Enhanced FGF23 production in mice expressing PI3K-insensitive GSK3 is normalized by β-blocker treatment

Abstract

Glycogen synthase kinase (GSK)-3 is a ubiquitously expressed kinase inhibited by insulin-dependent Akt/PKB/SGK. Mice expressing Akt/PKB/SGK-resistant GSK3α/GSK3β (gsk3^KI) exhibit enhanced sympathetic nervous activity and phosphaturia with decreased bone density. Hormones participating in phosphate homeostasis include fibroblast growth factor (FGF)-23, a bone-derived hormone that inhibits 1,25-dihydroxyvitamin D₃ (1,25(OH)₂D₃; calcitriol) formation and phosphate reabsorption in the kidney and counteracts vascular calcification and aging. FGF23 secretion is stimulated by the sympathetic nervous system. We studied the role of GSK3-controlled sympathetic activity in FGF23 production and phosphate metabolism. Serum FGF23, 1,25(OH)₂D₃, and urinary vanillylmandelic acid (VMA) were measured by ELISA, and serum and urinary phosphate and calcium were measured by photometry in gsk3^KI and gsk3^WT mice, before and after 1 wk of oral treatment with the β-blocker propranolol. Urinary VMA excretion, serum FGF23, and renal phosphate and calcium excretion were significantly higher, and serum 1,25(OH)₂D₃ and phosphate concentrations were lower in gsk3^KI mice than in gsk3^WT mice. Propranolol treatment decreased serum FGF23 and loss of renal calcium and phosphate and increased serum phosphate concentration in gsk3^KI mice. We conclude that Akt/PKB/SGK-sensitive GSK3 inhibition participates in the regulation of FGF23 release, 1,25(OH)₂D₃ formation, and thus mineral metabolism, by controlling the activity of the sympathetic nervous system.—Fajol, A., Chen, H., Umbach, A. T., Quarles, L. D., Lang, F., Föller, M. Enhanced FGF23 production in mice expressing PI3K-insensitive GSK3 is normalized by β-blocker treatment.

Insulin mainly regulates glucose homeostasis, but also affects renal phosphate handling (1, 2). Cellular insulin’s effects are in large part mediated by activation of PI3K resulting in the stimulation of Akt/PKB and serum- and glucocorticoid-inducible kinase (SGK) isoforms (3, 4). Upon activation, Akt/PKB (5) and SGK (6, 7) isoforms can phosphorylate numerous cellular targets, including glycogen synthase kinase (GSK)-3, thereby rendering this kinase inactive. Loss of Akt2 or of SGK3 activity in mouse models results in decreased renal phosphate reabsorption and, hence, phosphate loss (8, 9). Moreover, transgenic mice expressing Akt/PKB/SGK-resistant GSK3α/β [gsk-3 knockin (gsk-3^KI)] have hypophosphatemia, phosphaturia, and decreased bone density, illustrating the significance of PI3K signaling for renal phosphate handling (10). A direct inhibitory effect of GSK3 on renal sodium-dependent phosphate transporter IIa (NaPiIIa) (10) is likely to contribute to the phosphaturia of gsk-3^KI mice, but may not fully explain it. Gsk-3^KI mice also have hypertension and a faster heart rate caused by enhanced sympathetic activity (11).

Fibroblast growth factor (FGF)-23 is a bone-derived hormone that controls phosphate and calcium metabolism (12–14). Its main target is the kidney, where FGF23 inhibits tubular phosphate but fosters tubular calcium reabsorption (14–21). Renal expression of FGF23 is observed in polycystic kidneys (22). Moreover, FGF23 has been shown to inhibit renal 25-hydroxyvitamin D 1α-hydroxylase (Cyp27b1) and to stimulate 25-hydroxyvitamin D 24-hydroxylase (Cyp24a1) thereby suppressing the formation and favoring the catabolism of the biologically active form of vitamin D, 1,25-dihydroxyvitamin D₃ (1,25(OH)₂D₃; calcitriol) (20, 23–25). Therefore, FGF23 lowers the plasma level of both 1,25(OH)₂D₃ and phosphate.

