangsu Province, China (32° 23′ N, 119° 24′ E), was used as the experimental material. The leaves at three leaf developmental stages (purple stage (S1), purple–green stage (S2), green stage (S3); Fig. 1a, b) were collected as samples. Anatomical observation as well as color indices and SPAD values determination were performed immediately after each collection, and the samples were then frozen in liquid nitrogen and stored at −80 °C until examination.

Fig. 1.

Fig. 1

Phenotype and microscopic observation of leaves in P. lactiflora at three leaf developmental stages. a Phenotype of the P. lactiflora plant. b Phenotype of the leaf adaxial and abaxial surface. Bar = 1 cm. c Microscopic observation of leaf transverse sections. Bar = 100 μm

Anatomy observation

Microscopic observation of leaf transverse sections was performed using free-hand sections. The leaves were cross-sectioned and placed on a glass slide with a drop of water. They were immediately observed under a light microscope (Olympus CX31RTSF, Tokyo, Japan) and the specific operational method was performed as described by Zhao et al. (2015).

Color indices measurement

Leaf colors including leaf adaxial and abaxial surface colors, were first compared with the Royal Horticultural Society Color Chart (RHSCC), and were then measured using a portable colorimeter, RM200QC spectrophotometer (X-Rite, Switzerland) in the laboratory at room temperature. Intotal, fifteen different leaves were measured and each measurement was repeated three times. The results were recorded using the color parameters L*, a*, and b*·L* stands for lightness (0 = black, 100 = white), a* indicates the red (positive)/green (negative) coordinate, and b* represents the yellow (positive)/blue (negative) coordinate. Then, SPAD values of these fifteen leaves (also including leaf adaxial and abaxial surface) were detected using a SPAD chlorophyll meter (SPAD-502 PLUS, Konica Minolta, Japan) and each measurement was repeated three times.

Pigment contents measurement

The content of pigments including anthocyanin, flavonoid, chlorophyll, and carotenoid was measured. Anthocyanins were extracted in a methanol and acetic acidmixture (methanol/water/acetic acid = 85:15:0.5, v/v/v), according to the procedure described by Lewis et al. (2003). The absorbance of each supernatant was measured at 530 nm and 657 nm using a UV spectrophotometer (UV BlueStar A, Beijing Lab Tech Co., Ltd., China) to calculatethe anthocyanin concentration. The content of flavonoids was measured using a reagent kit (Suzhou Comin Biotechnology Co., Ltd., China). For chlorophylls and carotenoids, approximately 0.1 g of the same samples used for anthocyanin extraction were extracted using an ethanol and acetone mixture (ethanol/acetone = 1:4, v/v). The absorbance of the supernatant obtained by centrifugation was measured using the same spectrophotometer at 470, 645, and 663 nm. The concentrations of chlorophyll a, chlorophyll b, total chlorophylls, and carotenoids were then calculated according to Lichtenthaler (1987).

Gene isolation and sequencing

According to the cDNA sequence of 11 genes including phenylalanine ammonialyase (PAL) gene, chalcone synthase (CHS) gene, chalcone isomerase (CHI) gene, flavonoid isomerase (FLS) gene, dihydroflavonol 4-reductase (DFR) gene, anthocyanin synthase (ANS) gene involved in flavonoid biosynthesis, and glutamyl-tRNA reductase (HEMA) gene, protoporphyrinogen IX oxidase (PPO) gene, magnesium chelatase subunit I (CHLI) gene, chlorophyll a synthase (CHLG) gene, and chlorophyll b reductase (NYC) gene involved in chlorophyll biosynthesis, obtained from the transcriptome data (NCBI accessions: SRP127132), gene-specific primers were designed to isolate the cDNA sequences. The methods that used for gene isolation and sequencing were the same as described by Zhao et al. (2015) with some modifications. The gene-specific primers are shown in Supplementary Table S1, and the PCR products were sent to TsingKe Biological Technology Co., Ltd. (Beijing, China) for sequencing. Sequence comparison was performed using NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Gene expression analysis

Gene transcript levels were analyzed using qRT-PCR with a BIO-RAD CFX Connect™ Optics Module (Bio-Rad, USA). cDNA was synthesized from RNA using a PrimeScript® RT reagent Kit With gDNA Eraser (TaKaRa, Japan). PlActin was used as an internal control in P. lactiflora (Zhao et al. 2012a). All gene-specific primers in this study are shown in Table 1, and were synthesized by TsingKe Biological Technology Co., Ltd. (Beijing, China). qRT-PCR was performed as reported by Tang et al. (2019). Relative expression levels of target genes were calculated by the 2−∆∆Ct comparative threshold cycle (Ct) method (Schmittgen and Livak 2008). The Ct values of triplicate reactions were gathered using the Bio-Rad CFX Manager V1.6.541.1028 software.

Table 1.

