Skip to main content
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2019 Nov 14;177(2):298–313. doi: 10.1111/bph.14863

LL1, a novel and highly selective STAT3 inhibitor, displays anti‐colorectal cancer activities in vitro and in vivo

Zhe Liu 1, Huan Wang 1, Lingnan Guan 1, Chong Lai 3, Wenying Yu 2,✉, Maode Lai 1,✉
PMCID: PMC6989959  PMID: 31499589

Abstract

Background and Purpose

Signal transducer and activator of transcription 3 (STAT3) factor is associated with the development and progression of numerous types of human cancer. STAT3 activation is involved in metastasis. However, no STAT3 inhibitor has been used therapeutically. Hence, we syntheised a novel, potent and small‐molecule inhibitor of STAT3, LL1, and studied its antitumour effects and investigated its mechanism of action in two tumour models.

Experimental Approach

Using structure‐based drug design method, based on the crystal structure of STAT3 protein, we identified a potent STAT3 inhibitor (LL1) targeting STAT3 SH2 domain and characterized its therapeutic properties and potential toxicity in vitro and in vivo using the MTT assay, colony formation assay, histological, immunohistochemical, flow cytometric analysis, and tumour xenograft model.

Key Results

LL1 is highly selective among STATs family members and specifically inhibits phosphorylation of STAT3 Tyr‐705 site, blocking the whole transmission process of STAT3 signalling. LL1 inhibited proliferation, colony formation, migration, and invasion of colonic cell lines. STAT3 is orally available to animals and suppresses tumour growth and metastasis in a dosage level compatible to clinical applications. Importantly, it does not cause significant toxicity at several times the effective dose.

Conclusions and Implications

LL1 inhibits tumour growth and metastasis by blocking STAT3 signalling pathway. LL1 could be a promising therapeutic drug candidate for colorectal cancer by inhibiting the STAT3 activation.


Abbreviations

LL1

4‐((2‐(piperazin‐1‐yl)phenyl)amino)‐5H‐naphtho[1,8‐cd]isothiazol‐5‐one 1,1‐dioxide

JAKS

Janus kinase

MST

microscale thermophoresis

qRT‐PCR

quantitative RT‐PCR

SH

Src homology domain

What is already known

  • STAT3 plays critical roles in some types of cancer such as breast, colorectal, and lung.

  • No inhibitors that directly target STAT3 have been approved by the FDA.

What this study adds

  • LL1 selectively inhibits the activation of STAT3.

  • LL1 is effective against colorectal cancer in vitro and vivo.

What is the clinical significance

  • LL1 could be a promising therapeutic drug candidate for colorectal cancer.

1. INTRODUCTION

The https://www.guidetopharmacology.org/GRAC/FamilyDisplayForward?familyId=990 are latent cytoplasmic transcription factors which can be activated by extracellular signalling ligands such as cytokines, growth factors, and hormones (Catlett‐Falcone et al., 1999; Darnell, Kerr, & Stark, 1994; Heinrich et al., 2003; Stark, Kerr, Williams, Silverman, & Schreiber, 1998; Zhong, Wen, & Darnell, 1994). Once activated, cytoplasmic STATs form homo‐ or hetero‐dimers and translocate to the nucleus where they can bind to the target genes and regulate their transcription (Reich & Liu, 2006). Seven members of the STATs family, STAT1, STAT2, https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=2994, STAT4, STAT5A, STAT5B, and STAT6, have been identified in mammals (Buettner, Mora, & Jove, 2002; Yu & Jove, 2004). The activation of STATs in normal cells is highly regulated to prevent unscheduled gene regulation. However, prolonged activation of STATs in cancer cells results in undesirable consequences. Among the seven members, STAT3 and STAT5 have more promenient role in tumour genesis. Persistent activation of STAT3 and STAT5, particularly STAT3, leads to altered regulation of crucial cellular processes such as cell proliferation, cell cycle progression, apoptosis, angiogenesis, and immune evasion (Bromberg & Darnell, 2000; Haura, Turkson, & Jove, 2005; Yu, Pardoll, & Jove, 2009).

Colorectal cancer ranks as the third most common cancer in western countries, more than 1.3 million people worldwide were diagnosed with the disease in 2012 (Kuipers et al., 2015). According to the statistics from American Cancer Society, there will be an estimated 140,250 new cases and 50,630 deaths due to colorectal cancer in the United States in 2018 (Siegel, Miller, & Jemal, 2017). At present, the treatment of colorectal cancer is by mainly surgery‐based chemotherapy supplement. Fluorouracil (5FU) and its derivatives are the most common chemotherapeutics used at the clinic, but drug resistance to a large extent limits the effect of chemotherapy. Therefore, there is a critical need for better therapeutic approaches to treat colorectal cancer. The development of colorectal cancer is a multistep process and is closely related to diet, environment, and genetic background (Brenner, Kloor, & Pox, 2014). Treatment regimens for advanced colorectal cancer involve the combination of chemotherapies that are toxic and mostly ineffective yet have remained the backbone of therapy over the last decade.

Increasing evidences indicate that STAT3 is involved in both tumour genesis and angiogenesis (Suiqing, Min, & Lirong, 2005). Furthermore, persistent STAT3 activation induces the abnormal high expression of downstream signalling, such as c‐myc, survivin, cyclin‐D1, https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=2844, and several other oncogenes (Levy & Darnell, 2002; Schindler, Levy, & Decker, 2007). The canonical target genes are responsible for the regulation of cell cycle, apoptosis, and various cell physiological functions (Levy & Lee, 2002). It has been reported that STAT3 activation in colorectal cancer is associated with adverse clinical outcome and poor prognosis (Morikawa et al., 2011). Primary human colorectal cancer cells and human colorectal cancer cell lines were detected with constitutive activation of STAT3 (Eyking et al., 2011; J. H. Park et al., 2017). The elevated level of STAT3 phosphorylation affects tumour invasion, nodal metastasis, and tumour staging (Rokavec et al., 2014; Timofeeva et al., 2013; Zhang et al., 2012). These reports indicate that STAT3 is one of the major oncogenic pathways activated in colorectal cancer and has the potential roles as a prognostic biomarker and a therapeutic target. Hence, strategies to exploit STAT3 alterations in colorectal cancer have a broad clinical potential.

Although STAT3 plays an important role in various biological processes of tumours, there is no clinically useful STAT3 inhibitor at this stage. In the earlier times, the development of STAT3 inhibitors has been in a state of stagnation, because researchers believe that the surface pocket of STAT3 protein is too shallow, and small molecules are difficult to bind to STAT3 protein. With the advancement of molecular biology and drug discovery technology, as well as the increasing role of STAT3 in tumour biology, researchers have found several small molecules that target STAT3, such as stattic (Scuto et al., 2011), STA‐21 (Park et al., 2014), HO‐3867 (Notarangelo et al., 2018), and so on. Stattic was the first non‐peptide STAT3 small‐molecule inhibitor, and many studies had shown its stable anti‐STAT3 effect (Scuto et al., 2011). However, most of these small molecules have low antitumour activity and low selectivity. Combining drug discovery, new technologies, chemical synthesis, and molecular biology techniques our research group has developed a novel STAT3 targeting molecule 4‐((2‐(piperazin‐1‐yl)phenyl)amino)‐5H‐naphtho[1,8‐cd]isothiazol‐5‐one 1,1‐dioxide (LL1), which has significant antitumour potency and selectivity. Mechanistically, LL1 interferes with the binding of SH2 domain, a key domain of STAT3 activation. Firstly, activated membrane receptors create a dock for STAT3 SH2 domain. The docked STAT proteins are subsequently activated by https://www.guidetopharmacology.org/GRAC/FamilyDisplayForward?familyId=581. Activated STAT monomers form homo‐ or hetero‐dimers and translocate to the nucleus. Binding of LL1 to SH2 domain will prevent activated receptors from recruiting STAT3, thereby affecting the phosphorylation process of STAT3. Moreover, inhibition of the SH2 domain would result in impairment of not only STAT3 activation and dimerization but also subsequent nuclear translocation and expression of STAT3‐regulated genes. Therapeutically, LL1 is orally available to animals and suppresses tumour growth without causing significant side effects in mice. The favourable pharmacological and therapeutic properties of LL1 demonstrate the potential of this compound as a potent therapeutic agent for cancer treatment.

2. METHODS

2.1. Design of LL1

Autodock4 was downloaded from its official website (http://autodock.scripps.edu/) for free and installed in English. The docking procedure involved the preparation of the ligand and macromolecule using the Schrödinger software. AutoDockTools were used to assign Gasteiger charges to the ligands. AutoGrid (RRID:SCR_015982) maps were then calculated for all atom types in the ligand set. The grid box was centred in the SH2 domain of the STAT proteins. The docking was performed according to its protocol of the software. All common reagents and solvents were obtained from commercial suppliers and used without further purification. Reaction progress was monitored using analytical TLC on precoated silica gel GF254 plates (Qingdao Haiyang Chemical Plant, Qingdao, China) plates, and the spots were detected under UV light (254 nm). Column chromatography was performed on a silica gel (90–150 μm; Qingdao Marine Chemical Inc.) The amount of silica gel used in column chromatography was 50–100 times the weight charged on the column. Melting point was measured on an XT‐4 micromelting point instrument and uncorrected. All the 1H NMR spectra were measured on a Bruker ACF‐500 spectrometer at 25°C and referenced to TMS. Chemical shifts are reported in ppm (δ) using the residual solvent line as internal standard. Splitting patterns were designed as s, singlet; br.s, broad single; d, doublet; t, triplet; m, multiplet. The purity of all compounds used for biological evaluation was confirmed to be higher than 95% through analytical HPLC performed with Agilent 1100 HPLC System. Mass spectra were obtained on a MS Agilent 1100 Series LC/MSD Trap mass spectrometer (ESI‐MS) and a Mariner ESI‐TOF spectrometer (HRESI‐MS), respectively.