FGF23 requires αKlotho as a coreceptor to mediate its renal effects (26, 27). In contrast, FGF23 induces hypertrophy of the left ventricle without αKlotho (28, 29). FGF23- or αKlotho-deficient mouse models exhibit rapid aging and age-related diseases that replicate human aging (24, 27). In humans, a high FGF23 plasma level can be caused by FGF23-producing tumors and result in osteomalacia (30). Inactivating mutations in the SIBLING (small integrin-binding ligand, N-linked glycoprotein) dentin matrix protein (Dmp1) gene [autosomal dominant hypophosphatemic rickets (ADHR)] or the endopeptidase PHEX gene [X-linked hypophosphatemia (XLH)] result in excessive FGF23 formation by osteoblasts/osteocytes and subsequent phosphaturia, hypophosphatemia, and low serum level of 1,25(OH)₂D₃ (25, 31–35).

The regulation of FGF23 production in the bone is only partly understood. 1,25(OH)₂D₃ enhances FGF23 expression via activation of the vitamin D receptor (VDR) (36, 37). Parathyroid hormone (PTH) also stimulates FGF23 release (38–40). Dietary interventions affect FGF23, in that increased phosphorus uptake moderately enhances FGF23 secretion, whereas a low-phosphate diet decreases FGF23 serum concentration (41–43). Iron appears to be another regulator; however, its exact role has remained ill defined (44–48). It has been shown recently that the autonomous nervous system is also involved in the regulation of FGF23 formation, as sympathetic activation triggers FGF23 expression (49).

In this study, we explored whether GSK3 is involved in the regulation of FGF23 synthesis by investigating FGF23 formation in gsk-3^KI and gsk-3^WT (WT; wild-type) mice. Moreover, we studied the underlying mechanism.

MATERIALS AND METHODS

Mice

All animal experiments were conducted according to the German law for the welfare of animals and were approved by the authorities of the state of Baden–Württemberg. We used gene-targeted mice carrying a mutant GSK3α,β, in which the codon encoding Ser⁹ of GSK3β gene was changed to encode nonphosphorylable alanine (GSK3β^9A/9A), and the codon encoding Ser²¹ of GSK3α was changed simultaneously to encode the nonphosphorylable GSK3α^21A/21A, thus yielding the GSK3α/β^{21A/21A/9A/9A} double-knockin mouse (gsk3^KI) (50). The mice were compared to age- and sex-matched WT mice (gsk3^WT). The mice were studied at the age of 2–5 mo and had free access to water and standard chow (Ssniff, Soest, Germany). Where indicated, the mice were treated with the β-blocker propranolol (500 mg/L in drinking water; Sigma-Aldrich, Schnelldorf, Germany) for 1 wk.

Serum and plasma parameters

With the mice under light anesthesia, blood was collected from the retro-orbital plexus into heparinized or EDTA-coated (in case of PTH analysis) capillaries on the day before the mice were placed in metabolic cages and on the last day of propranolol treatment. The following parameters were determined in serum or plasma. Intact FGF23 was measured with an ELISA kit from Kainos Laboratories (Tokyo, Japan), C-terminal FGF23 and PTH (1–84) by ELISAs from Immutopics (San Clemente, CA, USA), and 1,25(OH)₂D₃ by an ELISA from IDS (Frankfurt am Main, Germany). Inorganic phosphate was measured by a photometric method (Roche, Mannheim, Germany) and total calcium by flame photometry. Serum creatinine was assessed by enzymatic colorimetry (Labor & Technik, Berlin, Germany).

Urinary parameters

To obtain 24 h urine, the mice were placed in metabolic cages (Tecniplast, Hohenpeissenberg, Germany) individually and allowed to adapt to the new environment on the first 2 d. Then, 24 h urine was collected on the following 3 d in siliconized metabolic cages under water-saturated oil. The mice were again housed in metabolic cages from d 2–5 of propranolol treatment. The following urinary parameters were determined: phosphate by a photometric method (Roche), calcium by flame photometry, epinephrine by ELISA (Labor Diagnostika Nord, Nordhorn, Germany), and vanillylmandelic acid (VMA) by ELISA (IBL, Frankfurt, Germany) in acidified urine. Urinary creatinine was assessed by the Jaffé method (Labor & Technik). All measurements were performed according to the manual provided by the manufacturer.