Gene-specific primers used in qRT-PCR analysis

Gene Forward primer sequence (5′ → 3′) Reverse primer sequence (5′ → 3′)
PAL TGAGTCAAGTTGCCAAGAG GCATTAAAGGGTAAGTAGCG
CHS ATGACTGGAACTCGATACTCT CTCACTCAAAACATGCCTAG
CHI TTGTAACGGGTCCATTTG TTCGGCATCAGTGTAAGT
FLS GCTATCTCATCCGCACAA CTTCAAACTTTCCTCTACCAG
DFR GCACTTTCTCCAATCACAG CAAATGTAGCGACCCTCT
ANS AGATTAGAACAAGAAGTCGGTG GGAGGATGAAAGTGAGGG
HEMA GAAGTCGTGGCTGCTAAC GCTTTCCTAGTCTTCTTCGTTA
PPO TCCACTCTATGGGCGTAA TTGCAACCCGAAGCTATT
CHLI AACGTCTTCTACGGCAATC GAAATCCCAATCCCTCCA
CHLG GCTGGATTGTTAGATGTG AAAGGTGGAGCAGAGTAT
NYC ACAGTTGCGAGAACCCTA TCAGCCCAGTTTCGTATT
Actin GTTGCCCTTGATTACGAG CAGCTTCCATTCCGATTA

Statistical analysis

All experiments described here were repeated three times in a completely randomized design. Primers were designed using the Primer 5.0 program. All data were means of three replicates with standard deviations. The results were analyzed for variance using the SAS/STAT statistical analysis package (version 6.12, SAS Institute, Cary, NC, USA).

Results

Anatomical observation and color indices

As shown in Fig. 1a, leaf color was transformed from purple to purple–green to green during the leaf developmental stages. The color of the leaf abaxial surface was more vivid than that of the leaf adaxial surface (Fig. 1b). Anatomical observation demonstrated that red-colored pigments were all distributed in the epidermis at the purple and purple–green stage (Fig. 1c). Specifically, increased red-colored pigments were accumulated in the leaf abaxial surface than in the leaf adaxial surface. Besides, accumulation of red-colored pigments was reduced along with the leaf development, and completely disappeared at the green stage.

Furthermore, the color indices of the leaf adaxial and abaxial surfaces were checked using the RHSCC and the chromameter. With leaf development, the color of the leaf adaxial surface gradually ranged from 200B to 200A to 137C, whereas that of the leaf abaxial surface changed from 59A to 200C to 138B. The adaxial surface of leaves showed higher L* and b* values and lower a* values than the abaxial surface of leaves. In three different leaf developmental stages, the L* and b* values of the leaf surface were gradually increased, whereas the a* value of the leaf surface was decreased (Fig. 2a). These color indices showed that the colors of the leaf surfacewere purple and purple—red at the purple stage, respectively, and then gradually faded to green along with leaf development. Collectively, this result was relevant to the visual result.

Fig. 2.

Fig. 2

Color parameters and SPAD of leaves in P. lactiflora at three leaf developmental stages. a Color parameters of the leaves. b SPAD of the leaves. S1, purple stage, S2, purple–green stage, S3, green stage. The values represent the means ± SDs, and different letters indicate significant differences (P < 0.05)

Pigment contents

Leaf color variation was accompanied with pigment changes including flavonoids (containing anthocyanin), chlorophylls, and carotenoids. For anthocyanin and flavonoid contents, quantitative comparison showed that the leaves accumulated the most anthocyanins at the purple stage, the least anthocyanins at the green stage, and the middle level at the purple–green stage. The anthocyanin level in the leaves at the purple stage was 1.34 times and 2.14 times higher than that at the purple–green and green stage, respectively. Although accumulation of flavonoids demonstrated a decreasing tendency, it did not reach a significant level (Table 2).

Table 2.

Pigment contents of P. lactiflora at three different leaf development stage

Category Content (mg g−1 DW)
Purple stage (S1) Purple–green stage (S2) Green stage (S3)
Anthocyanins 0.937 ± 0.177a 0.701 ± 0.129b 0.439 ± 0.122c
Flavonoids 6.719 ± 0.482a 6.657 ± 0.849a 6.225 ± 0.546a
Chlorophyll a 3.495 ± 0.302c 4.166 ± 0.285b 4.597 ± 0.200a
Chlorophyll b 1.220 ± 0.167c 1.662 ± 0.294b 2.227 ± 0.250a
Chlorophylls 4.715 ± 0.451c 5.828 ± 0.574b 6.824 ± 0.397a
Carotenoids 1.462 ± 0.058a 1.679 ± 0.232a 1.698 ± 0.109a

The values represented mean ± SE, and different letters marked significant differences (P < 0.05)

During leaf developmental stages, the contents of chlorophyll a, chlorophyll b, and total chlorophyll sharply rose from the purple stage to green stage. Specifically, the content of chlorophyll a was increased by 19.21% and 31.55% at the purple–green and green stage, respectively, compared to that of chlorophyll a at the purple stage, whereas the contents of chlorophyll b and total chlorophyll were increased by 36.22%, 23.61%, and 82.51%, 44.74% at the purple–green and green stage, respectively, compared to that at the purple stage (Table 2). SPAD value was further calculated and the result showed that the value significantly increased from the purple stage to green stage, with no difference between the leaf adaxial and abaxial surfaces (Fig. 2b). For carotenoids, the accumulation of carotenoids demonstrated a gradually rising trend, but did not reach a significant level (Table 2).