2.2. Synthesis of compound 2

Naphthalene sulfonyl chloride 1 (5 g, 21.9 mmol) was dissolved in acetone (200 ml) and was stirred at 0°C for 30 min. Ammonium hydroxide (240 ml) was cooled to 0°C and was added to the above mixture and stirred at room temperature for 3 hr. Acetone was removed at reduced pressure, and then precipitated white crystals were formed. The formed precipitate was collected by filtration, washed with water, and dried to give compound 2 (4.35 g, 96.7%); melting point (mp) 147 to 149°C; 1H NMR (500 MHz, DMSO‐d 6) δ 8.65 (d, J = 8.5 Hz, 1H), 8.19 (d, J = 8.2 Hz, 1H), 8.14 (d, J = 6.8 Hz, 1H), 8.08 (d, J = 7.4 Hz, 1H), 7.76–7.59 (m, 5H); MS ([M + Na]+ 230.0245).

2.3. Synthesis of compound 3

Compound 2 (500 mg, 2.41 mmol) was dissolved in glacial acetic acid (5 ml). Chromium trioxide (1.08 g, 10.85 mmol) was dissolved in a mixture of water–glacial acetic acid (1:1, 2 ml) and was added to the solution of compound 2 and was stirred at 85°C for 16 min. The solution was poured into ice water then stood overnight. The precipitated yellow powder was filtered, washed with water, and dried to give compound 3 (100 mg, 17.5%); mp (187–188°C); 1H NMR (500 MHz, DMSO‐d 6) δ 7.23 (d, J = 9 Hz, 2H), 7.43 (s, 2H), 8.11 (t, J = 9 Hz, 1H), 8.34 (d, J = 9 Hz, 1H), 8.515 (d, J = 9 Hz, 1H); MS ([M + Na]+ 259.9990).

2.4. Synthesis of compound 5

To a solution of compound 2 (500 mg, 2.11 mmol), tert‐butyl 4‐(2‐aminophenyl)piperazine‐1‐carboxylate 4 (700 mg, 2.52 mmol) and Cu(OAc)2 ·H2O (42 mg, 0.21 mmol) were stirred in glacial acetic acid (12 ml) at 73°C for 3 hr. When TLC indicated that the reaction was complete, glacial acetic acid was removed at reduced pressure, loaded on silica gel, and purified by flash column chromatography with petroleum/ethyl acetate as eluent to give compound 5 (568 mg, 51.1%); mp (189–190°C); 1H NMR (500 MHz, DMSO‐d 6) δ 8.85 (s, 1H), 8.39 (dd, J = 8.0, 1.3 Hz, 1H), 8.29 (dd, J = 7.8, 1.3 Hz, 1H), 8.05 (t, J = 7.8 Hz, 1H), 7.43–7.45 (d, 2H), 7.41 (s, 2H), 7.23 (d, J = 4.2 Hz, 2H), 6.12 (s, 1H), 3.45 (t, J = 4.8 Hz, 4H), 2.82 (t, J = 5.0 Hz, 4H), 1.40 (s, 9H); MS ([M + Na]+ 535.1619).

2.5. Synthesis of compound LL1

To a solution of compound 5 (200 mg, 0.39 mmol) in dichloromethane (2 ml) was added trifluoroacetic acid (2 ml) at room temperature. The mixture was stirred for 2 hr until the reaction was complete. The solution was evaporated, and the residue was purified by flash column chromatography (dichloromethane/methanol) to give the title compound LL1 (113 mg, 70.2%); mp (200–201°C); 1H NMR (500 MHz, DMSO‐d 6) δ 9.11 (s, 1H), 8.74 (s, 2H), 8.42 (d, J = 7.4 Hz, 1H), 8.08 (dd, J = 19.6, 7.4 Hz, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.32 (t, J = 7.8 Hz, 1H), 7.28–7.19 (m, 2H), 5.86 (s, 1H), 3.18–3.10 (m, 8H); MS ([M + H]+ 395.1174). LL1 was synthesized at the Department of Medicinal Chemistry, School of Pharmacy, China Pharmaceutical University, and the purity was no less than 99%. For in vitro experiments, LL1 was dissolved in DMSO. For in vivo experiments, LL1 was suspended and diluted in 0.5% methylcellulose solution, or the solid dispersion form of LL1 was suspended in saline solution. LL1 was administered in a volume of 5 ml·kg−1.

2.6. Cell lines and reagents

Human colorectal cancer cell lines, HCT116 (RRID:CVCL_0291), SW480 (RRID:CVCL_0546), RKO (RRID:CVCL_0504), Caco‐2 (RRID:CVCL_0025), and HT29 (RRID:CVCL_0320) were purchased from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All the above cell lines were maintained in DMEM (Gibco) supplemented with 10% FBS, 4.5 g·L−1 l‐glutamine, sodium pyruvate, and 1% penicillin/streptomycin. All cell lines were cultured in a humidified 37°C incubator with 5% CO2. https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4998 and EGF were purchased from Cell Signaling Technology. The powder of LL1 was dissolved in sterile DMSO to make a 10‐mM stock solution stored at −20°C.

2.7. Cell viability assay

The cells were seeded in 96‐well plates at 5,000 cells per well. After incubated for 24 hr, the cells were treated with LL1 ranging from 1 to 32 μM. The cells were incubated for 24 hr, and viability was identified using the MTT assay. The absorbance was read at 490 nm.

2.8. Colony formation

The cells were seeded in six‐well plates at 10,000 cells per well. After cultured for 24 hr, the cells were treated with varying concentrations of LL1 and incubated for a week. The cells were washed and fixed with cold methanol for 15 min. After stained with crystal violet for 10 min, the cells were rinsed and dried.

2.9. Wound healing assay

SW480 and RKO cells were seeded in six‐well plates. When the cells reached 100% confluence, the cells were scratched using a yellow tip and washed twice to remove non‐adherent cells. The cells were treated with DMSO and 1 and 2 μM of LL1. The cells were allowed to migrate into the scratched area for 48 hr, and observed under the microscope. The percentage of wound healing was calculated using the formula: (per cent wound healing) = average of [(gap area: 0 hr) − (gap area: 48 hr)]/(gap area: 0 hr).

2.10. Flow cytometry

The cells were seeded in six‐well plates at 10 × 104 cells per well and incubated for 24 hr; the cells were treated with DMSO or LL1 for an addition of 24 hr. After the treatment, the cells were washed and harvested with cold PBS. Apoptotic cell death was detected using Cell Apoptosis Detection Kit and Annexin V‐FITC Apoptosis Detection Kit (Keygen) according to the manufacturer's instruction. The cells were analysed by flow cytometry.

2.11. Mitochondrial membrane potential detection

The cells were seeded in six‐well plates at 10 × 104 cells per well and incubated for 24 hr, the cells were treated with DMSO or LL1 for addition 24 hr. After the treatment, the cells were washed and harvested with cold PBS. Mitochondrial membrane potential was detected using JC‐1 Apoptosis Detection Kit according to the manufacturer's instruction. The cells were analysed by flow cytometry.

2.12. ROS assay

SW480 and HCT116 cells were seeded in six‐well plate at a density of 3 × 105 cells per well. After 24 hr, the cells were treated with LL1 (0, 2, 4, and 8 μM) for 4 hr. DCFH‐DA was dissolved in serum‐free medium and diluted to a final concentration of 10 μM. The cells were incubated with the probe for 20 min at 37°C after the treatment of LL1. The cells were harvested and washed with serum‐free medium and analysed by flow cytometry.

2.13. Dual luciferase reporter assays

Dual luciferase reporter gene assay kit was used to detect the activity of firefly luciferase and Renilla activity, and transient transfection was conducted using Lipofectamine 2000 (Life Technologies, Grand Island, NY, USA). The cells were seeded in 24‐well culture plates at 1 × 104 per well. After incubation for 24 hr, the cells were cotransfected with appropriate reporter plasmids 0.8 μg pGMSTAT3‐Lu and internal control (pGMR‐TK, 0.08 μg) in 24‐well plates and incubated for 24 hr. HCT116 and SW480 cells were treated with LL1 (0, 1, 2, and 4 μM) for 24 hr, and then the cells were lysed. The luciferase and Renilla activities were measured using Luminoskan Ascent (Thermo Scientific, Waltham, MA, USA), and the luciferase activity was normalized to Renilla activity.