Renal Klotho abundance

Anesthetized mice were euthanized, and the kidneys were removed and immediately shock frozen in liquid nitrogen. The kidneys were then lysed in lysis buffer [54.6 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 2.69 mM Na₄P₂O₇, 360 mM NaCl, 10% (vol/vol) glycerol, and 1% (vol/vol) Nonidet P-40] or RIPA lysis buffer (Cell Signaling Technology, Frankfurt, Germany), containing phosphatase and a protease inhibitor cocktail tablet (Complete mini; Roche), and the samples were incubated on ice for 30 min and then centrifuged at 14,000 rpm and 4°C for 20 min. The supernatant was removed and used for Western blot analysis. Tissue lysate (40 µg) was separated by SDS-PAGE, transferred to PVDF membranes, and blocked in 5% nonfat milk with Tris-buffered saline-Tween-20 (TBST) at room temperature for 1 h. After the membrane was probed overnight at 4°C with polyclonal rat anti-Klotho antibody (1:1000 in 5% fat-free milk in TBST; kindly provided by A. Saito, Kyowa Hakko Kirin Co., Ltd., Japan), it was washed several times and again incubated with horseradish peroxidase–conjugated anti-rat secondary antibody (1:2000; Cell Signaling Technology) for 1 h at room temperature. The membrane was washed again, and the bands were visualized with ECL reagent (GE Healthcare-Amersham, Freiburg, Germany). For a loading control, the membrane was probed with GAPDH antibody (1:2000 in 5% bovine serum albumin in TBST; Cell Signaling Technology). Densitometric analysis was performed with Quantity One software (Bio-Rad, München, Germany).

Blood pressure

Mean arterial blood pressure was determined with a noninvasive tail cuff system (IITC Life Science, Woodlands Hills, CA, USA). Several days of readings were averaged to obtain the systolic blood pressure for the respective mouse. All recordings and data analyses were obtained with a computerized data-acquisition system and software (PowerLab 4/26 and chart5; ADInstruments, Colorado Springs, CO, USA).

Cell culture

UMR106 rat osteosarcoma cells were cultured in high-glucose DMEM supplemented with 10% fetal calf serum and 1% penicillin-streptomycin in standard culture conditions. The cells were treated with 100 nM 1,25(OH)₂D₃ (Sigma-Aldrich) with or without 150 µM propranolol (Sigma-Aldrich) overnight. Total RNA was isolated from the cells with Trifast reagent (Peqlab, Erlangen, Germany) according to the manufacturer’s instructions. Reverse transcription of 2 µg RNA was performed with a random hexamer and SuperScriptIII Reverse Transcriptase (Thermo Scientific-Invitrogen, Darmstadt, Germany) and the cDNA samples were treated with RnaseH (Thermo Scientific-Invitrogen).

qRT-PCR

For qRT-PCR analysis, the final volume of the RT-PCR reaction mixture was 20 µl and contained 2 µl cDNA, 1 µM of each primer, 10 µl GoTaq Green Master Mix (Promega, Mannheim, Germany), and sterile water up to 20 µl. PCR conditions were 95°C for 3 min, followed by 40 cycles of 95°C for 10 s, 58°C for 30 s, and 72°C for 45 s. qRT-PCR was performed on a BioRad iCycler iQTM Real-Time PCR Detection System (Bio-Rad).

The following primers were used: rat Tbp (TATA box-binding protein), forward (5′–3′), ACTCCTGCCACACCAGCC, reverse (5′–3′), GGTCAAGTTTACAGCCAAGATTCA; and rat Fgf23, forward (5′–3′), TGGCCATGTAGACGGAACAC, reverse (5′–3′), GGCCCCTATTATCACTACGGAG. Calculated mRNA expression levels were normalized to the expression levels of Tbp of the same cDNA sample as internal reference. All PCRs were performed in duplicate. Relative quantification of gene expression was performed by the ΔΔC_t method.

Statistics

Data are provided as means ± sem, with n indicating the number of independent experiments. All data were tested for significance with Student’s t test. Only results reaching P < 0.05 were considered statistically significant.

RESULTS

Gsk-3^KI mice have been reported to have low serum phosphate (hypophosphatemia) and 1,25(OH)₂D₃ levels and loss of renal phosphate (phosphaturia) (10). The bone-derived hormone FGF23 induces all those effects. We therefore determined the serum C-terminal and intact FGF23 concentration. The serum concentration of C-terminal FGF23 was significantly (P < 0.05) higher in gsk-3^KI mice (967 ± 229 pg/ml; n = 5) than in gsk-3^WT mice (341 ± 37 pg/ml; n = 5). Also, the serum level of intact FGF23 was significantly (P < 0.01) higher in gsk-3^KI mice (119 ± 21 pg/ml; n = 6) than in gsk-3^WT mice (89 ± 8 pg/ml; n = 6).