Pigment biosynthesis-related gene isolation and sequence analyses

To investigate the transformation mechanisms of color shift in P. lactiflora leaves at the molecular level, six structural genes in the flavonoid biosynthetic pathway including PAL, CHS, CHI, FLS, DFR and ANS, along with five structural genes in the chlorophyll biosynthetic pathway including HEMA, PPO, CHLI, CHLG, and NYC were isolated (Supplemental Fig. S1—S11). The partial-length cDNA sequence of PlPAL (MN869918) was 2206 bp, and contained a partial ORF of 2121 bpencoding a 706 amino acid protein, an untranslated region (UTR) of 28 bp in 5′ end, a 3′-UTR of 57 bp. Similarly, the partial-length sequence cDNAs of PlCHS (MN869919), PlCHI (MN869920), PlFLS (MN869921), PlDFR (MN869922), PlANS (MN869923), PlHEMA (MN869924), PlPPO (MN869925), PlCHLI (MN869926), PlCHLG (MN869927), and PlNYC (MN869928) were 1253 bp, 803 bp, 1045 bp, 1186 bp, 1108 bp, 1534 bp, 1357 bp, 1420 bp, 1197 bp, and 1438 bp, respectively. They contained a partial ORF of 1182 bp, 654 bp, 999 bp, 1134 bp, 1065 bp, 1524 bp, 1357 bp, 1272 bp, 1119 bp, and 1837 bp encoding 393, 217, 332, 377, 354, 507, 453, 423, 372, and 307 amino acid proteins, respectively. The high identity and similarity of these proteins was shown with related proteins from other plants (Supplemental Table S2).

Pigment biosynthesis-related gene expression

To further characterise the transformation mechanisms of color shift of P. lactiflora leaves, the expression of these 11 structural genes was examined by qRT-PCR. They were all expressed at three different leaf developmental stages, but their expression patterns were different from each other. In the flavonoid biosynthetic pathway, PlCHS was expressed at the highest level, followed by PlPAL, PlDFR, and PlANS, whereas PlCHI and PlFLS were expressed the lowest levels. During the three leaf developmental stages, the expression patterns of PlPAL, PlFLS, PlDFR, and PlANS demonstrated a decreasing trend, whereas that of PlCHS first increased and then decreased and that of PlCHI expressed a trend opposite to PlCHS. Besides, DFR catalysed dihydroflavonols into leucoanthocyanidin, and then leucoanthocyanidin was catalysed by ANS to colored anthocyanidin. In this study, the expression level of PlDFR decreased sharply at the purple–green and green stage compared to that at purple stage which was reduced by 98.27%, 98.41%, and 97.62%, 98.20%, respectively (Fig. 3a).

Fig. 3.

Fig. 3

Expression patterns of genes associated with pigment biosynthesis in P. lactiflora leaves at three developmental stages. a Expression patterns of genes involved in flavonoids biosynthesis. b Expression patterns of genes involved in chlorophyll biosynthesis. S1, purple stage, S2, purple–green stage, S3, green stage

Among the six genes in the chlorophyll biosynthetic pathway, the expression level of HEMA was the highest, whereas that of the other genes was lower. During the three leaf developmental stages, the expression levels of PlHEMA presented a sharp-upward trend; PlPPO and PlNYC exhibited a decreasing tendency, whereas PlCHLI and PlCHLG attained the minimum level at the purple–green stage and then increased. The expression patterns of PlHEMA and PlNYC were the most obviously changed during the leaf developmental stages. Specifically, the expression levels of PlHEMA increased by 4.36 and 11.66 times, from the purple–green stage to the green stage, and that of PlNYC at the purple–green and green stage was reduced by 84.61% and 90.86% compared to the levels at the purple stage (Fig. 3b).