2.14. DNA binding activity assays

DNA binding activity of STAT3 was tested by EMSA/Gel‐Shift kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. Briefly, excess cold hSIE probe (5′‐AGCTTCATTTCCCGTAAATCCCTA‐3′) that binds STAT1 and STAT3 and MGFe (5′‐AGATTTCTAGGAATTCAA) that binds STAT5 and STAT1 for 30 min at room temperature in binding buffer. The radiolabelled probes were mixed with protein samples and incubated for 30 min at room temperature. The samples were subjected to SDS‐PAGE gel and transferred to a PVDF membrane. Bound immuno‐complexes were detected using ChemiDOC™ XRS + system (Bio‐Rad Laboratories, Hercules, CA, USA, RRID:SCR_008426).

2.15. Immunofluorescence

SW480 and HCT116 cells were seeded in 24‐well plates at 5 × 104 per well. After incubated for 24 hr, the cells were cultured in serum‐free medium for 24 hr. The cells were pretreated with LL1 (4 μM) for 2 hr, and then cultured with IL‐6 (50 ng ml) for another 30 min. After the treatment, the cells were fixed with cold methanol for 15 min. The cells were blocked using 5% normal goat serum and treated with 0.3% Triton X‐100 for 30 min. After washing three times with PBS, the cells were probed with primary antibody of P‐STAT3 and STAT3 (1:100 dilution) overnight at 4°C. The cells were incubated with anti‐rabbit IgG (H + L), F (ab′) 2 fragment Alexa Fluor 555 secondary antibody (Cell Signaling, 1:200) for 1 hr. After mounted using DAPI (Beyotime Biotechnology) for 10 min, the cells were captured by fluorescent microscope.

2.16. Microscale thermophoresis assay

The GFP‐tagged STAT3 purified protein (140 nM) was mixed with 16 different concentrations of LL1 (0.0153–500 μM). In the dilution series, the highest concentration was chosen to be 20‐fold higher than the expected Ki. A 10‐μl aliquot of the serial dilution of the nonlabelled molecule (LL1) was mixed with 10 μl of the GFP‐tagged STAT3 purified protein. Mixed samples were loaded into glass capillaries, and the microscale thermophoresis (MST) analysis was performed using the Monolith NT.115 MST instrument.

2.17. Biolayer interferometry

Super Streptavidin Biosensor from ForteBio were used to capture 100 μg·ml−1 biotinylated recombinant human STAT3 protein onto the surface of the Super Streptavidin Biosensor. After reaching the baseline, sensors were subjected to the association step containing 1.66‐, 3.32‐, 6.64‐, 13.28‐, and 26.56‐μM LL1 for 60 s and then dissociated for 60s. All reagents were diluted in PBS buffer containing 1% DMSO, 0.02% Tween 20, and 0.1 mg·ml−1 BSA.

2.18. Western blot analysis

The cells were seeded in six‐well plates at 50 × 104 cells per well. After incubated for 24 hr, the cells were treated with LL1 (1 μM, 2 μM and 4 μM) or DMSO for 24 hr. The cells were harvested and lysed after treatment then lysates were subjected to 10% SDS‐PAGE gel and transferred to PVDF membrane. Membranes were probed with a 1:2,000 dilution of primary antibodies and 1:4000 HRP conjugated secondary antibodies. Primary antibodies including cyclin D1 (RRID:AB_443423), β‐catenin (RRID:AB_725966), survivin (RRID:AB_1524459), c‐myc (RRID:AB_731658), Bcl‐2 (RRID:AB_725644), phospho‐STAT3 (Tyr705) (RRID:AB_1658549), and STAT3 (RRID:AB_10901752) were purchased from Abcam. E‐cadherin (RRID:AB_2291471), N‐cadherin (RRID:AB_2687616), vimentin (RRID:AB_10695459), STAT1 (RRID:AB_2197984), phospho‐STAT1 (Tyr701) (RRID:AB_10860071), phospho‐STAT5 (Tyr694) (RRID:AB_2315225), and STAT5 (RRID:AB_2798908) were purchased from Cell Signaling Technology (Beverly, MA, USA). Cleaved caspase‐3 (RRID:AB_302962), caspase‐3 (RRID:AB_777433), cleaved caspase‐9 (RRID:AB_302981), and caspase‐9 (RRID:AB_725960) were obtained from Abcam. β‐actin and secondary antibodies were purchased from Beyotime Biotechnology. The immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology.

2.19. Quantitative RT‐PCR

Total mRNA was isolated from cells using TRIzol (Invitrogen, Life Technologies), and cDNA was synthesized using HiScript Q RT SuperMix for qPCR (Vazyme Biotech). Quantitative RT‐PCR (qRT‐PCR) analysis was performed using SYBR green on an iCycler mounted with an iQ5 Multicolor Real‐Time PCR Detection System (Bio‐Rad). The relative gene expression level between treatments was calculated using the following equation: relative gene expression = 2−(ΔCtsample−ΔCtcontrol). Primer sequences (Realgene): Human Bcl‐2 [forward (F): GGTGGGGTCATGTGTGTGG; reverse (R): CGGTTCAGGTACTCAGTCATCC], Human cyclin D1 [forward (F): GCTGCGAAGTGGAAACCATC; reverse (R): CCTCCTTCTGCACACATTTGAA], Human Survivin [forward (F): AGGACCACCGCATCTCTACAT; reverse (R): AAGTCTGGCTCGTTCTCAGTG], Human β‐Actin [forward (F): AGCGAGCATCCCCCAAAGTT; reverse (R): GGGCACGAAGGCTCATCATT].

2.20. STAT3 siRNA transfection

Human STAT3 siRNA and negative control siRNA (Realgene) were transfected into HCT116 and SW480 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instruction. The cells were incubated for 48 hr before harvested and lysed for protein analysis or processed to cell viability assay. STAT3 siRNA sequences: STAT3#1 [sense (5′‐3′): GGGACCUGGUGUGUGAAUUAUTT; antisense (5′‐3′): AUAAUUCACACCAGGUCCCTT], STAT3#2 [sense (5′‐3′): CCCGGAAAUUUAACAUUCUTT; antisense (5′‐3′): AGAAUGUUAAAUUUCCGGGTT], STAT3#3 [sense (5′‐3′): GGUACAUCAUGGGCUUUAUTT; antisense (5′‐3′): AUAAAGCCCAUGAUGUACCTT].

2.21. Acute toxicity test

All mice were housed under standard specific pathogen‐free conditions, and all animal experiments in the study were performed under a protocol approved by the China Pharmaceutical University Institutional Animal Care and Use Committee. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010) and with the recommendations made by the British Journal of Pharmacology. ICR mice (RRID:MGI:5523976) were purchased from Vital River Laboratory. Six to 7‐week‐old female ICR mice were divided into five groups (n = 10) randomly and treated with LL1 (5, 50, 500, and 1,000 mg·kg−1) or solvent (saline) by gavage once a day. Five mice were kept in a cage. LD50 was measured after the treatment for 2 weeks. The mice were killed after 14 days by cervical dislocation.

2.22. Animal experiments

All animal experiments were conducted in accordance with the principles and procedures approved by the Committee on the Ethics of Animal Experiments of China Pharmaceutical University. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny, Browne, Cuthill, Emerson, & Altman, 2010) and with the recommendations made by the British Journal of Pharmacology. All healthy mice were purchased from Vital River Laboratory. Athymic nude mice (4 to 5 weeks old) and ICR mice (6 to 7 weeks old) were all female, and severe‐combined immunodeficient mice (5 weeks old) were male. All mice were housed under standard specific pathogen‐free conditions. Three or five mice were kept in a cage. All mice were executed by cervical dislocation at the end of the research. This study is in accordance with the 3Rs. The assessments were carried out by an investigator blinded to all groups of mice.

Four to 5‐week‐old female athymic nude mice (RRID:IMSR_CRL:194) were purchased from Vital River Laboratory. Briefly, 1 × 107 HCT116 cells were injected subcutaneously in the right flanks of female nude mice. When the tumour volume reached about 100 mm3, the mice were grouped randomly. Then mice were divided into three groups (n = 6) randomly and treated with LL1 (5 mg·kg−1), stattic (5 mg·kg−1), or solvent (saline) by gavage once a day, and tumour volume and body weight were measured three times per week. Three mice were kept in a cage. The mice were killed after 21 days by cervical dislocation. Tumours were harvested, weighted, and subjected to further use.

2.23. Tail vein transfer model

HCT116 cells were first transfected with pGKV5 luciferase vector and then treated with G418 at 4 μg·ml−1 to obtain a cell line stably expressing luciferase. Each mouse (severe non‐obese diabetic/severe‐combined immunodeficient mice, male, 5 weeks old) was injected with 1 × 106 luciferase stable expressed HCT 116 cells in 100‐μl PBS by tail vein injection. Then mice were divided into two groups (n = 8) randomly and treated with LL1 (5 mg·kg−1) or solvent (saline) by gavage once a day. Three mice were kept in a cage. Mice were detected every week for metastatic foci by bioluminescence imaging. Mice were injected with luciferin (150 mg·kg−1, 5 min prior to imaging), anaesthetized with 3% isoflurane, and then imaged in an IVIS spectrum imaging system (Caliper, Newton, USA). Images were analysed with Living Image software (Caliper, RRID:SCR_014247). Bioluminescent flux was determined for the tumours and lungs. The mice were killed after 42 days by cervical dislocation.

2.24. Data and statistical analysis

The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2012). Data are presented as mean ± SD. These data were analysed with ANOVA with appropriate post hoc comparison among means. *P < .05 was considered statistically significant. Data were analysed using GraphPad Prism (RRID:SCR_002798). Representative data are presented as raw data. Unless indicated otherwise, experiments were carried out at n = 5, where n = number of independent experiments. Blinding or randomization was undertaken in vitro and in vivo studies

2.25. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2017/18 (Alexander et al., 2017).

3. RESULTS

3.1. Design and synthesis of LL1

The STAT3 protein consists of N‐terminal, coiled coil domain, DNA binding domain, SH2 domain, and transactivation domain. Among them, DNA binding domain and SH2 domain are regarded as the two most effective binding targets. However, since small molecules targeting DNA binding domains are less selective for STAT3, we chose SH2 domain as our target.

Computer‐aided drug design is used for the design of druggable STAT3 inhibitors. Using structure‐based drug design method, based on the crystal structure of STAT3 protein (PDB:1BG1), we found that compound LL1 could fit to the hot spots of STAT3 protein very well with a docking score of −7.5 kcal·mol−1 by Autodock4. Its docking mode is shown in Figure 1a. Compound LL1 was synthesized as Figure 1b.

Figure 1.

Figure 1

LL1 binds to STAT3 and disrupts the signal transduction process. (a) Molecular docking model of LL1 and STAT3. (b) Graphical synthetic route of LL1. (c) and (d) LL1 directly bound to the STAT3 protein as shown by microscale thermophoresis assay. A 10‐μl aliquot of the serial dilution (500–0.0153 μM) of the nonlabelled molecule (LL1) was mixed with 10 μl of GFP or labelled STAT3. Mixed samples were loaded into glass capillaries, and the analysis was performed using the Monolith NT.115 MST instrument. (e) Biolayer interferometry quantification of the binding of LL1 to purified STAT3 shows that LL1 has affinity for STAT3. (f) LL1 inhibits the nuclear translocation of p‐STAT3. HCT‐116 and SW480 cells were incubated with the indicated concentrations of DMSO, IL‐6 (50 ng·ml−1), and LL1 (4 μM) plus IL‐6 (50 ng·ml−1) for 6 hr. Confocal images of the cells show the fluorescence of DAPI in blue, STAT3 in green, and the merged images in column 3. (g) EMSA analysis of equal total protein containing activated STATs, pre‐incubated with 0‐ to 4‐μM LL1 for 30 min before incubation with a radiolabelled hSIE probe that binds STAT1 and STAT3 proteins or mammary gland factor element probe that binds STAT5 and STAT1 proteins. EMSA analysis using a hSIE probe for STAT3 DNA binding activity in protein prepared from SW480 and HCT116 cells treated with 0‐ to 4‐μM LL1. (h) Quantification of transcriptional activity by luciferase assay in LL1‐treated SW480 and HCT116 cells. Data are mean ± SD, n = 5. *P value <.05 compared with the control group

3.2. LL1 directly binds to STAT3 and disrupts the signal conduction process

The original intention of our research is to inhibit the activation of STAT3 by binding small molecules to the SH2 domain of STAT3, and therefore, we will detect the binding activity of LL1 with STAT3 protein. We performed an MST assay to evaluate the affinity between purified STAT3 and LL1. MST was a recently broadly used technology for the analysis of the interactions of biomolecules, and the equilibrium K D was used to show the affinity between the two molecules. Our results demonstrated that LL1 directly bound to the STAT3 protein with a K D value of 3.3 μM (Figure 1c), and we can conclude that the binding ratio of LL1 to STAT3 protein exceeds 95% through formula (K D = A*B/AB). In order to demonstrate the stability of the experiment and eliminate the error, we performed a second binding experiment using GFP and LL1. The result showed almost no affinity between GFP and LL1 (Figure 1d). In addition, we performed biolayer interferometry to verify the robustness of binding. The results demonstrated that LL1 binds to the STAT3 protein with a low K D value of 4.1 μM (Figure 1e). These results all indicate that LL1 specifically binds to STAT3, and this binding is stable as well as having a high affinity. SH2 domain specifically recognizes phosphorylated tyrosine residue on other ligands, and therefore, STAT3 will lose the ability to recognize phosphorylated tyrosine residue on other molecules once LL1 binds to its SH2 domain. As a consequence, STAT3 proteins cannot be phosphorylated by JAK and losses its dimerization ability. STAT3 dimers translocated into the nucleus, while free STAT3 monomer tends to remain mainly in the cytoplasm. This phenomenon is shown in Figure 1f, as LL1 blocks dimerization of STAT3. As a transcription factor, STAT3 dimers would translocate into the nucleus and bound to the target DNA to initiate transcription. We used EMSA to evaluate the DNA binding activity and luciferase to detect the transcription factor activity of STAT3. The hSIE probe could bind to STAT3 or STAT1 dimers specifically, and the mammary gland factor element probe could bind to STAT5 or STAT1 dimers. Probes binding to STAT proteins indicated the DNA binding activity of STATs. We found that LL1 selectively inhibited DNA binding activity of STAT3, while almost no effect on STAT1 dimers and STAT5 dimers (Figure 1g). Moreover, the results of luciferase showed that LL1 inhibited the transcription factor activity (Figure 1h).

3.3. LL1 specifically inhibited STAT3 phosphorylation and nuclear translocation

Considering that STAT3 regulates various biological processes of tumour cells following activation, we investigated the expression of STAT3, p‐STAT3, and downstream targets. LL1 significantly decreased the expression of p‐STAT3 but did not inhibit total STAT3 in colorectal cancer cell lines (Figure 2a). Furthermore, LL1 down‐regulated the target genes of STAT3 such as cyclin D1, survivin, and Bcl‐2. To further confirm the effect of LL1 on STAT3 downstream gene expression, qRT‐PCR was used to measure STAT3 downstream target gene expression (Figure 2b). The results were consistent with the western blot data, suggesting that STAT3‐related genes were down‐regulated by LL1. We have demonstrated that LL1 exerts an inhibitory effect by inhibiting STAT3 phosphorylation, and we hope to further explore the specificity of LL1 in STATs family members. We chose STAT1 and STAT5 as our subjects, because STAT1 has the most similar structure to STAT3, and STAT5 and STAT3 have similar functions. Following the treatment of cytokines, STAT3, STAT1, and STAT5 were activated. We found that phosphorylated STAT3 was inhibited by LL1; however, LL1 had almost no inhibitory effect on the increased phosphorylation of STAT1 or STAT5 stimulated by IFN‐γ or EGF respectively in colorectal cancer cells (Figure 2c). Additionally, LL1 selectively inhibited STAT3 activation on Tyr‐705 site rather than on Ser‐727 site (Figure 2d). STAT3 activation was mainly achieved through Tyr‐705 site phosphorylation, while Ser‐727 site phosphorylation increased the affinity of STAT3 to DNA and enhanced transcriptional activity. These results demonstrated that LL1 selectively inhibited STAT3 phosphorylation at Tyr‐705 site in colorectal cancer cell lines.

Figure 2.

Figure 2

LL1 selectively inhibits STAT3 phosphorylation. (a) Left: Western blotting analysis of p‐STAT3 (Tyr‐705), STAT3, and downstream target genes in HCT116 and SW480 cells after LL1 treatment (1, 2, and 4 μM) for 24 hr. An anti‐β‐actin antibody was used to check the proper protein loading. Right: Analysis of WB results in (a). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group. (b) qRT‐PCR analysis of Bcl‐2, c‐myc, and survivin in HCT‐116 and SW480 cells after LL1 treatment (1, 2, and 4 μM) for 24 hr. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group. (c) Left: Western blotting analysis of STAT3 and p‐STAT3 (Tyr‐705) in HCT‐116 and SW480 cells that stimulated by IL‐6 (50 ng·ml−1) after LL1 treatment (1 and 2 μM) for 24 hr. An anti‐β‐actin antibody was used to check the proper protein loading. Western blotting analysis of STAT1, p‐STAT1 (Tyr‐701), STAT5, and p‐STAT5 (Tyr‐694) in HCT116 and SW480 cells that stimulated by IFN‐γ (50 ng·ml−1) or EGF (50 ng·ml−1) after LL1 treatment (1 and 2 μM) for 24 hr. An anti‐β‐actin antibody was used to check the proper protein loading. Right: Analysis of WB results in (c). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group. (d) Left: Western blotting analysis of STAT3, p‐STAT3 (Tyr‐705), and p‐STAT3 (Ser‐727) in HCT‐116 and SW480 cells that treated with 0‐, 1‐, 2‐, and 4‐μM LL1 for 24 hr. An anti‐β‐actin antibody was used to check the proper protein loading. Right: Analysis of WB results in (d). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group

3.4. LL1 inhibits the viability of colorectal cancer cells in vitro

To test the anticancer effect of LL1, we explored the cytotoxicity of LL1 in five human colorectal cancer cell lines, SW480, HCT116, RKO, HT29, and Caco‐2. Our data demonstrated that LL1 inhibited cell survival in a dose‐dependent fashion on colorectal cancer cell lines with IC50 from 3 to 16 μM (Figure 3a) and it remarkably reduced the colony formation capacity in HCT116, SW480, and RKO cell lines (Figure 3b). The results showed that the antitumour activity of LL1 in the Caco‐2 cell line was much lower than in other cell lines. To explore the possible mechanisms by which LL1 exerts its different antitumour activity in colorectal cancer cell lines, we performed western blotting and found that Caco‐2 showed the lowest p‐STAT3 level in these cell lines (Figure 3c,d). The result demonstrated that the cytotoxic activity of LL1 on colorectal cancer cells may correlate with the expression of p‐STAT3 in different colorectal cancer cell lines.

Figure 3.

Figure 3

Inhibition of proliferation in colorectal cancer cell by LL1. (a) SW480, HCT‐116, RKO, HT29, and Caco‐2 cells were seeded in 96‐well plates, incubated overnight, and treated with 0‐, 1‐, 2‐, 4‐, 8‐, and 16‐μM LL1 for 24 hr. Data represent mean ± SD, n = 5, *P < .05. (b) SW480, HCT116, and RKO cells were seeded in six‐well plates, incubated overnight, and treated with 0‐ to 0.5‐μM LL1 for 7 days. Cells were stained by crystal violet and counted under optical microscope. Data are mean ± SD, n = 5. *P value <.05 compared with the control group. (c) Western blotting analysis of p‐STAT3 in HCT‐116, SW480, Caco‐2, and RKO cells. An anti‐β‐actin antibody was used to check the proper protein loading. (d) Quantification of p‐STAT3 (Tyr‐705) expression in four cancer cell lines. Data are mean ± SD, n = 5

To further confirm the inhibitory ability of LL1 for aberrantly activated p‐STAT3 and its anticancer effects, we used siRNA approach to specifically silence STAT3 and to assess the effects on colorectal cancer cells. STAT3 siRNA effectively inhibited the expression of STAT3 and its downstream targets (Figure 4a). Moreover, knockdown of STAT3 significantly produced strong cytotoxicity and inhibited the colonies formation in SW480 and HCT116 cell lines (Figure 4b,c). These results demonstrated that STAT3 played a critical role in the growth of colorectal cancer cells. In addition, STAT3 silence induced the decrease of cell viabilities in SW480 and HCT116 cell lines; however, LL1 treatment did not induce further cell death, suggesting that LL1 was selective for STAT3 (Figure 4c). More than that, overexpressed STAT3 increased the colony‐forming activity in both SW480 and HCT116 cell lines (Figure 4e). p‐STAT3 and Bcl‐2 were up‐regulated after lentiviral transfection (Figure 4d). Overexpression of STAT3 exhibited protective effects to LL1‐induced cell death (Figure 4f), implying that STAT3 was the target for LL1.

Figure 4.

Figure 4

The role of STAT3 expression in the biology of colorectal cancer cells. (a) Left: Western blotting analysis of STAT3, p‐STAT3, β‐catenin, cyclin D1, and c‐myc in HCT‐116 and SW480 cell lines that transfected with or without STAT3 siRNA. An anti‐β‐actin antibody was used to check the proper protein loading. Right: Analysis of WB results in (a). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group. (b) SW480 and HCT116 cells were seeded in six‐well plates, incubated overnight, and transfected with or without STAT3 siRNA for 7 days. Cells were stained by crystal violet and counted under optical microscope. (c) SW480 and HCT116 cells were seeded in 96‐well plates, incubated overnight, and transfected with or without STAT3 siRNA. After the cells were treated with 0‐, 2‐, and 4‐μM LL1 for 24 hr, cell viability was detected by MTT assay. Data represent mean ± SD, n = 5, *P < .05. (d) Left: Western blotting analysis of STAT3, Bcl‐2, and p‐STAT3 in HCT‐116 and SW480 cell lines that transfected with or without STAT3 cDNA. An anti‐β‐actin antibody was used to check the proper protein loading. Right: Analysis of WB results in (d). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with the control group. (e) SW480 and HCT116 cells were seeded in six‐well plates, incubated overnight, and transfected with or without STAT3 cDNA for 7 days. Cells were stained by crystal violet and counted under optical microscope. (f) SW480 and HCT116 cells were seeded in 96‐well plates, incubated overnight, and transfected with or without STAT3 cDNA. After the cells were treated with 0‐, 0.5‐, 1‐, 2‐, 4‐, 8‐, and 16‐μM LL1 for 24 hr, cell viability was detected by MTT assay. Data represent mean ± SD, n = 5, *P < .05 compared with the control group

3.5. LL1 induces apoptosis and inhibits metastasis in colorectal cancer cells

SW480 and HCT116 cells were stained with PI, and we found that the cell number of sub G1 phase was obviously increased after treatment with LL1 by flow cytometry (Figure 5a). In addition, we performed Annexin V and PI staining assay to determine whether LL1 induces apoptosis or necrosis. As shown in Figure 5b, cell apoptosis rates measured by flow cytometer in SW480 and HCT116 cells were markedly increased to 51.5% and 27.5%, significantly higher than in control. Furthermore, we found that Bcl‐2 was down‐regulated in SW80 and HCT116 cell lines after treatment with LL1, and caspase‐9 and caspase‐3 were both activated, suggesting the involvement of these two caspases in LL1‐induced apoptosis (Figure 5c). Electron microscopy data showed that chromatin was aggregated at margin of nucleus following the treatment of LL1 (Figure 5d). These results above demonstrated that LL1 might induce cell apoptosis through mitochondria apoptosis pathway. Mitochondrion is the main organelle of https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1840 production and the primary targets of ROS. Elevated intracellular ROS can cause a decrease in mitochondrial membrane potential, leading to apoptosis. We found that the treatment of LL1 on colorectal cancer cells could induce a decrease in mitochondrial membrane potential, and therefore, we evaluated the ROS levels in tumour cells using flow cytometry. As expected, the ROS levels increased at different concentrations of LL1 in SW480 and HCT116 cells (Figure S2). More than that, cell death induced by LL1 was partially protected by N‐acetyl‐l‐cysteine, a ROS scavenger (Figure S3). These results indicated that stimulating cells to produce ROS may be another mechanism of LL1‐induced apoptosis.

Figure 5.

Figure 5

LL1 induces apoptosis and inhibits metastasis in colorectal cancer cells. (a) SW480 and HCT116 cells were seeded in six‐well plates. After treatment with 4‐μM LL1 for 24 hr, cells were stained with PI, detected by flow cytometry. (b) SW480 and HCT116 cells were seeded in six‐well plates. After treatment with 4‐μM LL1 for 24 hr, cells were stained with Annexin V and PI, detected by flow cytometry. (c) Left: Western blotting analysis of Bcl‐2, caspase‐9, cleaved caspase‐9, caspase‐3, and cleaved caspase‐3 in HCT116 and SW480 cells after LL1 treatment (1, 2, and 4 μM) for 24 hr. An anti‐β‐actin antibody was used to check the proper protein loading. Right: Analysis of WB results in (c). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group. (d) SW480 cells were treated with 8‐μM LL1 for 24 hr, and the sample was photographed by transmission electron after immobilization. (e) Transwell migration activity of SW480 and HCT116 cells induced by LL1 (2 μM). (f) The inhibition of cell invasion was assessed by using the ImageJ. Data are mean ± SD, n = 5. * P value <.05 compared with the control group. (g) Upper: Western blotting analysis of E‐cadherin, vimentin, and N‐cadherin in HCT116 and SW480 cells after LL1 treatment (1, 2, and 4 μM) for 24 hr. An anti‐β‐actin antibody was used to check the proper protein loading. Down: Analysis of WB results in (g). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group. (h) A total of 1 × 106 HCT116 cells infected with pGKV5 luciferase was injected into the tail vein of severe‐combined immunodeficiency mice, n = 6. The locations of tumour cells overexpressing luciferase were monitored by in vivo bioluminescent imaging 0, 7, and 42 days after injection

To investigate the effect of LL1 on metastasis in vitro, we evaluated cell migration by using wound healing assays in colorectal cancer cell lines. Due to the biological characteristics of HCT116 cells are not suitable for wound healing assay, we use SW480 and RKO cells in this experiment. Our results suggested that LL1 significantly blocked colorectal cancer cells to migrate through scratched area (Figure S4). In addition, we used transwell assay to conduct the invasion of cells. As shown in Figure 5e,f, the cell invasion was obviously inhibited by LL1. Finally, in order to evaluate the mechanism of LL1 on cell invasion and migration, we examined the levels of invasion markers. The expression of E‐cadherin was up‐regulated, and Vimentin and N‐cadherin were decreased following the treatment of LL1 (Figure 5g). To demonstrate the ability of LL1 to inhibit the metastasis of colorectal cancer cells in vivo, we constructed a model of tail vein metastasis in nude mice. HCT116 cells transfected with pGKV5 luciferase vector were introduced into the tail vein of immunodeficient mice. The mice receiving cells infected with pGKV5 luciferase vector were monitored by in vivo bioluminescence imaging (Figure 5h). We observed signals from the thoracic cavity during the first few days post injection, and the signals gradually became undetectable within a week, suggesting that the tumour cells are initially trapped in the capillary beds of the lungs and then disperse through the pulmonary capillaries into the systemic blood circulation. After 42 days, mice from the control group exhibited metastases in the lungs. In contrast, mice treated with LL1 had fewer cancer signals compared with mice from the control group. These data above demonstrated that LL1 might block cell metastasis through regulating the expression of epithelial–mesenchymal transition‐related proteins.

3.6. LL1 inhibits tumour growth in vivo

We examined the antitumour activity of LL1 in colorectal tumour genesis using two in vivo mouse models. In xenograft model, stattic, which is a classic STAT3 inhibitor, was used as a positive control. We administrated stattic or LL1 to mice at 5 mg·kg−1 once daily by oral gavage. The treatment of LL1 significantly reduced tumour burden in comparison to the negative and positive controls (Figure 6a). No significant changes in body weights or the gross anatomy of organs or obvious signs of toxicity, such as loss of appetite, decreased activity, or lethargy, were observed (Figure 6b,c). Furthermore, haematoxylin and eosin staining and oil red staining of the heart, liver, spleen, lung, and kidney demonstrated that LL1 had no damage of the major organs (Figures S5 and S6). These in vivo properties of LL1 demonstrated conceptually the therapeutic potential of this compound in cancer treatment. We previously showed that LL1 inhibited p‐STAT3 level and induced Bcl‐2‐mediated apoptosis. To determine whether these biological effects induced by LL1 also worked in vivo, we analysed the xenograft tumours harvested from mice treated by LL1 or vehicle. The results showed that p‐STAT3, Bcl‐2, and c‐myc expressions were decreased (Figure 6d,e). Both the in vitro and in vivo results indicated LL1 as a safe, selective STAT3 inhibitor. In order to estimate the safety profile of LL1 in vivo, we experimented with an acute toxicity test. All mice were vital and lively even when treated at the highest dose (1,000 mg·kg−1), and thus, the median lethal dose (LD50) could not be obtained (Table 1). Moreover, no obvious toxicity was found in the organs of all mice involved in the acute toxicity test (Figure 6f). In conclusion, our results indicate that LL1 significantly reduces tumour growth and could represent a promising strategy for colorectal cancer.

Figure 6.

Figure 6

LL1 inhibits tumour growth in vivo. (a and b) Volume of xenograft tumours and body weight of nude mice following implantation and LL1 treatments. Data are mean ± SD, n = 6 mice each. *P value <.05 compared with the control group. (c) Weight of final dissected xenograft tumour mass and organs. Data are mean ± SD, n = 6. *P value <.05 compared with the control group. (d) Left: Western blotting analysis of p‐STAT3, c‐myc, and Bcl‐2 in tumour after LL1 treatment (0 and 5 mg·kg−1) for 21 days. An anti‐β‐actin antibody was used to check the proper protein loading. Right: Analysis of WB results in (d). Protein levels were quantified using grey value analyses by ImageJ software. Data are mean ± SD, n = 5. *P value <.05 compared with cells control group. (e) Immunohistochemistry staining of xenograft tumour tissues for the expression of p‐STAT3, n = 6. (f) Haematoxylin and eosin‐stained paraffin sections of lung, heart, spleen, kidney, and liver tissues of vehicle control and LL1‐treated mice in acute toxicity test, n = 10 mice each

Table 1.

The mortality of ICR mice following the treatment of LL1 (n = 10)

Concentration (mg·kg−1) Mortality (%) Time (days)
0 0 14
5 0 14
50 0 14
500 0 14
1,000 0 14

4. DISCUSSION

Constitutive STAT3 activation in human tumours was reported to drive unscheduled gene transcription which could promote tumour development and progression (Dai et al., 2015; Lee, Kim, Sethi, & Ahn, 2015; Mohan et al., 2014). STAT3 represents a promising molecular target for anticancer therapeutics, and there is an immense need to design and develop a novel STAT3 inhibitor which is safe and potent. Several naturally occurring compounds have anti‐STAT3 activity, such as https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=7000, https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=2486, and https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=2745 (Bhutani et al., 2007; Hahn et al., 2018; Kim et al., 2008). However, most of these inhibitors show modest potency and low selectivity, and this is why the majority of STAT3 inhibitors are difficult to rule out off‐target effects and pinpoint (Schust, Sperl, Hollis, Mayer, & Berg, 2006; Song, Wang, Wang, & Lin, 2005). In this study, we have demonstrated that the novel small‐molecule STAT3 inhibitor, LL1, is very promising candidate for the treatment of colorectal cancer. LL1 was designed as a non‐peptide cell permeable inhibitor using computational structure‐based drug design approach. Similar with other compounds, LL1 shows definable toxicity towards colorectal cancer cell proliferation, inducing cell apoptosis and suppressing invasion and migration. But unlike the others, it shows highly selective toxicity towards STAT3 together with excellent water solubility, oral bio‐availability, and safety. Moreover, LL1 decreased tumour burden in colorectal cancer xenografts in vivo, being well tolerated.

The STAT3 SH2 domain was recognized as a druggable target, due to its crucial role both in tyrosine residues interaction and STAT3 dimerization (Zhang et al., 2010). We identified that LL1 directly bound to STAT3 protein, which was confirmed by MST. This process would disrupt STAT3–STAT3 dimer formation and block STAT3 phosphorylation (Figure 7). The inhibition of STAT3 activity was also supported by the luciferase assay (inhibition of STAT3 transcription), confocal (suppression of STAT3 nuclear translocation), and ESMA data (abrogation of STAT3 DNA binding activity). Moreover, LL1 selectively inhibits the phosphorylation of STAT3 and almost has no effect on p‐STAT1 and p‐STAT5 at a relative low concentration, in colorectal cancer cells.

Figure 7.

Figure 7

Schematic diagram to describe the action of LL1. JAK proteins binding to IL‐6 receptor subunit‐β (gp130) induces JAK‐mediated phosphorylation of gp130 at several tyrosine residues, including four C‐terminal residues that serve as docking sites for STAT3. Once bound to gp130, STAT3 is phosphorylated by JAKs at tyrosine 705, leading to STAT3 dimerization and nuclear translocation, followed by STAT3‐mediated transcription of target genes. In the process, LL1 binds to the SH2 domain of STAT3, and this leads to losing the recognition function of STAT3, blocking STAT3 dimerization and signal transduction

Previous studies of STAT3 inhibitors in tumourigenesis have suggested that the STAT3 inhibitor has the ability to modulate multiple intracellular pathways involved in cellular proliferation, apoptosis, and migration (Chen et al., 2008). Current study from our lab further confirmed that the cytotoxicity of LL1 in colorectal cancer cell lines was positively correlated with the expression of p‐STAT3, and the canonical target genes of STAT3 were down‐regulated by LL1. The identified downstream genes of STAT3 include Bcl‐2, c‐myc, cyclin D1, and survivin. Our data suggested that LL1 could induce cell growth inhibition and apoptosis via Bcl‐2, related to the mitochondria apoptotic signalling pathways in colorectal cancer. We tried the forced down‐regulation of STAT3 in colorectal cancer cells to examine whether it is able to reduce LL1‐mediated antitumour activity. Knockdown results confirmed that STAT3 is important for the viability of colorectal cancer cells, and LL1 share the same downstream regulated genes with STAT3 siRNA. Furthermore, silenced STAT3 reduced the antitumour effect of LL1 on colorectal cancer cells. Nonetheless, consistent with peer studies, the inhibition of STAT3 in cancer cells could also increase ROS levels, thereby inducing cell apoptosis (Du et al., 2012; Mantel et al., 2012).

In addition, we found that LL1 inhibits the invasion and migration through regulating the expression of E‐cadherin, N‐cadherin, and vimentin. Nude mouse transplanted tumour model confirmed the antitumour effect of LL1 in vivo. Accumulating evidence indicates that inflated levels of STAT3 associate with a poor prognosis in colorectal cancer (Morikawa et al., 2011). Although various inhibitors targeting STAT3 have been developed, only one STAT3 inhibitor (BBI608) is currently in Phase III clinic trials approved by the FDA (MacDonagh et al., 2018). According to our preliminary study, LL1 demonstrated the characteristics of high selectivity and comparable efficacy compared with BBI608. More than that, good water solubility of LL1 improved its druggability. In this respect, LL1 may be a promising therapeutic drug candidate for colorectal cancer through inhibiting STAT3 signalling pathway.

AUTHOR CONTRIBUTIONS

M.L., W.Y., and Z.L. designed the experiments. Z.L. performed the experiments, analysed the data, and wrote the manuscript. H.W. and L.G. aided in the construction of tumour transplantation model. M.L., W.Y., and C.L. revised the manuscript.

CONFLICT OF INTEREST

The authors declare no competing interests.

All experiments were approved by the Ethics Committee of China Pharmaceutical University.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14207, https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14208, and https://bpspubs.onlinelibrary.wiley.com/doi/abs/10.1111/bph.14206, and as recommended by funding agencies, publishers and other organizations engaged with supporting research.

Supporting information

Figure S1. Mitochondrial membrane potential was monitored using JC‐1 and then detected by flow cytometry after treatment of SW480 and HCT116 cells with LL1 (2 μM and 4 μM) for 24 h, n=5.

Figure S2. ROS production was monitored using 10 μM DCFH‐DA and then detected by flow cytometry after treatment of SW480 and HCT116 cells with LL1 (2 μM, 4 μM, and 8 μM) for 6 h, n=5.

Figure S3. SW480 and HCT116 cells were seeded in 96‐well plates, incubated overnight, and treated with 0, 0.5, 1, 2, 4, 8, 16 μM LL1 after preincubating with NAC for 30 min. Results represent mean values of three experiments ± SD, *P value < 0.05, **P value < 0.01 compared with cells conditioned‐medium treated group. n=5.

Figure S4. LL1 inhibited the migration of SW480 and RKO cells. Wound healing assay for migration was carried out by scratching the cells with yellow tip when cells grew into monolayer. Then, cells were incubated with the medium with or without LL1 (1 μM and 2 μM) and allowed to migrate into the scratched area for 48 h, n=5.

Figure S5. H&E staining of lung, heart, spleen, kidney and liver tissues of vehicle control and LL1‐treated nude mice, n=6.

Figure S6. Oil red O staining of lung, heart, spleen, kidney and liver tissues of vehicle control and LL1‐treated nude mice, n=6.

ACKNOWLEDGEMENTS

This research was supported by Science Technology Department of Zhejiang Province (2016C33065, C.L.), Jiangsu “Shuang Chuang” Team (2014, M.L.), and National Natural Science Foundation of China (81673298, W.Y.).

Liu Z, Wang H, Guan L, Lai C, Yu W, Lai M. LL1, a novel and highly selective STAT3 inhibitor, displays anti‐colorectal cancer activities in vitro and in vivo . Br J Pharmacol. 2020;177:298–313. 10.1111/bph.14863

Zhe Liu and Huan Wang contributed equally to this work.

Contributor Information

Wenying Yu, Email: ywy@cpu.edu.cn.

Maode Lai, Email: lmd@cpu.edu.cn.

REFERENCES

  1. Alexander, S. P. H. , Fabbro, D. , Kelly, E. , Marrion, N. V. , Peters, J. A. , Faccenda, E. , … CGTP Collaborators (2017). The Concise Guide to PHARMACOLOGY 2017/18: Enzymes. British Journal of Pharmacology, 174, S272–S359. 10.1111/bph.13877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bhutani, M. , Pathak, A. K. , Nair, A. S. , Kunnumakkara, A. B. , Guha, S. , Sethi, G. , & Aggarwal, B. B. (2007). Capsaicin is a novel blocker of constitutive and interleukin‐6‐inducible STAT3 activation. Clinical Cancer Research, 13, 3024–3032. 10.1158/1078-0432.CCR-06-2575 [DOI] [PubMed] [Google Scholar]
  3. Brenner, H. , Kloor, M. , & Pox, C. P. (2014). Colorectal cancer. Lancet, 383, 1490–1502. 10.1016/S0140-6736(13)61649-9 [DOI] [PubMed] [Google Scholar]
  4. Bromberg, J. , & Darnell, J. E. Jr. (2000). The role of STATs in transcriptional control and their impact on cellular function. Oncogene, 19, 2468–2473. 10.1038/sj.onc.1203476 [DOI] [PubMed] [Google Scholar]
  5. Buettner, R. , Mora, L. B. , & Jove, R. (2002). Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clinical Cancer Research, 8, 945–954. [PubMed] [Google Scholar]
  6. Catlett‐Falcone, R. , Landowski, T. H. , Oshiro, M. M. , Turkson, J. , Levitzki, A. , Savino, R. , … Jove, R. (1999). Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity, 10, 105–115. 10.1016/S1074-7613(00)80011-4 [DOI] [PubMed] [Google Scholar]
  7. Chen, C. L. , Cen, L. , Kohout, J. , Hutzen, B. , Chan, C. , Hsieh, F. C. , … Lin, J. (2008). Signal transducer and activator of transcription 3 activation is associated with bladder cancer cell growth and survival. Molecular Cancer, 7, 78 10.1186/1476-4598-7-78 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dai, X. , Ahn, K. S. , Kim, C. , Siveen, K. S. , Ong, T. H. , Shanmugam, M. K. , … Sethi, G. (2015). Ascochlorin, an isoprenoid antibiotic inhibits growth and invasion of hepatocellular carcinoma by targeting STAT3 signaling cascade through the induction of PIAS3. Molecular Oncology, 9, 818–833. 10.1016/j.molonc.2014.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Darnell, J. E. Jr. , Kerr, I. M. , & Stark, G. R. (1994). Jak‐STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science, 264, 1415–1421. 10.1126/science.8197455 [DOI] [PubMed] [Google Scholar]
  10. Du, W. , Hong, J. , Wang, Y. C. , Zhang, Y. J. , Wang, P. , Su, W. Y. , … Fang, J. Y. (2012). Inhibition of JAK2/STAT3 signalling induces colorectal cancer cell apoptosis via mitochondrial pathway. Journal of Cellular and Molecular Medicine, 16, 1878–1888. 10.1111/j.1582-4934.2011.01483.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Eyking, A. , Ey, B. , Runzi, M. , Roig, A. I. , Reis, H. , Schmid, K. W. , … Cario, E. (2011). Toll‐like receptor 4 variant D299G induces features of neoplastic progression in Caco‐2 intestinal cells and is associated with advanced human colon cancer. Gastroenterology, 141, 2154–2165. 10.1053/j.gastro.2011.08.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hahn, Y. I. , Kim, S. J. , Choi, B. Y. , Cho, K. C. , Bandu, R. , Kim, K. P. , … Surh, Y. J. (2018). Curcumin interacts directly with the Cysteine 259 residue of STAT3 and induces apoptosis in H‐Ras transformed human mammary epithelial cells. Scientific Reports, 8, 6409 10.1038/s41598-018-23840-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR (2018). The IUPHAR/BPS Guide to PHARMACOLOGY in 2018: Updates and expansion to encompass the new guide to immunopharmacology. Nucleic Acids Research, 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Haura, E. B. , Turkson, J. , & Jove, R. (2005). Mechanisms of disease: Insights into the emerging role of signal transducers and activators of transcription in cancer. Nature Clinical Practice. Oncology, 2, 315–324. 10.1038/ncponc0195 [DOI] [PubMed] [Google Scholar]
  15. Heinrich, P. C. , Behrmann, I. , Haan, S. , Hermanns, H. M. , Muller‐Newen, G. , & Schaper, F. (2003). Principles of interleukin (IL)‐6‐type cytokine signalling and its regulation. The Biochemical Journal, 374, 1–20. 10.1042/bj20030407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , & Altman, D. G. (2010). Animal research: Reporting in vivo experiments: The ARRIVE guidelines. British Journal of Pharmacology, 160, 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kim, E. S. , Hong, S. Y. , Lee, H. K. , Kim, S. W. , An, M. J. , Kim, T. I. , … Cheon, J. H. (2008). Guggulsterone inhibits angiogenesis by blocking STAT3 and VEGF expression in colon cancer cells. Oncology Reports, 20, 1321–1327. [PubMed] [Google Scholar]
  18. Kuipers, E. J. , Grady, W. M. , Lieberman, D. , Seufferlein, T. , Sung, J. J. , Boelens, P. G. , … Watanabe, T. (2015). Colorectal cancer. Nature Reviews. Disease Primers, 1, 15065 10.1038/nrdp.2015.65 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lee, J. H. , Kim, C. , Sethi, G. , & Ahn, K. S. (2015). Brassinin inhibits STAT3 signaling pathway through modulation of PIAS‐3 and SOCS‐3 expression and sensitizes human lung cancer xenograft in nude mice to paclitaxel. Oncotarget, 6, 6386–6405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Levy, D. E. , & Darnell, J. E. Jr. (2002). Stats: Transcriptional control and biological impact. Nature Reviews. Molecular Cell Biology, 3, 651–662. 10.1038/nrm909 [DOI] [PubMed] [Google Scholar]
  21. Levy, D. E. , & Lee, C. K. (2002). What does Stat3 do? The Journal of Clinical Investigation, 109, 1143–1148. 10.1172/JCI0215650 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. MacDonagh, L. , Gray, S. G. , Breen, E. , Cuffe, S. , Finn, S. P. , O'Byrne, K. J. , & Barr, M. P. (2018). BBI608 inhibits cancer stemness and reverses cisplatin resistance in NSCLC. Cancer Letters, 428, 117–126. 10.1016/j.canlet.2018.04.008 [DOI] [PubMed] [Google Scholar]
  23. Mantel, C. , Messina‐Graham, S. , Moh, A. , Cooper, S. , Hangoc, G. , Fu, X. Y. , & Broxmeyer, H. E. (2012). Mouse hematopoietic cell‐targeted STAT3 deletion: Stem/progenitor cell defects, mitochondrial dysfunction, ROS overproduction, and a rapid aging‐like phenotype. Blood, 120, 2589–2599. 10.1182/blood-2012-01-404004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mohan, C. D. , Bharathkumar, H. , Bulusu, K. C. , Pandey, V. , Rangappa, S. , Fuchs, J. E. , … Rangappa, K. S. (2014). Development of a novel azaspirane that targets the Janus kinase‐signal transducer and activator of transcription (STAT) pathway in hepatocellular carcinoma in vitro and in vivo. The Journal of Biological Chemistry, 289, 34296–34307. 10.1074/jbc.M114.601104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Morikawa, T. , Baba, Y. , Yamauchi, M. , Kuchiba, A. , Nosho, K. , Shima, K. , … Ogino, S. (2011). STAT3 expression, molecular features, inflammation patterns, and prognosis in a database of 724 colorectal cancers. Clinical Cancer Research, 17, 1452–1462. 10.1158/1078-0432.CCR-10-2694 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Notarangelo, T. , Sisinni, L. , Trino, S. , Calice, G. , Simeon, V. , & Landriscina, M. (2018). IL6/STAT3 axis mediates resistance to BRAF inhibitors in thyroid carcinoma cells. Cancer Letters, 433, 147–155. 10.1016/j.canlet.2018.06.038 [DOI] [PubMed] [Google Scholar]
  27. Park, J. H. , van Wyk, H. , McMillan, D. C. , Quinn, J. , Clark, J. , Roxburgh, C. S. , … Edwards, J. (2017). Signal transduction and activator of transcription‐3 (STAT3) in patients with colorectal cancer: Associations with the phenotypic features of the tumor and host. Clinical Cancer Research, 23, 1698–1709. 10.1158/1078-0432.CCR-16-1416 [DOI] [PubMed] [Google Scholar]
  28. Park, J. S. , Kwok, S. K. , Lim, M. A. , Kim, E. K. , Ryu, J. G. , Kim, S. M. , … Cho, M. L. (2014). STA‐21, a promising STAT‐3 inhibitor that reciprocally regulates Th17 and Treg cells, inhibits osteoclastogenesis in mice and humans and alleviates autoimmune inflammation in an experimental model of rheumatoid arthritis. Arthritis & Rhematology, 66, 918–929. 10.1002/art.38305 [DOI] [PubMed] [Google Scholar]
  29. Piranlioglu, R. , Lee, E. , Ouzounova, M. , Bollag, R. J. , Vinyard, A. H. , Arbab, A. S. , … Korkaya, H. (2019). Primary tumor‐induced immunity eradicates disseminated tumor cells in syngeneic mouse model. Nature Communications, 10, 1430 10.1038/s41467-019-09015-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Reich, N. C. , & Liu, L. (2006). Tracking STAT nuclear traffic. Nature Reviews. Immunology, 6, 602–612. 10.1038/nri1885 [DOI] [PubMed] [Google Scholar]
  31. Rokavec, M. , Oner, M. G. , Li, H. , Jackstadt, R. , Jiang, L. , Lodygin, D. , … Hermeking, H. (2014). IL‐6R/STAT3/miR‐34a feedback loop promotes EMT‐mediated colorectal cancer invasion and metastasis. The Journal of Clinical Investigation, 124, 1853–1867. 10.1172/JCI73531 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Schindler, C. , Levy, D. E. , & Decker, T. (2007). JAK‐STAT signaling: From interferons to cytokines. The Journal of Biological Chemistry, 282, 20059–20063. 10.1074/jbc.R700016200 [DOI] [PubMed] [Google Scholar]
  33. Schust, J. , Sperl, B. , Hollis, A. , Mayer, T. U. , & Berg, T. (2006). Stattic: A small‐molecule inhibitor of STAT3 activation and dimerization. Chemistry & Biology, 13, 1235–1242. 10.1016/j.chembiol.2006.09.018 [DOI] [PubMed] [Google Scholar]
  34. Scuto, A. , Kujawski, M. , Kowolik, C. , Krymskaya, L. , Wang, L. , Weiss, L. M. , … Jove, R. (2011). STAT3 inhibition is a therapeutic strategy for ABC‐like diffuse large B‐cell lymphoma. Cancer Research, 71, 3182–3188. 10.1158/0008-5472.CAN-10-2380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Siegel, R. L. , Miller, K. D. , & Jemal, A. (2017). Cancer statistics, 2017. CA: A Cancer Journal for Clinicians, 67, 7–30. 10.3322/caac.21387 [DOI] [PubMed] [Google Scholar]
  36. Song, H. , Wang, R. , Wang, S. , & Lin, J. (2005). A low‐molecular‐weight compound discovered through virtual database screening inhibits Stat3 function in breast cancer cells. Proceedings of the National Academy of Sciences of the United States of America, 102, 4700–4705. 10.1073/pnas.0409894102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Stark, G. R. , Kerr, I. M. , Williams, B. R. , Silverman, R. H. , & Schreiber, R. D. (1998). How cells respond to interferons. Annual Review of Biochemistry, 67, 227–264. 10.1146/annurev.biochem.67.1.227 [DOI] [PubMed] [Google Scholar]
  38. Suiqing, C. , Min, Z. , & Lirong, C. (2005). Overexpression of phosphorylated‐STAT3 correlated with the invasion and metastasis of cutaneous squamous cell carcinoma. The Journal of Dermatology, 32, 354–360. [DOI] [PubMed] [Google Scholar]
  39. Timofeeva, O. A. , Tarasova, N. I. , Zhang, X. , Chasovskikh, S. , Cheema, A. K. , Wang, H. , … Dritschilo, A. (2013). STAT3 suppresses transcription of proapoptotic genes in cancer cells with the involvement of its N‐terminal domain. Proceedings of the National Academy of Sciences of the United States of America, 110, 1267–1272. 10.1073/pnas.1211805110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yang, K. , Chen, Y. , Zhou, J. , Ma, L. , Shan, Y. , Cheng, X. , … Yin, W. (2019). Ursolic acid promotes apoptosis and mediates transcriptional suppression of CT45A2 gene expression in NSCLCs harboring EGFR T790M. British Journal of Pharmacology. 10.1111/bph.14793 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yu, H. , & Jove, R. (2004). The STATs of cancer—New molecular targets come of age. Nature Reviews. Cancer, 4, 97–105. 10.1038/nrc1275 [DOI] [PubMed] [Google Scholar]
  42. Yu, H. , Pardoll, D. , & Jove, R. (2009). STATs in cancer inflammation and immunity: A leading role for STAT3. Nature Reviews. Cancer, 9, 798–809. 10.1038/nrc2734 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Yu, W. , Li, C. , Zhang, W. , Xia, Y. , Li, S. , Lin, J. Y. , … Kong, L. (2017). Discovery of an orally selective inhibitor of signal transducer and activator of transcription 3 using advanced multiple ligand simultaneous docking. Journal of Medicinal Chemistry, 60, 2718–2731. 10.1021/acs.jmedchem.6b01489 [DOI] [PubMed] [Google Scholar]
  44. Zhang, X. , Yue, P. , Fletcher, S. , Zhao, W. , Gunning, P. T. , & Turkson, J. (2010). A novel small‐molecule disrupts Stat3 SH2 domain‐phosphotyrosine interactions and Stat3‐dependent tumor processes. Biochemical Pharmacology, 79, 1398–1409. 10.1016/j.bcp.2010.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Zhang, X. , Yue, P. , Page, B. D. , Li, T. , Zhao, W. , Namanja, A. T. , … Turkson, J. (2012). Orally bioavailable small‐molecule inhibitor of transcription factor Stat3 regresses human breast and lung cancer xenografts. Proceedings of the National Academy of Sciences of the United States of America, 109, 9623–9628. 10.1073/pnas.1121606109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhong, Z. , Wen, Z. , & Darnell, J. E. Jr. (1994). Stat3: A STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin‐6. Science, 264, 95–98. 10.1126/science.8140422 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. Mitochondrial membrane potential was monitored using JC‐1 and then detected by flow cytometry after treatment of SW480 and HCT116 cells with LL1 (2 μM and 4 μM) for 24 h, n=5.

Figure S2. ROS production was monitored using 10 μM DCFH‐DA and then detected by flow cytometry after treatment of SW480 and HCT116 cells with LL1 (2 μM, 4 μM, and 8 μM) for 6 h, n=5.

Figure S3. SW480 and HCT116 cells were seeded in 96‐well plates, incubated overnight, and treated with 0, 0.5, 1, 2, 4, 8, 16 μM LL1 after preincubating with NAC for 30 min. Results represent mean values of three experiments ± SD, *P value < 0.05, **P value < 0.01 compared with cells conditioned‐medium treated group. n=5.

Figure S4. LL1 inhibited the migration of SW480 and RKO cells. Wound healing assay for migration was carried out by scratching the cells with yellow tip when cells grew into monolayer. Then, cells were incubated with the medium with or without LL1 (1 μM and 2 μM) and allowed to migrate into the scratched area for 48 h, n=5.

Figure S5. H&E staining of lung, heart, spleen, kidney and liver tissues of vehicle control and LL1‐treated nude mice, n=6.

Figure S6. Oil red O staining of lung, heart, spleen, kidney and liver tissues of vehicle control and LL1‐treated nude mice, n=6.


Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES