Skip to main content
PMC home page
Food Safety logoLink to Food Safety
. 2018 Jun 29;6(2):74–82. doi: 10.14252/foodsafetyfscj.2018005

Fumonisin-production by Aspergillus section Nigri isolates from Japanese Foods and Environments

Jun-ichi Onami 1, Maiko Watanabe 2,✉, Tomoya Yoshinari 2, Ruiko Hashimoto 3, Mayumi Kitayama 4, Naoki Kobayashi 5, Yoshiko Sugita-Konishi 5, Yoichi Kamata 6, 7, Haruo Takahashi 2, Hiroshi Kawakami 4, Jun Terajima 2, 6
PMCID: PMC6989198  PMID: 32231950

Abstract

Fumonisins are well known as mycotoxins produced by various Fusarium species. Recently Aspergillus niger has been reported to be a fumonisin B2 (FB2) producer. Aspergillus niger is a member of Aspergillus section Nigri. Members of this section are common food contaminants and are also distributed widely in the environment. This study aimed to determine 1) optimum culture conditions of A. niger for fumonisin production including growth medium, temperature and incubation period and 2) fumonisin production among isolates of Aspergillus section Nigri and closely related species isolated from Japanese food and environmental samples. Growth on Czapek yeast extract broth +5% NaCl (CYBS) at 28°C for 7 days resulted in the highest levels of FB2 production as determined by quantitative LC-MS/MS of culture extracts. Sixty-two isolates were collected from various foods in domestic markets as well as from soil and air. The isolates principally separated into two groups; A. niger and A. luchuensis/A. piperis/A. tubingensis, following molecular phylogenetic analysis. ELISA using the tip culture method was shown to be suitable for screening of the fumonisin-producing strains. Phylogenic analysis of Aspergillus section Nigri isolates from food and environmental samples indicated that fumonisin producing strains could be grouped into the A. niger clade. Nineteen of 35 (54%) isolates classified as A. niger were FB2 producers. The current study suggests that FB2-producing A. niger are distributed throughout several regions of Japan.

Key words: : Aspergillus niger, fumonisin B2, tip culture method, mycotoxin

1. Introduction

Mycotoxins, produced by certain fungal contaminants in food and feed commodities, are known to cause food poisoning in humans and domesticated animals1–5). One such group of mycotoxins, fumonisins, are produced by Fusarium species. Fumonisin B1 (FB1) and B2 (FB2) were first extracted from cultures of Fusarium verticillioides in 19881). Fumonisins are now thought to cause leukoencephalomalacia in horses and pulmonary edema in pigs in the United States, South Africa and other areas in the world2). Adverse health implications of exposure to fumonisins have also been suggested in humans. In 1991, long-term animal experiments in rats revealed the onset of liver cancer2) and experiments on mice in 2014 revealed that FB1 inhibited folic acid transport, which is involved in neural tube closure3). An association has been established between fumonisin contamination in maize cultivated for consumption and increased risk of cancer in humans based on data collected from two geographical regions. These regions include the Transkei region in South Africa, that reported a high prevalence of esophageal cancer4), while Haimen county in Jiangsu province, China, saw a high prevalence of esophageal and liver cancer5).

Recently, a genome-wide study of A.niger revealed the presence of a gene cluster similar to that identified in Fusarium verticillioides responsible for fumonisin production6) and synthesis of FB2 has been confirmed in an isolate of A. niger in vivo7). Aspergillus niger has been frequently detected in the environment worldwide as well as in several food products. Owing to its potential for fermentation, the fungus has been used for industrial production of citric acid and oxalic acid. Fumonisins B2, B4, and B6, but not fumonisin B1 (the more potent toxin), have been reported to be produced during growth on agar-based media of 180 strains of A. niger. These included both industrial and laboratory strains, particularly during growth on agar media having low water activity8). There have been no reports of fumonisin production other than by A. niger and A. awamori9) (A. awamori is no longer used as the kuro-koji mold for shochu-brewing) in Aspergillus section Nigri, a closely related group of fungi that resembles the characteristics of A. niger both morphologically10) and genetically.