The renal effects of FGF23 are mediated by a receptor that requires αKlotho as a coreceptor (26, 27). As has been shown in Klotho-deficient mice, insufficient renal expression of αKlotho is associated with a high serum concentration of FGF23 (51). We therefore analyzed renal αKlotho expression by Western blot analysis. However, we did not find a difference in αKlotho expression between the genotypes (Fig. 1). Hence, altered αKlotho expression is not relevant to the elevated serum FGF23 level in gsk-3^KI mice.

Figure 1.

Renal αKlotho expression is similar in gsk-3^KI and gsk-3^WT mice. A) Original Western blot demonstrating renal Klotho and GAPDH abundance. B) Densitometric analysis of the Western blot from (A). Data are arithmetic means ± sem (n = 6).

In an earlier study, the β-receptor agonist isoproterenol was shown to induce Fgf23 transcription in UMR106 osteoblast-like cells, suggesting that sympathetic activation is a known trigger of FGF23 release (49). Sympathetic activation can be estimated from the renal excretion of epinephrine, a major neurotransmitter of the sympathetic nervous system. The main metabolite of epinephrine is VMA. Urinary VMA is therefore another indicator of sympathetic activation. In line with another study (11), we found a significantly higher level of urinary epinephrine (Fig. 2A) and VMA excretion (Fig. 2B) in gsk-3^KI mice than in gsk-3^WT mice, pointing to enhanced activity of the sympathetic nervous system in gsk-3^KI mice. As a consequence of the enhanced sympathetic activity, blood pressure was significantly higher (P < 0.001) in gsk-3^KI mice (106 ± 2 mm Hg; n = 12) than in gsk-3^WT mice (93 ± 2 mm Hg; n = 12). Treatment with propranolol abrogated the difference between the genotypes (gsk-3^KI mice: 83 ± 2 mm Hg, n = 12; gsk-3^WT mice: 84 ± 3 mm Hg, n = 12). As blood pressure may affect the glomerular filtration rate (GFR) of the kidney, we determined creatinine clearance as a measure of GFR. Before propranolol treatment, GFR was significantly higher (P < 0.05) in gsk-3^KI mice [8.4 ± 1.6 µl/min/g body weight (bw), n = 19] than in gsk-3^WT mice (3.8 ± 0.5 µl/min/g bw; n = 19). Propranolol again abrogated the difference between the genotypes (gsk-3^KI mice: 5.7 ± 0.7 µl/min/g bw, n = 19; gsk-3^WT mice: 4.4 ± 0.7 µl/min/g bw, n = 19).

Figure 2.

Urinary excretion of epinephrine and VMA is enhanced in gsk-3^KI mice vs. gsk-3^WT mice. Data are arithmetic means ± sem (n = 7) of urinary 24 h epinephrine (A) and 24 h-VMA (B) excretion of gsk-3^WT and gsk-3^KI mice. *P < 0.05, **P < 0.01.

Next, we explored whether sympathetic activation accounts for enhanced FGF23 production and contributes to the phosphaturia in gsk-3^KI mice. To this end, we treated gsk-3^KI mice and gsk-3^WT mice with propranolol for 1 wk. Before treatment, the serum FGF23 concentration was significantly higher in gsk-3^KI mice than in gsk-3^WT mice (Fig. 3A). Propranolol significantly reduced the elevated serum C-terminal FGF23 level, and, to a lesser extent, the intact FGF23 serum concentration (Fig. 3B) in gsk-3^KI mice and abrogated the difference in serum FGF23 levels between the genotypes (Fig. 3A, B).

Figure 3.

Propranolol decreases the serum FGF23 level in gsk-3^KI mice. (A–D) Serum C-terminal FGF23 (A; n = 20), intact FGF23 (B; n = 12), 1,25(OH)₂D₃ (C; n = 11–12), and PTH (D; n = 12) concentrations in gsk-3^WT and gsk-3^KI mice determined before and after 1 wk of treatment with propranolol. Data are arithmetic means ± sem. *P < 0.05, ***P < 0.001, significant difference between the genotypes; ^##P < 0.01, significant difference vs. no propranolol.

As a next step, we exposed UMR106 cells to propranolol to test whether β-blockade directly interferes with Fgf23 transcription in osteoblast-like cells. As a result, a 14 h incubation with 150 µM propranolol significantly (P < 0.05) down-regulated Fgf23 transcripts to 0.0021 ± 0.0001 arbitrary units (AU) (n = 15) compared to control cells (0.0027 ± 0.0002 AU; n = 15). Thus, propranolol inhibits FGF23 formation in vivo and in vitro.

As FGF23 suppresses the key enzyme for the generation of 1,25(OH)₂D₃ in the kidney, 25-hydroxyvitamin D 1α-hydroxylase, we also measured serum 1,25(OH)₂D₃ in gsk-3^WT and gsk-3^KI mice. The high serum FGF23 was paralleled by low 1,25(OH)₂D₃ in gsk-3^KI mice, with or without propranolol (Fig. 3C). Another important regulator of 1,25(OH)₂D₃ is PTH. In line with low serum 1,25(OH)₂D₃, the serum PTH level was significantly reduced in gsk-3^KI mice compared with the level in gsk-3^WT mice (Fig. 3D).

A high serum level of FGF23 is expected to induce phosphaturia, an effect already described in gsk-3^KI mice (10). Therefore, we measured serum phosphate and renal phosphate excretion before and after treatment with propranolol. In line with the earlier report, we found a low serum phosphate concentration (hypophosphatemia) in gsk-3^KI mice before treatment with propranolol (Fig. 4A). Despite hypophosphatemia, gsk-3^KI mice had significantly higher renal phosphate excretion than did gsk-3^WT mice (Fig. 4B). Treatment with propranolol significantly ameliorated the hypophosphatemia of gsk-3^KI mice (Fig. 4A) and reduced their phosphaturia (Fig. 4B). We noted that β-blocker treatment also increased the serum phosphate level and decreased renal phosphate loss in gsk-3^WT mice.

Figure 4.

Propranolol lowers the renal phosphate loss in gsk-3^KI mice. Serum phosphate concentration (A; n = 19) and renal phosphate excretion (B; n = 19) in gsk-3^WT and gsk-3^KI mice determined before and after 1 wk of treatment with propranolol. Data are arithmetic means ± sem. *P < 0.05, **P < 0.01, gsk-3^KI mice vs. gsk-3^WT mice; ^#P < 0.05, ^###P < 0.001, vs. no propranolol.

As reported earlier, gsk-3^KI mice also have calciuria. We therefore studied whether propranolol influences the serum level and renal handling of calcium. Before treatment, gsk-3^KI mice did not differ from gsk-3^WT mice in serum calcium concentration (Fig. 5A), but had higher renal calcium excretion (Fig. 5B). Treatment with propranolol did not affect the serum calcium level but moderately blunted the calciuria in gsk-3^KI mice.

Figure 5.

Propranolol lowers the renal calcium loss in gsk-3^KI mice. Serum calcium concentration (A; n = 16–17) and renal calcium excretion (B; n = 19) in gsk-3^WT and gsk-3^KI mice determined before and after 1 wk of treatment with propranolol. Data are arithmetic means ± sem. *P < 0.05, gsk-3^KI mice vs. gsk-3^WT mice; ^#P < 0.05, vs. no propranolol.

DISCUSSION

Our study revealed that PKB/Akt/SGK-sensitive GSK3 influences the release of FGF23 by regulating the activity of the sympathetic nervous system.

We analyzed mice carrying a GSK3α/β mutation that renders the kinase insensitive to the inhibitory effect of PKB/Akt/SGK (gsk-3^KI mice). Although normal insulin action requires inactivation of GSK3 through a PI3K/PKB/Akt/SGK-dependent mechanism, gsk-3^KI mice are viable and do not have insulin resistance (50). However, gsk-3^KI mice have been shown to have phosphaturia, calciuria, and demineralized bone. These effects were in part attributed to a direct inhibitory effect of GSK3 on the main phosphate transporter of the kidney, NaPiIIa (10). Our present study suggests that the renal phosphate loss of gsk-3^KI mice is also caused by the high serum FGF23 level in these mice.

Commercially available ELISA kits allow measurement of either C-terminal plus full length (intact) FGF23 or intact FGF23 only. Inactive C-terminal FGF23 results from furin-dependent degradation of the biologically active intact FGF23 (52). In this study, we confirmed by using both types of FGF23 ELISA kit that the serum level of the active form of FGF23, intact FGF23, is indeed elevated in gsk-3^KI mice.

The renal effects of FGF23 depend on sufficient expression of αKlotho in the cell membrane (51), and deficiency of this protein is associated with a dramatically elevated serum concentration of FGF23, suggesting that αKlotho is a regulator of serum FGF23. The expression of renal αKlotho, however, was not different between the genotypes.

The activity of the sympathetic nervous system is higher in gsk-3^KI mice than in gsk-3^WT mice. Hence, gsk-3^KI mice have higher blood pressure and heart rate than do gsk-3^WT mice (11). In the present study, we confirmed enhanced sympathetic activation of gsk-3^KI mice by detecting significantly higher 24 h urinary excretion of epinephrine and of VMA, the main metabolite of epinephrine and norepinephrine. The hypertension of gsk-3^KI mice was indeed caused by higher sympathetic activity, as propranolol abrogated the difference in blood pressure between the genotypes. As sympathetic activation has been shown to induce FGF23 release, we sought to define the role of the higher sympathetic activity for enhanced FGF23 formation in gsk-3^KI mice. To this end, we treated gsk-3^KI and gsk-3^WT mice with the widely used β-blocker propranolol and analyzed the consequence for serum FGF23 and phosphate metabolism. As was obvious, enhanced sympathetic activation accounted for the excess FGF23 formation in gsk-3^KI mice to a large extent: a 1 wk propranolol treatment greatly reduced the FGF23 level in gsk-3^KI mice to the level in gsk-3^WT mice. In vitro, β-blocker treatment similarly reduced Fgf23 formation in osteoblast-like cells.

As a result, hypophosphatemia and phosphaturia of gsk-3^KI mice were also ameliorated by β-blocker treatment. This result emphasizes that the renal phosphate loss of gsk-3^KI mice was at least in part the direct consequence of the high serum FGF23 concentration. Treatment with propranolol did not affect the low serum 1,25(OH)₂D₃ level in gsk-3^KI mice, despite its profound effect on FGF23, 1 of the 2 main regulators of 1,25(OH)₂D₃ production. However, the other main regulator, PTH, which stimulates 1,25(OH)₂D₃ formation, was also low in gsk-3^KI mice and was not significantly affected by propranolol, an effect that presumably contributes to the low serum 1,25(OH)₂D₃ concentration. In addition, it is possible that GSK3 signaling directly affects vitamin D metabolism or VDR signaling. In another study, treatment of mice with the GSK3 inhibitor lithium elevated the serum FGF23 level while lowering the serum calcitriol concentration (53). More research is needed to study the putative direct effects of GSK3 on vitamin D metabolism.

In line with findings in another study (54), GFR was significantly higher in gsk-3^KI mice than in gsk-3^WT mice. The profound blood pressure–lowering effect of β-blocker treatment in gsk-3^KI mice was also associated with a lowering of GFR. Thus, the mild reduction of phosphaturia and calciuria in gsk-3^KI mice after propranolol treatment could, at least in part, be caused by the decrease in GFR.

β-Blockers such as propranolol are widely prescribed for the treatment of hypertension, heart failure, and atrial fibrillation (55–57). It is tempting to speculate that the FGF23-lowering effect of β-blockers observed in gsk-3^KI mice has an implication for millions of patients treated with β-blockers. These drugs clearly reduce the cardiovascular mortality of high-risk patients. In fact, a high FGF23 level correlates positively with cardiovascular mortality (28, 58, 59) and atrial fibrillation (60). Therefore, it appears possible that the benefit of β-blocker therapy is at least partially related to its ability to lower blood FGF23 concentration. Further studies are needed to test this hypothesis.

We conclude that PKB/Akt/SGK-sensitive GSK3 signaling controls the activity of the sympathetic nervous system, which is an important regulator of FGF23 production and phosphate metabolism. Hence, gsk-3^KI mice expressing PKB/Akt-insensitive GSK3 exhibit a high serum FGF23 level, phosphaturia, and hypophosphatemia, effects that are all reversed by treatment with the β-blocker propranolol.

Glossary

1,25(OH)₂D₃

1,25-dihydroxyvitamin D₃ (calcitriol)

AU

arbitrary units

bw

body weight

FGF

fibroblast growth factor

GFR

glomerular filtration rate

GSK

glycogen synthase kinase

KI

knockin

NaPiIIa

sodium-dependent phosphate transporter IIa

PTH

parathyroid hormone

qRT-PCR

quantitative RT-PCR

SGK

serum- and glucocorticoid-inducible kinase

Tbp

TATA box-binding protein

TBST

Tris-buffered saline–Tween-20

VDR

vitamin D receptor

VMA

vanillylmandelic acid

WT

wild-type