Discussion

Leaf color is a key trait of many ornamental plants, and has gained increasing attention for its commercial value. Plants that are always colorful or present red/yellow colors at spring or autumn bring great value to landscape viewing. Paeonia lactiflora is a traditional kind of flower in China, and in this research, we found that the new leaves of P. lactiflora presented purple color at spring, similar to M. spectabilis (Yang et al. 2018). With leaf development, the purple coloration gradually faded and finally the mature leaves presented green color. Leaf color is judged by the pigment concentration or distribution in plant leaves (Ewa 2009), and the new leaves presenting purple color are due to the red-colored pigments concentrated in leaf blade surfaces including the adaxial and abaxial surfaces compared to the mature green leaves. This was consistent with the colored pigment distribution in cabbage (Brassica oleracea) (Leahu et al. 2018), but was inconsistent with that in Anthurium andraeanum Lind. for the red-colored pigment randomly distributed in mesophyll cells resulting in pink colored leaves (Yang et al. 2015). Besides, increased red-colored pigments accumulated in the abaxial surface of leaf blade, whereas a decreased amount was deposited in the adaxial surface of the leaf blade. As a result, the new purple leaves were due to the accumulation of red-colored pigments in the leaf surfaces, and the loss of the red-colored pigment and the increase in green colored pigment contributed to the green mature leaves.

There are three types of pigments in plant leaves including chlorophylls, carotenoids, and anthocyanins (Field et al. 2001). In general, a high concentration of chlorophylls contributes to the green coloration of leaves, whereas carotenoids and anthocyanins accumulation is responsible for leaves representing brighter colors (Carlson and Holsinger 2010). Specifically, anthocyanins, the components of flavonoids, determined whether the leaves appear red, blue, and purple (Winkel-Shirley 2001). Leaf coloration depends mainly on flavonoids/anthocyanins when their ratio to chlorophylls is high enough to dissimulate the green color (Shen et al. 2018). In this research, the concentration of flavonoids was higher in purple and purple–green leaves than that in green leaves, but that of anthocyanins was very low. The anthocyanins content showed a significant reduction along with the leaf color transformation from purple to green, which is consistent with the results in M. spectabilis (Yang et al. 2018). This was similar with the study on red and green colored leaves in A. andraeanum (Yang et al. 2015), Pelargonium crispum (Kanemaki et al. 2018), and Camellia sinensis L. (Wei et al. 2016; Shen et al. 2018) that the anthocyanin content was lower in green colored leaves than that in red-colored leaves. Combined with the anatomical observation, this suggested that the concentrated distribution of higher levels of anthocyanin in the leaf surface masks the green color of chlorophylls, resulting in the presentation of purple in new leaf coloration.

Anthocyanins, originate from a branch of the flavonoid biosynthetic pathway, and are water-soluble pigments belonging to secondary metabolites (Nguyen and Cin 2009). Anthocyanin accumulation is generally controlled by structural gene expression (Jaakola 2013). In P. lactiflora, the structural genes involved in the anthocyanin biosynthetic pathway can be distributed into two groups: the upstream biosynthesis genes (PlPAL, PlCHS, PlCHI, flavanone 3-hydroxylase (PlF3H), flavonoid 3′-hydroxylase (PlF3′H) and PlFLS), and the downstream biosynthesis genes (PlDFR, PlANS, UDP-glucoside (PlUGT) and methyl transferase (PlMT)) (Zhao et al. 2012b). In C. sinensis, the expression levels of these genes including PAL, CHI, F3H, F3′H, FLS, DFR, and ANS were all higher in red leaves than in green leaves, with higher accumulation of anthocyanins (Shen et al. 2018). Also, Liu et al. (2016) found that PAL, CHS, CHI, F3′H, DFR, ANS, UFGT, and OMT were expressed at a higher level in red leaves with more anthocyanins content than in the green leaves of jew (Tradescantia fluminensis). However, the expression level of CHS was demonstrated a lower level in A. andraeanum (Yang et al. 2015) in pink leaves compared to green leaves, which showed a result opposite to that of Liu et al. (2016). In this research, a similar result was achieved, wherein PlPAL, PlCHS, PlCHI, PlFLS, PlDFR, and PlANS demonstrated the highest expressions at S1 except for CHS, which was increased from the purple to purple–green stage and was decreased from the purple–green to green stage. Combined with the dissimilar expression patterns of PlCHS, the block of anthocyanidin biosynthesis might be less likely relevant to PlCHS expression despite the highest expression level. Among the remaining genes, successful leaf color alteration by genetic transformation using PlDFR, PlFLS, and PlANS has already been reported as follows. In M. spectabilis, overexpression of McDFR, or silencing of McFLS, promoted anthocyanin accumulation and resulted in leaves presenting red color. On the contrary, it resulted in M. spectabilis leaves appearing green (Tian et al. 2015). Through silencing ANS in a red-leaved Malus sp. cultivar, anthocyanin biosynthesis was almost completely blocked and this was accompanied by a reduction in the profile of anthocyanin (Szankowski et al. 2009). Considering the lower expression of PlFLS, the enzymatic activities of PlDFR and PlANS resulted in the P. lactiflora leaves demonstrating red coloration, and a block in anthocyanin biosynthesis from purple young leaves to green mature leaves, resulted in reduced anthocyanin accumulation.