Outside of Japan, contamination of food products with FB2, which is surmised to result from contamination with A. niger, has been reported in grape juice11), wine12), and dried grapes13). Moreover, A. niger strains isolated from dried grapes14) were reported to produce FB2 up to maximum 7.841 ppm. Thus, the occurrence of FB2 contamination in food products by Aspergillus section Nigri strains, in particular A. niger, is becoming more apparent. However, in Japan, there have been no reports of detection of FB2 in food products due to contamination with Aspergillus section Nigri isolates such as A. niger. Additionally, FB2 production by food product-derived strains of these fungi is limited to a single report of an isolate from imported, dried figs15). Thus, the prevalence of FB2 contamination of domestically distributed food products in Japan by Aspergillus section Nigri isolates is unclear, and it is hence essential to perform a detailed survey of fumonisin-producing strains of this Aspergillus section.

In the present study, we investigated the optimal growth and screening conditions for fumonisin-producing strains of Aspergillus section Nigri, and we collected isolates of this section from Japanese commercial food products and environments and determined their potential for fumonisin production.

2. Materials and Methods

2-1. Isolation of Fungal Strains from Foods and Environments

Aspergillus section Nigri strains were isolated from 15 foods and 11 environmental samples. Details of the food samples were as follows: polished rice, onion, wheat, soybeans, passion fruit, pickled perilla, bread, pepper imported from southeast Asian and corn grits imported from the United States. All food samples were purchased from Japanese markets. Details of the environmental samples were as follows: soil, wood, horse stall straw, and air collected in several areas of Japan (summarized in Table 1). Samples were placed on Dichloran Glycerol (DG-18; Kanto Chemical Co. Ltd., Tokyo, Japan) agar plates supplemented with chloramphenicol (Wako, Osaka, Japan) at 100 mg/ml. For collection of air-borne samples, an air sampler (air ideal 3P; Sysmex Biomelius, Tokyo, Japan) was used. Agar plates were incubated at 25°C for 7-10 days in the dark. Following incubation, fungal colonies were visually observed and those of Aspergillus section Nigri were collected as black aspergilli and then plated on potato dextrose agar (PDA; Eiken Chemical Co., Tokyo, Japan).

Table 1. Number of isolated strains, detected fumonisin B2*1, and range/average yields of fumonisin B2.

Origin Clade* Number of
isolated strain		 Number of fumonisin positive from ELISA method Number of fumonisin positive samples
(LC/MS/MS)		 Range*4 of fumonisin B2 concentrations
LC-MS/MS (ppb)		 Average*4 of fumonisin B2 concentrations
LC-MS/MS (ppb)
Food Import Pepper A. niger *2 17 10 7 100 - 3500 1100
A. luchuensis/A. piperis/A. tubingensis *3 4 0 0 ― ―
Corn grits A. niger 3 3 2 1550 - 2350 1950
A. luchuensis/A. piperis/A. tubingensis 1 0 0 ― ―
Domestic Rice A. niger 8 8 1 1500 1500
A. luchuensis/A. piperis/A. tubingensis 7 0 0 ― ―
Wheet A. luchuensis/A. piperis/A. tubingensis 1 0 0 ― ―
Soy beans A. niger 1 1 0 ND*5 ND
A. luchuensis/A. piperis/A. tubingensis 1 0 0 ― ―
Onion A. niger 4 3 0 ND ND
Bread A. niger 1 0 0 ― ―
Passion
fruit		 A. niger 1 1 0 ND ND
Pickle of red perilla A. luchuensis/A. piperis/A. tubingensis 1 0 0 ― ―
Subtotal 50 26 (52%) 10 (20%)
Environment Soil A. niger 1 0 0 ― ―
Wood A. niger 2 1 1 280 280
Straw A. luchuensis/A. piperis/A. tubingensis 1 0 0 ― ―
Air A. niger 5 3 2 100 - 310 205
A. luchuensis/A. piperis/A. tubingensis 3 0 0 ― ―
Subtotal 12 4 (33%) 3 (25%)
Total 62 30 (48%) 13 (21%)
Open in a new tab

*1Fumonisin B1 and B3 were not detected.

*2 Aspergillus niger

*3Aspergillus luchuensis, Aspergillus piperis, or Aspergillus tubingensis

*4Only fumonisin-producing strains were involved.

*5<2.5 ppb

2-2. Identification of Aspergillus section Nigri Strains

Isolates of Aspergillus section Nigri were identified using morphological and molecular techniques. For morphological identification, isolates were transferred to Czapek agar medium (Cz: Czapek Dox Broth, Becton Dickinson and Company, France), 12 g agar (Shoei Co., Tokyo, Japan) per liter, malt extract agar medium (MEA: Kanto Chemical Co., Ltd.), and Czapek-yeast extract agar medium (CYA: per liter: Czapek Dox Broth, 12 g; Bacto Yeast Extract (Difco Becton Dickinson and Company), 2 g). Plates were incubated at 25°C for 7 days and then the isolates were morphologically identified based on colony textures and microscopic observation according to Susca et al.11). For molecular identification, isolates were inoculated into 1 ml potato dextrose broth (PDB; Difco Becton Dickinson and Company) in 2.0 ml microtubes and incubated overnight at 25°C. After incubation, the fungal mycelia were collected by centrifugation at 15,000 rpm for 10 min at 4°C and the genomic DNA were extracted using the DNeasy Plant Mini Kit (QIAGEN, The Netherlands) according to the manufacturer’s instructions. The β-tubulin gene (β-tub) was amplified from the extracted genome for purposes of β-tub phylogenetic analysis16). PCR reactions were performed using TaKaRa Ex Taq (Takara Bio Co., Ltd., Otsu, Japan) with Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC)16) as primers. The thermocycler parameters consisted of a denaturing step at 94°C and 3 min, followed by amplification for 35 cycles (94°C for 30 sec, 52°C for 40 sec, and 72°C for 1.5 min). The final elongation reaction was performed at 72°C for 5 min. PCR products were purified using ExoSAP IT (GE Healthcare Japan, Tokyo, Japan) according to the manufacturer’s instructions. DNA sequencing reactions were performed using BigDye Terminator v3,1 Cycle Sequencing Kit (Thermo Fisher Scientific, USA) with Bt2a or Bt2b as primers. The PCR products were purified according to a protocol published by Thermo Fisher Scientific and sequenced using a 3730 XL genetic analyzer (Thermo Fisher Scientific, USA). The sequences were edited using ATGC ver. 6.0 (Genetycs, Tokyo, Japan). All β-tubulin sequences were phylogenetically analyzed with the β-tubulin sequences of Aspergillus reference strains downloaded from GenBank. The references are described in Table 2. In this study, two strains, RIB 2603 and NBRC 8877, which are provided as Aspergillus awamori, were described as Aspergillus awamori re-identified “Aspergillus niger”, because both strains were re-identified as Aspergillus niger17). Sequences were aligned and analyzed using MEGA618). Phylogenetic analysis was performed by the neighbor joining method with the maximum composite likelihood model. The stability of clades was assessed with 500 bootstrap replications.

Table 2. Reference sequences of beta tubulin from database.

GenBank
accession no.		 Taxon name Strain number
AB574097.1 Aspergillus awamori (re-identified “Aspergillus niger”) RIB 2603
AB574111.1 Aspergillus awamori (re-identified “Aspergillus niger”) NBRC 8877
GU296687.1 Aspergillus niger CBS 554.65
AB574102.1 Aspergillus niger RIB 2611
AY820006.1 Aspergillus brasiliensis CBS 101740
FJ629280.1 Aspergillus foetidus CBS 564.65T
FJ629303.1 Aspergillus piperis CBS 112811T
GU296699.1 Aspergillus costaricaensis CBS 115574T
FJ629305.1 Aspergillus tubingensis CBS 134.48
FJ629276.1 Aspergillus carbonarius CBS 111.26T
AY819992.1 Aspergillus flavus CBS 100927T
EF203128.1 Aspergillus caelatus CBS 117616
Open in a new tab

2-3. Fumonisin Production by Aspergillus Section Nigri Strains

In this study a simple and rapid “Tip Culture” method was adopted for fungal growth and preparation of culture solutions for toxin analysis19). The optimum substrate, temperature and time of incubation that provided the greatest amounts of fumonisins during growth of fungal strains was ascertained. Specifically, five types of liquid medium were prepared that had been found to be highly productive for fumonisin production in A. niger7); CYB (CYA broth), CY20S broth (CYB + 20% sucrose), YES broth (Bacto Yeast Extract+sucrose+MgSO4 · 7H2O), PDB, and CYBS broth (CYB + 5% NaCl). Aspergillus niger MAFF425037, which was previously shown to produce FB2, was incubated at 25°C statically for 7 days. After incubation, the spores were collected in PBS containing 0.1% tween 80 for use as an inoculum. Three µl of fungal spores (about 103 spores/µl) were used to inoculate each 300 μl of broth present in the tip culture set up used. Cultures were incubated at 25°C for 30 days in the dark. Following incubation, 20-fold dilution of each broth was prepared for analysis of tip FB1, FB2 and FB3 by LC-MS/MS. Analyses were performed using a LC-20A HPLC (Shimadzu Corporation, Kyoto Prefecture) and 3200 Q TRAP mass spectrometer (AB Sciex, Redwood City, CA). Samples were loaded onto an Inertsil ODS-4 column (3.0×50 mm, 2 m; GL Sciences) at 40°C. The mobile phase was a binary gradient of solvent A (0.1% formic acid in water) and solvent B (acetonitrile) programmed as follows: at 0 min, 25% B; at 5 min 50% B; at 8 min, 50% B. The flow rate was set at 0.2 mL/min. Ion monitoring were as indicated below; precursor m/z >product m/z, fumonisin B1 722 [M+H]+>352, fumonisin B2 706 [M+H]+>336, and fumonisin B3 706 [M+H]+>336. The concentration of 0.3 ppb, which is equivalent to an SN ratio of 3 at the time of measurement of fumonisins reference standard, was set as the lower limit of detection, and the concentration of 1 ppb, which is equivalent to an SN ratio of 10, was set as the lower limit of quantification. Cultures were incubated at 25°C, 28°C, and 32°C for 3, 5, and 7 days on the various media using the tip culture technique. Diluted samples were analyzed for FB1, FB2 and FB3 by LC-MS/MS. These experiments were repeated twice to calculate the mean of the results obtained.

2-4. Screening of Fumonisin-Producing Strains

Tip culture broths were screened for production of total fumonisin using an Enzyme-Linked Immuno Sorbent Assay (ELISA)-based Veratox Fumonisin Quantitative Test Kit (NEOGEN, U.S.A.). Microplate Manager 6 (Bio-Rad Laboratories, Tokyo, Japan) was used to measure the absorbance at a 630 nm wavelength. Samples giving a value of 2.5 ppb or higher total fumonisins were judged as positive for fumonisin production by this screening method.

2-5. Quantitation of Fumonisin Production

Strains that tested positive for fumonisin production by ELISA were quantitatively analyzed for fumonisin levels by LC-MS/MS. A 10- to 500-fold dilution of the samples was used for LC-MS/MS. Although the measurement conditions were the same as those described above, a threshold value for a sample considered positive for fumonisin production by LC-MS/MS was also set at 2.5 ppb or higher as this value is the same as the lower limit of detection in the ELISA method.

3. Results

3-1. Optimal Culture Conditions for Fumonisin B2 Production in Aspergillus section Nigri

Fumonisin B2 production by Aspergillus section Nigri strains was compared using 5 types of liquid culture media at 25°C for 7 days. The amounts detected by LC-MS/MS were low in the CYB, CY20S, YES, and PDB at 54 ppb, 3 ppb, 8 ppb, and below the limit of detection, respectively; however, in CYBS, 600 ppb FB2 was detected. Thus, CYBS was found to be optimal among the 5 liquid culture media tested. Furthermore, the temperature and duration of culture for fumonisin production were investigated using CYBS culture medium. Culture temperatures of 25°C, 28°C, and 32°C were used with incubation periods of 3, 5 and 7 days. The maximum production of FB2 was detected by LC-MS/MS when cultures were grown at 28°C for 7 days, with an average of 84.5 ppb FB2.

The tip culture method19) was used previously to investigate aflatoxin production in Aspergillus Section Flavi; however, when used with a liquid CYBS culture medium, it was found to be suitable for detection of FB2 production in Aspergillus section Nigri, and as a rapid detection method for fumonisin-producing strains.

3-2. Efficacy of Screening Methods via ELISA

Screening for fumonisin production was performed for 62 Aspergillus section Nigri strains, of which 30 were found to produce FB2 by ELISA. Quantitative LC-MS/MS of ELISA positive cultures, found that FB2 was detected in the range of 100 to 3500 ppb in culture broths of 14 of these strains, while the remaining were false-positives. Fumonisin B1 and FB3 were not detected in any of the strains. In addition, LC-MS/MS was performed on broths for detection of FB2 from 22 strains that tested negative for FB2 production by ELISA. There were no samples that exhibited amounts above the detection level of 2.5 ppb, indicating that the ELISA method does not produce false-negatives. The false-positive results may have been the result of cross-reactivity with intermediate metabolites with a similar structure to FB2 in the antigen-antibody reaction, enzyme reaction, or color-inducing steps in ELISA. However, since no false-negatives occurred with this method, it seems effective as a means of initially screening cultures for the ability to produce fumonisins.

3-3. Phylogenetic Relationships of Fumonisin-Producing Strains

Sixty-two strains were isolated from the environment or from food products and the nucleotide sequences of β-tub of these strains were determined in this study (GenBank accession Nos. LC387849-LC387876, LC389050-LC389061). Each stain was classified based on both morphological observations and molecular phylogenetic analysis. A phylogenetic tree based on nucleotide sequences of β-tub (331bp), inferred using the neighbor joining method, is shown in Fig. 1. The bootstrap values were highly maintained, at 100% for the A. niger clade, and 96% for the clade containing A. luchuensis, A. piperis, A. costaricaensis and A. tubingensis (herein referred to as the A. luchuensis /A. piperis/A. tubingensis clade). The β-tub locus did provide good support (86% bootstrap) for delineating the A. tubingensis clade, but further inference of relationships among the species within the A. luchuensis /A. piperis/A. tubingensis clade was not well supported. This result was consistent with the previously reported phylogenetic analysis of Hong et al.17) based on nucleotide sequences of the rDNA-ITS region, β-tub, and calmodulin gene.

Fig. 1.

Fig. 1

Open in a new tab

Phylogenetic tree of strains of the genus Aspergillus derived from environment/food in Japan based on β-tubulin nucleotide sequence. The text of each node shows the species, the origin of each strain noted in parentheses, and the strain number, respectively. Sequences were aligned and analyzed using MEGA6. Phylogenetic analysis was performed by neighbor joining method with the maximum composite likelihood model. The stability of clades was assessed with 500 bootstrap replications. Nodal numbers indicate bootstrap probabilities. The branch lengths are proportional to the numbers of nucleotide substitutions. The scale bar shows the number of substitutions per site. The sequences of A. flavus and A. caelatus were used as outgroups.

3-4. Fumonisin-Producing Status of Aspergillus section Nigri

Table 1 summarizes fumonisin production of fungi based on origin and the surmised clade of each strain. Of the 62 strains, 43 (69%) were A. niger, with the rest classified into the A. luchuensis /A. piperis/A. tubingensis clade. Among the 62 strains assessed, 13 (21%) were positive for FB2 production in accordance with LC-MS/MS results, with all of them being A. niger. Fumonisin producing-strains comprised 30% of the 43 strains that were classified into the A. niger clade. In contrast, fumonisin production was negative in all 19 strains classified into the A. luchuensis /A. piperis/A. tubingensis clade.

When examining the strains by origin, 17 of the 21 Aspergillus section Nigri strains isolated from imported pepper were identified as A. niger, of which seven were found to produce fumonisin (41% of the isolated A. niger strains). Of the four Aspergillus section Nigri strains isolated from imported corn grit, three were identified as A. niger, of which two were found to produce fumonisin (67% of the isolated A. niger strains). Of the 15 Aspergillus section Nigri strains isolated from domestic rice, eight were identified as A. niger, of which one produced fumonisin (13% of the isolated A. niger strains). Of the six Aspergillus section Nigri strains isolated from domestically produced dried soy bean, onion, and passion-fruit food products, five were identified as A. niger; however, none of these produced fumonisin. Of the eight Aspergillus section Nigri strains isolated from the air, five were identified as A. niger, of which two were found to produce fumonisin (40% of the isolated A. niger strains). Of the two Aspergillus section Nigri strains isolated from woods, both were identified as A. niger and one was found to produce fumonisin (50% of the isolated A. niger strains). In this study, the FB2-producing strains were found to belong only to the A. niger clade.

Based on their origin, FB2 production was often higher for strains derived from foods, such as pepper, corn grit, and rice while FB2 production of strains isolated from the environment tended to be lower under the conditions used in this study.

4. Discussion

Fumonisin B2 production by isolates of Aspergillus section Nigri had only been confirmed in A. niger strains originating from imported dried figs in previous studies of food products distributed in Japan15). However, the present study demonstrates that a considerable proportion, 33% of the A. niger strains derived from various food products, produce FB2 regardless of whether they are of Japanese origin or imported from other countries. While the production of fumonisins is not as high as that detected in fungi of the genus Fusarium, it seems possible that many food products can potentially be contaminated with FB2 from A. niger. Future studies are required to investigate the distribution of FB2-producing Aspergillus section Nigri strains in nature, particularly A. niger, and the risk posed by them in food products with a wide distribution including in Japan.

In addition, the tip culture method used in the present study has been reported as a suitable method for verifying aflatoxin production in A. flavus19). To our knowledge, this is the first time its efficacy has been verified in experiments to confirm fumonisin production in A. niger. Agar culture media are often used for detecting fumonisin production in A. niger but the process of extraction of the culture media and preparation of samples for analysis can be quite laborious. In contrast, using the tip culture system, incubation is performed in a small incubator and collection of the culture fluid requires only a single centrifugation step. Because sample broths can be rapidly obtained from multiple strain cultures, it is a promising method for high throughput experiments requiring analysis of numerous samples.

Mycotoxin productivity is species-specific to some extent, with particular mycotoxins associated with certain genera, and the presence of mycotoxins in commodities can be considered an indicator of infection and growth of the producing fungi20). Furthermore, phylogenetic relationships can, in some cases, be used to determine mycotoxin production capability in fungi that have not been evaluated for their mycotoxigenicity21). Such predictive inferences are potentially useful for monitoring and management of mycotoxin exposure. According to previous reports, the A. niger and A. luchuensis /A. piperis/A. tubingensis groups are each very closely related with similar morphologies17,22), and in the present study, fumonisin production was only observed in the A. niger clade. The difference in FB2 production between the A. niger and A. luchuensis /A. piperis/A. tubingensis clades may be due to genetic defects that result in loss of expression or the genes related to fumonisin biosynthesis23); however, these details remain unclear.

Additionally, the A. niger clade contained a mixture of fumonisin-producing groups and non-producing groups. However, in the Okinawa region, several fungal strains used in brewing since antiquity form a group that is clearly distinct even among the other Aspergillus section Nigri strains. Moreover, these strains are non-fumonisin producers24). It may be that domestication of fumonisin producers led to artificial selection of strains for brewing with a low potential for fumonisin production. In contrast, A. niger that has been selected and used industrially for production of citric acid exhibits the same level of fumonisin production as naturally derived strains9). Therefore, the elucidation of the detailed mechanism of fumonisin production by fungi of the Aspergillus section Nigri clade is clearly needed.

Acknowledgments

We thank Dr. Kimiko Yabe in Fukui University of Technology for advising about the tip culture method. This work was supported by the Health and Labor Sciences Research Grants (Research on Food Safety, H28-shokuhin-ippan-004) from the Ministry of Health, Labor and Welfare of Japan.

Abbreviations: CY20S: Czapek yeast extract-20% sucrose medium, CYA: Czapek yeast extract agar, CYB: Czapek yeast extract broth, CYBS: Czapek yeast extract broth +5% NaCl, CZ: Czapek dox broth, ELISA: enzyme-linked immunosorbent assay, FB1: fumonisin B1, FB2: fumonisin B2, FB3: fumonisin B3, HPLC: high performance liquid chromatography, LC-MS/MS: liquid chromatography-mass spectrometry/mass spectrometry, MEA: malt extract agar, PCR: polymerase chain reaction, PDA: potato dextrose agar, SN: signal to noise, YES: yeast extract sucrose medium

Footnotes

Conflict of interest: The authors have no conflict of interest.

References

  • 1.Gelderblom WCA, Jaskiewicz K, Marasas WFO, et al. Fumonisins--novel mycotoxins with cancer-promoting activity produced by Fusarium moniliforme. Appl Environ Microbiol. 1988; 54: 1806–1811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Gelderblom WCA, Kriek NPJ, Marasas WFO, Thiel PG. Toxicity and carcinogenicity of the Fusanum monilzforine metabolite, fumonisin B 1, in rats. Carcinogenesis. 1991; 12: 1247–1251. 10.1093/carcin/12.7.1247 [DOI] [PubMed] [Google Scholar]
  • 3.Voss KA, Riley RT, Gelineau-van Waes J. Fumonisin B 1 induced neural tube defects were not increased in LM/Bc mice fed folate-deficient diet. Molecular Nutrition & Food Research. 2014; 58: 1190–1198. 10.1002/mnfr.201300720 [DOI] [PubMed] [Google Scholar]
  • 4.Rheeder JP, Marasas WFO, Thiel PG, et al. Fusarium moniliforme and Fumonisins in Corn in Relation to Human Esophageal Cancer in Transkei. Phytopathology. 1992; 82: 353–357. 10.1094/Phyto-82-353 [DOI] [Google Scholar]
  • 5.Ueno Y, Iijima K, Wang SD, et al. Fumonisins as a possible contributory risk factor for primary liver cancer: A 3-year study of corn harvested in Haimen, China, by HPLC and ELISA. Food and Chemical Toxicology. 1997; 35: 1143–1150. 10.1016/S0278-6915(97)00113-0 [DOI] [PubMed] [Google Scholar]
  • 6.Pel HJ, de Winde JH, Archer DB, et al. Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nature Biotechnology. 2007; 25: 221–231. 10.1038/nbt1282 [DOI] [PubMed] [Google Scholar]
  • 7.Frisvad JC, Smedsgaard J, Samson RA, Larsen TO, Thrane U. Fumonisin B2 production by Aspergillus niger. Journal of Agricultural and Food Chemistry. 2007; 55: 9727–9732. 10.1021/jf0718906 [DOI] [PubMed] [Google Scholar]
  • 8.Frisvad JC, Larsen TO, Thrane U, et al. Fumonisin and ochratoxin production in industrial Aspergillus niger strains. PLoS ONE. 2011; 6: e23496. 10.1371/journal.pone.0023496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Logrieco A, Ferracane R, Haidukowsky M, Cozzi G, Visconti A, Ritieni A. Fumonisin B 2 production by Aspergillus niger from grapes and natural occurrence in must. Food Additives & Contaminants: Part A. 2009; 26: 1495–1500. 10.1080/02652030903148322 [DOI] [PubMed] [Google Scholar]
  • 10.Klick MA. Identification of common Aspergillus species. Utrecht, The Netherlands: Centraalbureau voor Schimmelcultures; 2002. [Google Scholar]
  • 11.Susca A, Proctor RH, Mulè G, et al. Correlation of mycotoxin fumonisin B2 production and presence of the fumonisin biosynthetic gene fum8 in Aspergillus niger from grape. Journal of Agricultural and Food Chemistry. 2010; 58: 9266–9272. 10.1021/jf101591x [DOI] [PubMed] [Google Scholar]
  • 12.Logrieco A, Ferracane R, Visconti A, Ritieni A. Natural occurrence of fumonisin B 2 in red wine from Italy. Food Additives & Contaminants: Part A. 2010; 27: 1136–1141. 10.1080/19440041003716547 [DOI] [PubMed] [Google Scholar]
  • 13.Knudsen PB, Mogensen JM, Larsen TO, Nielsen KF. Occurrence of fumonisins B(2) and B(4) in retail raisins. Journal of Agricultural and Food Chemistry. 2011; 59: 772–776. 10.1021/jf103855x [DOI] [PubMed] [Google Scholar]
  • 14.Mogensen JM, Frisvad JC, Thrane U, Nielsen KF. Production of Fumonisin B2 and B4 by Aspergillus niger on grapes and raisins. Journal of Agricultural and Food Chemistry. 2010; 58: 954–958. 10.1021/jf903116q [DOI] [PubMed] [Google Scholar]
  • 15.Yanai M, Kajihara C, Kimura A, Ogiso M, Baba H, Udagawa S. Identification and fumonisin B2 production of black aspergilli isolated from moldy dried fruits. Japanese Journal of Food Microbiology. 2013; 30: 33–38. 10.5803/jsfm.30.33 [DOI] [Google Scholar]
  • 16.Glass NL, Donaldson GC. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol. 1995; 61: 1323–1330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution. 2013; 30: 2725–2729. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hong SB, Lee M, Kim DH, et al. Aspergillus luchuensis, an industrially important black Aspergillus in East Asia. PLoS ONE. 2013; 8: e63769. 10.1371/journal.pone.0063769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yabe K, Nakamura H, Ando Y, Terakado N, Nakajima H, Hamasaki T. Isolation and characterization of Aspergillus parasiticus mutants with impaired aflatoxin production by a novel tip culture method. Appl Environ Microbiol. 1988; 54: 2096–2100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Frisvad JC. Physiological criteria and mycotoxin production as AIDS in identification of common asymmetric penicillia. Appl Environ Microbiol. 1981; 41: 568–579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Watanabe M, Yonezawa T, Sugita-Konishi Y, Kamata Y. Utility of the phylotoxigenic relationships among trichothecene-producing Fusarium species for predicting their mycotoxin-producing potential. Food Additives & Contaminants: Part A. 2013; 30: 1370–1381. 10.1080/19440049.2013.794305 [DOI] [PubMed] [Google Scholar]
  • 22.Nielsen KF, Mogensen JM, Johansen M, Larsen TO, Frisvad JC. Review of secondary metabolites and mycotoxins from the Aspergillus niger group. Analytical and Bioanalytical Chemistry. 2009; 395: 1225–1242. 10.1007/s00216-009-3081-5 [DOI] [PubMed] [Google Scholar]
  • 23.Butchko RAE, Plattner RD, Proctor RH. Deletion analysis of FUM genes involved in tricarballylic ester formation during fumonisin biosynthesis. Journal of Agricultural and Food Chemistry. 2006; 54: 9398–9404. 10.1021/jf0617869 [DOI] [PubMed] [Google Scholar]
  • 24.Hashimoto R, Asano K, Tokashiki T, et al. Mycotoxin production and genetic analysis of Aspergillus niger and related species including the Kuro-Koji mold. Mycotoxins. 2013; 63: 179–186. 10.2520/myco.63.179 [DOI] [Google Scholar]

Articles from Food Safety are provided here courtesy of Food Safety Commission of Japan

RESOURCES