The variation of P. lactiflora leaf color from purple to green might also be owing to changes in chlorophylls. Chlorophyll is the primary photosynthetic pigment, and leaves appear green mainly due to high concentrations of chlorophyll (Shen et al. 2018). In C. sinensis, Shen et al. (2018) found that more chlorophyll a, chlorophyll b, and total chlorophyll were accumulated in the green colored leaves compared to the red-colored leaves, which was accordance with the report by Liu et al. (2016) in T. fluminensis leaves. In our study, we reached a similar result showing that during leaf development, or, with the variation of leaf coloration from purple to green, accumulation of chlorophyll was significantly increased. This result suggested that the accumulation of chlorophyll contributed to a higher concentration of chlorophyll, leading to the leaves appearing green during leaf development.

In plants, chlorophyll content is affected by the development and division of chloroplasts, and their biosynthesis and degradation (Zhang et al. 2018). The chlorophyll biosynthesis pathway is complex and involves more than 20 genes encoding 16 enzymes (Beale 2005). Leaves appearing green might change due to the expression changes of chlorophyll biosynthetic-related genes. The HEMA gene catalyses the initial step of chlorophyll biosynthesis, which plays a vital role in chlorophyll production (Kumar and Söll 2000). Changes in the expression level of HEMA might promote the biosynthesis of chlorophylls and add to the accumulation of chlorophylls in green leaves compared to that in the purple leaves in the C. sinensiscv. ‘Zijuan’ (Shen et al. 2018). In this study, a similar result was obtained and the expression level of PlHEMA was the highest among chlorophyll biosynthesis-related genes, suggesting that the increased expression of PlHEMA promoted the synthesis of chlorophyll and increased the content of chlorophyll in leaves. PPO controlled the oxidation of protoporphyrinogen IX and affected the feedback control of chlorophyll biosynthesis (Koach et al. 2004). The chelation of Mg2+ into protoporphyrin IX was catalysed by CHLD, CHLH, and CHLI, which encode Mg-chelatase subunits. CHLG controls the final step of chlorophyll biosynthesis. All these genes play an important role in the biosynthesis of chlorophylls, and their deficiency results in yellow—green-leaf mutations (Wu et al. 2007; Deng et al. 2014; Zhang et al. 2015). However, CHLH was expressed lower in green leaves compared to that in red leaves (Shen et al. 2018). A similar result was also shown in CHLG expression patterns, that a higher level was observed in light-green leaves than in green leaves (Zhu et al. 2015). The opposite result was also reached in this study showing that the expression level of PlPPO, PlCHLI, and PlCHLG demonstrated a decreasing trend from the purple-leaf stage to green-leaf stage, but that their expression was lower than PlHEMA. Considering the increased chlorophyll content and that the leaf appeared green, it is reasonable to conclude that the initial stage of chlorophyll biosynthesis was significantly enhanced and was then partially hampered, still accompanied with chlorophyll accumulation. Moreover, the expression level of PlNYC was notably reduced during leaf development in this research. NYC is involved in chlorophyll degradation, catalysing the degradation of chlorophyll b (Lai et al. 2015). An increase in the concentration of chlorophyll b was observed in NYC overexpressing plants (Sato et al. 2009; Jia et al. 2015) and a higher expression level was observed in gold-green leaves compared to that in green leaves (Li et al. 2018). Thus, an increase in chlorophyll accumulation might also be related to the chlorophyll degradation block, resulting in the leaves appearing green.

Apart from anthocyanins and chlorophylls, carotenoids are plant pigments that are responsible for the range from red to yellow color in flowers and fruits (Su et al. 2014). The changes in carotenoid content between red and green leaves were not consistent. For example, a higher level of carotenoid content was reported in leaves with green coloration compared to that in leaves with purple—red coloration in A. andraeanum and T. fluminensis, whereasan opposite change was observed in C. sinensis (Shen et al. 2018). In this study, the result was similar to that in A. andraeanum and T. fluminensis (Yang et al. 2015; Liu et al. 2016), but did not reach a significant level. As a whole, the result in this study suggests that a high level of anthocyanin content resulted in purple—red-colored new leaves, and that lack of anthocyanin accumulation along with increased chlorophyll accumulation contributed to the variation in leaf color at the physiological level.

In conclusion, we investigated the coloration variation of P. lactiflora leaves from purple color to green color with the development of leaves in this study. Higher anthocyanin contents were observed to be concentrated in the surface of the purple leaves at S1. With the development of leaves, the contents of anthocyanin decreased and the leaves appeared green. Furthermore, qRT-PCR experiments showed that the highest expression of anthocyanin biosynthesis-related genes at the purple stage contributed to high anthocyanin concentration, masking the green coloration of chlorophylls resulting in leaves representing purple coloration at S1. Reduced expression of these genes during leaf development resulted in anthocyanin reduction in the leaves. Increased chlorophyll biosynthesis and weakened chlorophyll degradation contributed to higher chlorophyll contents, resulting in green coloration of leaves. Our findings thus provide insights into the molecular mechanism underlying the coloration variation in plants.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Acknowledgements

This work was supported by the Natural Science Foundation of China (31400592), the National Key Research and Development Program (2018YFD1000405), the Graduate Innovation Program of Jiangsu Province (XKYCX19_119), the Program of Key Members of Yangzhou University Outstanding Young Teacher and the Priority Academic Program Development from Jiangsu Government.

Authors’ contributions

JT and DZ planned and designed the experiments. YT, ZF and ML performed the experiments. YT analyzed the data and wrote the manuscript. All authors carefully read and approved the final manuscript.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflicts of interest.

References

  1. Beale SI. Green genes gleaned. Trends Plant Sci. 2005;10(7):309–312. doi: 10.1016/j.tplants.2005.05.005. [DOI] [PubMed] [Google Scholar]
  2. Carlson JE, Holsinger KE. Natural selection on inflorescence color polymorphisms in wild Protea populations: the role of pollinators, seed predators, and intertrait correlations. Am J Bot. 2010;97:934–944. doi: 10.3732/ajb.0900348. [DOI] [PubMed] [Google Scholar]
  3. Deng XJ, Zhang HQ, Wang Y, He F, Liu JL, Xiao X, Shu ZF, Li W, Wang GH, Wang GL. Mapped clone and functional analysis of leaf-color gene Ygl7 in a rice hybrid (Oryza sativa L. ssp. indica) PLoS ONE. 2014;9:e99564. doi: 10.1371/journal.pone.0099564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ewa M. Survey of plant pigments molecular and environmental determinants of plant colors. Acta Biol Crac Ser Bot. 2009;51(1):7–16. doi: 10.1186/1471-2229-9-1. [DOI] [Google Scholar]
  5. Field TS, Lee DW, Holbrook NM. Why leaves turn red in autumn. The role of anthocyanins in senescing leaves of red-osier dogwood. Plant Physiol. 2001;127:566–574. doi: 10.1104/pp.127.2.566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Gong SJ, Hao ZJ, Meng JS, Liu D, Wei MR, Tao J. Digital gene expression analysis to screen disease resistance-relevant genes from leaves of herbaceous peony (Paeonia lactiflora Pall.) infected by Botrytis cinerea. Plos One. 2015;10(7):e0133305. doi: 10.1371/journal.pone.0133305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hao ZJ, Wei MR, Gong SJ, Zhao DQ, Tao J. Transcriptome and digital gene expression analysis of herbaceous peony (Paeonia lactiflora Pall.) to screen thermo-tolerant related differently expressed genes. Genes Genom. 2016;38(12):1201–1215. doi: 10.1007/s13258-016-0465-8. [DOI] [Google Scholar]
  8. Jaakola L. New insights into the regulation of anthocyanin biosynthesis in fruits. Trends Plant Sci. 2013;18(9):477–483. doi: 10.1016/j.tplants.2013.06.003. [DOI] [PubMed] [Google Scholar]
  9. Jia T, Ito H, Tanaka A. The Chlorophyll b, reductase NOL participates in regulating the antenna size of photosystem II in Arabidopsis thaliana. Proc Chem. 2015;14:422–427. doi: 10.1016/j.proche.2015.03.057. [DOI] [Google Scholar]
  10. Kanemakia A, Otania M, Takanoa M, Fujimotoa T, Okuharab H, Nomizub T, Kondob M, Kobayashib H, Tatsuzawac F, Nakano M. Ectopic expression of the R2R3-MYB gene from Tricyrtis sp. results in leaf color alteration in transgenic Pelargonium crispum. Sci Hortic. 2018;240:411–416. doi: 10.1016/j.scienta.2018.06.029. [DOI] [Google Scholar]
  11. Koch M, Breithaupt C, Kiefersauer R, Freigang J, Huber R, Messerschmidt A. Crystal structure of protoporphyrinogen IX oxidase: a key enzyme in haem and chlorophyll biosynthesis. EMBO J. 2004;23(8):1720–1728. doi: 10.1038/sj.emboj.7600189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kumar AM, Söll D. Antisense HEMA1 RNA expression inhibits heme and chlorophyll biosynthesis in Arabidopsis. Plant Physiol. 2000;122:49–56. doi: 10.1104/pp.122.1.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lai B, Hu B, Qin YH, Zhao JT, Wang HC, Hu GB. Transcriptomic analysis of Litchi chinensis pericarp during maturation with a focus on chlorophyll degradation and flavonoid biosynthesis. BMC Genom. 2015;16:225. doi: 10.1186/s12864-015-1433-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Leahu A, Ghinea C, Oroian MA, Damian C. Determination of essential and toxic elements, ascorbic acid content and color of different leaves in two cabbage varieties. Ovidius Uni Ann Chem. 2018;29(2):110–116. doi: 10.2478/auoc-2018-0016. [DOI] [Google Scholar]
  15. Lewis DH, Arathoon HS, Swinny EE, Huang SC, Funnell KA. Anthocyanin and carotenoid pigments in spathe tissue from selected Zantedeschia hybrids. Acta Hortic. 2003;624:147–154. doi: 10.17660/actahortic.2003.624.19. [DOI] [Google Scholar]
  16. Li Y, Zhang ZY, Wang P, Wang SA, Ma LL, Li LF, Yang RT, Ma YZ, Wang Q. Comprehensive transcriptome analysis discovers novel candidate genes related to leaf color in a Lagerstroemia indica yellow leaf mutant. Genes Genom. 2015;37:851–863. doi: 10.1007/s13258-015-0317-y. [DOI] [Google Scholar]
  17. Li WX, Yang SB, Lu ZG, He ZC, Ye YL, Zhao BB, Wang L. Jin B (2018) Cytological, physiological, and transcriptomic analyses of golden leaf coloration in Ginkgo biloba L. Hortic Res. 2018;5:12. doi: 10.1038/s41438-018-0015-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lichtenthaler HK. Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol. 1987;148:350–382. doi: 10.1016/0076-6879(87)48036-1. [DOI] [Google Scholar]
  19. Liu RY, Dong XC, Gu WT, Yu LX, Jin WJ, Qu Y, Zhang F, Li WJ. Variation in the phenotypic features and transcripts of thermo-sensitive leaf-color mutant induced by carbon ion beam in green wandering jew (Tradescantia fluminensis) Sci Hortic. 2016;213:303–313. doi: 10.1016/j.scienta.2016.11.001. [DOI] [Google Scholar]
  20. Liu C, Shi NR, Wu HY, An XY, Zheng JJ, Duan Sun DJ, Feng Y, Zhang LL. Cytogenetic analyses of PSL1 mutant, a novel low-temperature-sensitive purple-striped leaf color mutant in wheat. Crop Sci. 2018;58:1919–1931. doi: 10.2135/cropsci2018.01.0057. [DOI] [Google Scholar]
  21. Liu MY, Lu Y, Wang S, Wu F, Li JR, Wang YH, Zhao JJ, Shen SX. Characterization of the leaf color mutant hy and identification of the mutated gene in Chinese cabbage. J Am Soc Hortic Sci. 2018;143(5):363–369. doi: 10.21273/JASHS04403-18. [DOI] [Google Scholar]
  22. Nguyen P, Cin VD. The role of light on foliage colour development in coleus (Solenostemon scutellarioides (L.) Codd) Plant Physiol Biochem. 2009;47(10):934–945. doi: 10.1016/j.plaphy.2009.06.006. [DOI] [PubMed] [Google Scholar]
  23. Sato Y, Morita R, Katsuma S, Nishimura M, Tanaka A, Kusaba M. Two short-chain dehydrogenase/reductases, Non-Yellow coloring 1 and Nyc1-Like, are required for chlorophyll band light-harvesting complex II degradation during senescence in rice. Plant J. 2009;57(1):120–131. doi: 10.1111/j.1365-313x.2008.03670.x. [DOI] [PubMed] [Google Scholar]
  24. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc. 2008;3(6):1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
  25. Shen JZ, Zou ZW, Zhang XZ, Zhou L, Wang YH, Fang WP, Zhu XJ. Metabolic analyses reveal different mechanisms of leaf color change in two purple-leaf tea plant (Camellia sinensis L.) cultivars. Hortic Res. 2018;5:7. doi: 10.1038/s41438-017-0010-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Su TB, Yu SC, Zhang JWF, Yu YJ, Zhang DS, Zhao XY, Wang WH. Loss of function of the carotenoid isomerase gene BrCRTISO confers orange color to the inner leaves of Chinese cabbage (Brassica rapa L ssp pekinensis) Plant Mol Biol Rep. 2014;33(3):648–659. doi: 10.1007/s11105-014-0779-0. [DOI] [Google Scholar]
  27. Szankowski I, Flachowsky H, Li HH, Halbwirth H, Treutter D, Regos I, Hanke MV, Stich K, Fischer TC. Shift in polyphenol profile and sublethal phenotype caused by silencing of anthocyanidin synthase in apple (Malus sp.) Planta. 2009;229(3):681–692. doi: 10.1007/s00425-008-0864-4. [DOI] [PubMed] [Google Scholar]
  28. Tang YH, Zhao DQ, Meng JS, Tao J. EGTA reduces the inflorescence stem mechanical strength of herbaceous peony by modifying secondary wall biosynthesis. Hortic Res. 2019;6:36. doi: 10.1038/s41438-019-0117-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tian J, Han ZY, Zhang J, Hu YJ, Song TT, Yao YC. The balance of expression of dihydroflavonol 4-reductase and flavonol synthase regulates flavonoid biosynthesis and red foliage coloration in crabapples. Sci Rep. 2015;5:12228. doi: 10.1038/srep12228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wei K, Zhang YZ, Wu LY, Li HL, Ruan L, Bai PX, Zhang CC, Zhang F, Xu LY, Wang LY, Cheng H. Gene expression analysis of bud and leaf color in tea. Plant Physiol Biochem. 2016;107:310–318. doi: 10.1016/j.plaphy.2016.06.022. [DOI] [PubMed] [Google Scholar]
  31. Winkel-Shirley B. Flavonoid Biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001;126(2):485–493. doi: 10.1104/pp.126.2.485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wu ZM, Zhang X, He B, Diao LP, Sheng SL, Wang JL, Guo XP, Su N, Wang LF, Jiang L, Wang CM, Zhai HQ, Wan JM. A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol. 2007;145:29–40. doi: 10.1104/pp.107.100321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wu YQ, Tang YH, Jiang Y, Zhao DQ, Shang JL, Tao J. Combination of transcriptome sequencing and iTRAQ proteome reveal the molecular mechanisms determining petal shape in herbaceous peony (Paeonia lactiflora Pall.) Biosci Rep. 2018 doi: 10.1042/BSR20181485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yang YX, Chen XX, Xu B, Li YX, Ma YH, Wang GD. Phenotype and transcriptome analysis reveals chloroplast development and pigment biosynthesis together influenced the leaf color formation in mutants of Anthurium andraeanum ‘Sonate’. Front Plant Sci. 2015;6:139. doi: 10.3389/fpls.2015.00139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yang T, Li KT, Hao SX, Zhang J, Song TT, Tian J, Yao YC. The use of RNA sequencing and correlation network analysis to study potential regulators of leaf color transformation. Plant Cell Physiol. 2018;59(5):1027–1042. doi: 10.1093/pcp/pcy044. [DOI] [PubMed] [Google Scholar]
  36. Yu JJ, Zhang JZ, Zhao Q, Liu YL, Chen SX, Guo HL, Shi Dai SJ. Proteomic analysis reveals the leaf color regulation mechanism in chimera Hosta ‘Gold Standard’ leaves. Int J Mol Sci. 2016;17:346. doi: 10.3390/ijms17030346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang H, Liu LL, Cai MH, Zhu SS, Zhao JY, Zheng TH, Xu XY, Zeng ZQ, Niu J, Jiang L, Chen SH, Wan JM. A point mutation of magnesium chelatase OsCHLI gene dampens the interaction between CHLI and CHLD subunits in rice. Plant Mol Biol Rep. 2015;33(6):1975–1987. doi: 10.1007/s11105-015-0889-3. [DOI] [Google Scholar]
  38. Zhang T, Feng P, Li YF, Yu P, Yu GL, Sang XC, Ling YH, Zeng XQ, Li YD, Huang JY, Zhang TQ, Zhao FM, Wang N, Zhang CW, Yang ZL, Wu RH, He GH. Virescent-albino leaf 1 regulates leaf colour development and cell division in rice. J Exp Bot. 2018 doi: 10.1093/jxb/ery250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhao DQ, Tao J, Han CX, Ge JT. Actin as an alternative internal control gene for gene expression analysis in herbaceous peony (Paeonia lactifora Pall.) Afr J Agric Res. 2012;7:2153–2159. doi: 10.5897/AJAR11.1613. [DOI] [Google Scholar]
  40. Zhao DQ, Tao J, Han CX, Ge JT. Flower color diversity revealed by differential expression of flavonoid biosynthetic genes and favonoid accumulation in herbaceous peony (Paeonia lactifora Pall.) Mol Biol Rep. 2012;39:11263–11275. doi: 10.1007/s11033-012-2036-7. [DOI] [PubMed] [Google Scholar]
  41. Zhao DQ, Tang WH, Hao ZJ, Tao Identification of flavonoids and expression of flavonoid biosynthetic genes in two coloured tree peony flowers. Biochem Biophys Res Commun. 2015;459(3):450–456. doi: 10.1016/j.bbrc.2015.02.126. [DOI] [PubMed] [Google Scholar]
  42. Zhao DQ, Wei MR, Liu D, Tao J. Anatomical and biochemical analysis reveal the role of anthocyanins in flower coloration of herbaceous peony. Plant Physiol Biochem. 2016;102:97–106. doi: 10.1016/j.plaphy.2016.02.023. [DOI] [PubMed] [Google Scholar]
  43. Zhao DQ, Tang YH, Xia X, Sun J, Meng JS, Shang JL, Tao J. Integration of transcriptome, proteome, and metabolome provides insights into how calcium enhances the mechanical strength of herbaceous peony inflorescence stems. Cells. 2019;8(2):102. doi: 10.3390/cells8020102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhu GF, Yang FX, Shi SS, Li DM, Wang Z, Liu HL, Huang D, Wang CY. Transcriptome characterization of Cymbidium sinense ‘Dharma’ using 454 pyrosequencing and its application in the identification of genes associated with leaf color variation. PLoS ONE. 2015;10(6):e0128592. doi: 10.1371/journal.pone.0128592. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES