LysR-Type Transcriptional Regulator MetR Controls Prodigiosin Production, Methionine Biosynthesis, Cell Motility, H₂O₂ Tolerance, Heat Tolerance, and Exopolysaccharide Synthesis in Serratia marcescens

Serratia marcescens, a Gram-negative bacterium, is found in a wide range of ecological niches and can produce several secondary metabolites, including prodigiosin, althiomycin, and serratamolide. Among them, prodigiosin shows diverse functions as an immunosuppressant, antimicrobial, and anticancer agent. However, the regulatory mechanisms behind prodigiosin synthesis in S. marcescens are not completely understood. Here, we adapted a transposon mutant library to identify the genes related to prodigiosin synthesis, and the BVG90_22495 gene encoding the LysR-type regulator MetR was found to negatively regulate prodigiosin synthesis. The molecular mechanism of the metR mutant hyperproducing prodigiosin was investigated. Additionally, we provided evidence supporting new roles for MetR in regulating methionine biosynthesis, cell motility, heat tolerance, H₂O₂ tolerance, and exopolysaccharide synthesis in S. marcescens. Collectively, this work provides novel insight into regulatory mechanisms of prodigiosin synthesis and uncovers novel roles for the highly conserved MetR protein in regulating prodigiosin synthesis, heat tolerance, exopolysaccharide (EPS) synthesis, and biofilm formation.

ABSTRACT

Prodigiosin, a secondary metabolite produced by Serratia marcescens, has attracted attention due to its immunosuppressive, antimicrobial, and anticancer properties. However, information on the regulatory mechanism behind prodigiosin biosynthesis in S. marcescens remains limited. In this work, a prodigiosin-hyperproducing strain with the BVG90_22495 gene disrupted (ZK66) was selected from a collection of Tn5G transposon insertion mutants. Using real-time quantitative PCR (RT-qPCR) analysis, β-galactosidase assays, transcriptomics analysis, and electrophoretic mobility shift assays (EMSAs), the LysR-type regulator MetR encoded by the BVG90_22495 gene was found to affect prodigiosin synthesis, and this correlated with MetR directly binding to the promoter region of the prodigiosin-synthesis positive regulator PigP and hence negatively regulated the expression of the prodigiosin-associated pig operon. More analyses revealed that MetR regulated some other important cellular processes, including methionine biosynthesis, cell motility, H₂O₂ tolerance, heat tolerance, exopolysaccharide synthesis, and biofilm formation in S. marcescens. Although MetR protein is highly conserved in many bacteria, we report here on the LysR-type regulator MetR exhibiting novel roles in negatively regulating prodigiosin synthesis and positively regulating heat tolerance, exopolysaccharide synthesis, and biofilm formation.

IMPORTANCE Serratia marcescens, a Gram-negative bacterium, is found in a wide range of ecological niches and can produce several secondary metabolites, including prodigiosin, althiomycin, and serratamolide. Among them, prodigiosin shows diverse functions as an immunosuppressant, antimicrobial, and anticancer agent. However, the regulatory mechanisms behind prodigiosin synthesis in S. marcescens are not completely understood. Here, we adapted a transposon mutant library to identify the genes related to prodigiosin synthesis, and the BVG90_22495 gene encoding the LysR-type regulator MetR was found to negatively regulate prodigiosin synthesis. The molecular mechanism of the metR mutant hyperproducing prodigiosin was investigated. Additionally, we provided evidence supporting new roles for MetR in regulating methionine biosynthesis, cell motility, heat tolerance, H₂O₂ tolerance, and exopolysaccharide synthesis in S. marcescens. Collectively, this work provides novel insight into regulatory mechanisms of prodigiosin synthesis and uncovers novel roles for the highly conserved MetR protein in regulating prodigiosin synthesis, heat tolerance, exopolysaccharide (EPS) synthesis, and biofilm formation.

INTRODUCTION

Serratia marcescens, a Gram-negative rod-shaped bacterium of the Enterobacteriaceae family, is found in a wide range of ecological niches and can produce many antibiotic secondary metabolites, including prodigiosin, althiomycin, and serratamolide (1–3). Prodigiosin (PG), a red linear tripyrrole pigment and most prominent member of the prodiginine family, is mainly produced by S. marcescens (1), Serratia rubidaea (4), Streptomyces coelicolor (5), Streptomyces griseoviridis (6), and Serratia nematodiphila (7). Studies on prodigiosin have found that it has important antimicrobial, anticancer, and immunosuppressive properties (8, 9). Compared to that with traditional chemical methods, the biotechnological production of prodigiosin by S. marcescens is economical and more environmentally friendly and hence has recently attracted lots of interest. Although the optimization of fermentation parameters such as medium composition and pH (10, 11), temperature (12), and incubation period (12) has been extensively studied for improving prodigiosin production from its natural strains, efficient prodigiosin production for commercial purposes remains a challenge. Therefore, besides fermentation process optimization, there is an important need to identify high-yield prodigiosin-producing strains by alternative approaches and to analyze the metabolic regulatory network of prodigiosin synthesis. More importantly, the metabolic regulation network of prodigiosin biosynthesis should be clarified as soon as possible to guide the construction of high-yielding prodigiosin strains by metabolic engineering.

Unfortunately, although several genes have been shown to be essential for prodigiosin synthesis in S. marcescens, knowledge of the metabolic regulatory network for prodigiosin production is still limited. The enzymes for prodigiosin production in S. marcescens are encoded by the pig gene cluster, which is arranged in the order of pigA-pigN, a total of 14 genes. For production of prodigiosin, pigB, pigD, and pigE genes use 2-octenal as the substrate to synthesize the monopyrrole moiety, MAP, and pigA, pigF, pigG, pigH, pigI, pigJ, pigM, and pigN genes are involved in the production of the bipyrrole moiety, MBC. Finally, the pigC gene encodes the terminal condensing enzyme that condenses both MAP and MBC to prodigiosin (1). Also, the pig gene cluster essential for prodigiosin synthesis is regulated by transcription factors at the transcriptional level, including the negative regulators CopA (13), CRP (14), HexS (15), RssB (16), SmaR (17), and SpnR (18) and positive regulators EepR (19), PigP (20), GumB (21), and RbsR (22).

S. marcescens JNB5-1 was isolated from soil samples, and it produced a relatively large amount of prodigiosin (50.55 mg/liter) when fermented in LB medium. In this study, a higher-prodigiosin-producing strain, ZK66, was isolated from a collection of Tn5G insertion mutants using the strain JNB5-1 as the parental strain. The transposon-inserted BVG90_22495 (metR) gene encoding LysR-type regulator MetR was confirmed to function as a prodigiosin synthesis repressor. The mechanism for negative regulation of prodigiosin production by MetR was explored. Interestingly, MetR also positively regulated methionine biosynthesis, cell motility, H₂O₂ tolerance, heat tolerance, exopolysaccharide production, and biofilm formation in S. marcescens. Our data identified novel roles for the highly conserved MetR protein in influencing prodigiosin production, heat tolerance, biofilm formation, and exopolysaccharide production.

RESULTS

Identification of a regulator MetR that controls prodigiosin synthesis.

To identify prodigiosin-hyperproducing mutants, a random Tn5G transposon insertion library using Escherichia coli/pRK2013 Tn5G as the donor strain and S. marcescens JNB5-1 as the recipient strain was constructed, and nearly 20,000 mutants were collected (Fig. 1A). Among them, mutant strain ZK66 was isolated, as it produced 46.88 mg/liter of prodigiosin in a 48-well plate in 24 h, which was 59.78% higher than that of wild-type strain JNB5-1 (29.34 mg/liter). Furthermore, shake flask fermentation analysis showed that after 24 h of fermentation, the mutant ZK66 yielded the highest level of prodigiosin, 97.28 mg/liter, which was 1.92 times that of wild-type strain JNB5-1 (Fig. 1B) (P < 0.005).

FIG 1.

Identification of the prodigiosin synthesis repressor MetR. (A) Flow chart for screening prodigiosin-hyperproducing mutant ZK66 by transposon insertion mutation. (B) Shake flask fermentation to determine the ability of JNB5-1, ZK66, and ZK66/pXW1706 strains to synthesize prodigiosin. (C) The genetic loci identified in prodigiosin-hyperproducing mutant ZK66. (Top) Genetic map of the BVG90_22495 gene and surrounding genes. The transposon insertion site is noted by the triangle. (Middle) Conserved domain analysis of the protein BVG90_22495. (Bottom) BVG90_22495 is highly homologous to MetR protein. JNB5-1 is wild-type S. marcescens. ZK66 is a prodigiosin-hyperproducing mutant. ZK66/pXW1706 is a BVG90_22495 complementary strain. Plasmid pXW1706 carries BVG90_22495 gene with its own promoter. For panels A and B, the experiments were performed in biological triplicates. Error bars indicate the standard deviations. Student's t test was used to examine the mean differences between the data groups. ***, P < 0.005.

By inverse PCR analysis, the Tn5G transposon was found inserted between 483 bp and 484 bp in the coding region of the BVG90_22495 gene, which encodes a predicted LysR family transcriptional regulator (Fig. 1C). BVG90_22495 shares 100% identify with a predicted MetR, a transcriptional regulator with the helix-turn-helix DNA-binding domain of a sequenced S. marcescens strain, Db11 (Fig. 1C). Furthermore, the predicted metR gene from JNB5-1 was sequenced and submitted to GenBank (GenBank accession number MN630612) and shares 87.42%, 56.91%, and 33.33% (protein) identity with the proven MetR proteins of Escherichia coli O157:H7 strain TW14313 (EIP04670), Vibrio cholerae C6706 (OFJ23904), and Streptococcus mutans UA159 (NP_721604), respectively. Based on similarity to previously studied metR genes from other bacterial genera and experimental data described later in this study, we will refer to the BVG90_22495 open reading frame as MetR (23–25).

To confirm that the disruption of the metR gene resulted in a higher production of prodigiosin in the mutant ZK66, the strain ZK66 was complemented by introducing a recombinant plasmid pXW1706, in which the metR gene was driven by its own promoter, generating a complementary strain S. marcescens ZK66/pXW1706. Shake flask fermentation analysis showed that prodigiosin production in the complementary strain ZK66/pXW1706 was similar to that of wild-type strain JNB5-1 (Fig. 1B). Altogether, these results suggested that MetR is a repressor of the synthesis of prodigiosin in JNB5-1.

MetR represses the transcription of the prodigiosin-associated pig operon.

To exclude the possibility that cell growth was the main cause for hyperproduction of prodigiosin in the mutant ZK66, cell growth curves of the wild-type strain JNB5-1, metR mutant ZK66, and complementary strain ZK66/pXW1706 were determined. As shown in Fig. 2A, the growth of the mutant ZK66 was slightly inhibited compared to that of the strains JNB5-1 and ZK66/pXW1706 before 6 h, possibly due to the disruption of metR, involved in the synthesis of primary metabolites. From 6 h to 10 h, there was no significant difference in cell growth between parental and mutant strains. However, after 10 h, the growth of the mutant ZK66 appeared slightly enhanced. Further analysis of the ability for single-cell synthesis of prodigiosin in three strains revealed that the metR mutant ZK66 had significantly enhanced prodigiosin production (Fig. 2B), indicating that the ability of the mutant ZK66 to hyperproduce prodigiosin may be correlated with the higher expression level of the prodigiosin-associated pig operon instead of increased biomass.

FIG 2.

MetR inhibits the transcription of the pig gene cluster. (A) Growth in LB medium of the wild-type strain JNB5-1 and metR::Tn5 mutant ZK66 measured by taking the OD₆₀₀ values. (B) Unit cell production of prodigiosin of JNB5-1, ZK66, and ZK66/pXW1706 strains was assayed by measuring the absorbance (A₅₃₄) of cell lysates. (C) β-Galactosidase activity assay of ZK66 and JNB5-1 strains harboring the Ppig-lacZ reporter fusion. (D) RT-qPCR analysis of the changes in pigA, pigC, and pigE gene expression in the metR-disrupted mutant ZK66 and metR-overexpressing strain JNB5-1/pXW1706 compared with that in the wild-type strain JNB5-1. The experiments were performed in biological triplicates. Error bars indicate the standard deviations. For panel C, Student's t test was used to examine the mean differences between the data groups. ***, P < 0.005.

The metabolic pathway for the biosynthesis of prodigiosin by S. marcescens is composed of 14 genes, transcribed as a polycistronic mRNA from a promoter upstream of pigA (1). To analyze how MetR inhibits prodigiosin synthesis, a transcriptional lacZ fusion reporter gene of the pig operon was constructed, and β-galactosidase activity in the wild-type strain JNB5-1 and the metR mutant ZK66 was determined. Results showed that the transcription of the pig operon was significantly higher in the metR mutant ZK66 than in its parent strain JNB5-1 (P < 0.005) (Fig. 2C), indicating that MetR negatively regulated pig gene cluster expression. To further confirm the relationship between MetR and the pig gene cluster, the expression levels of the MAP pathway key gene pigE, the MBC pathway key gene pigA, and the condensing enzyme-encoding gene pigC in JNB5-1, metR-disrupted mutant ZK66, and metR-overexpressed mutant JNB5-1/pXW1706 were determined by real-time quantitative PCR (RT-qPCR). Results showed that the expression levels of the pigE, pigA, and pigC genes increased 5.48, 6.90, and 5.77 times, respectively, in the mutant ZK66, and decreased 3.25, 3.34, and 3.04 times, respectively, in the mutant JNB5-1/pXW1706 compared to that in strain JNB5-1 (Fig. 2D). The result that multicopy expression of metR led to a trend for decreased pigA, pigC, and pigE transcription in the strain JNB5-1/pXW1706 was consistent with MetR’s proposed role as an inhibitor of prodigiosin production. Collectively, these data indicated that metR inhibited prodigiosin production via negative control of the expression of the prodigiosin-associated pig operon.

Transcriptome analysis of the metR mutant strain.

To further reveal the reason for hyperproduction of prodigiosin by mutant ZK66, total RNA was isolated from the 12-h shake flask fermentation samples of three biological replicates, and transcriptome sequencing (RNA-Seq) analysis was performed to evaluate gene expression differences between wild-type strain JNB5-1 and prodigiosin hyperproducing mutant ZK66. Comparative transcriptomics data showed that the expression levels of 641 genes were significantly upregulated in the mutant strain ZK66, including the pigP, slyA, hfq, pstS, crp, and rsmA genes (log2 fold change [log2FC] ≥ 1, and false-discovery rate [FDR] < 0.05), whose roles in prodigiosin synthesis in S. marcescens or other prodigiosin-producing strains have been investigated (20, 26–30). The higher expression levels of pigP, slyA, hfq, pstS, crp, and rsmA genes in the metR mutant indicated that MetR probably indirectly regulated the expression of the prodigiosin synthesis genes and many other important core cellular processes in S. marcescens. Also, the expression levels of 784 genes were significantly downregulated, including for the 26 genes involved in flagellar biosynthesis (log2FC ≤ −1, and FDR < 0.05) (Fig. 3A). Moreover, based on the annotation of KEGG_B_class, an analysis of the major metabolic pathways for the significant differences of gene regulation in mutant ZK66 found that the significantly upregulated genes were involved in 23 major cellular processes, and the significantly downregulated genes were involved in 20 major cellular processes (Fig. 3B). Collectively, transcriptomics data indicated that MetR directly or indirectly regulated a variety of cell functions in addition to affecting prodigiosin synthesis in S. marcescens.

FIG 3.

Comparative transcriptome analysis of strains JNB5-1 and metR mutant ZK66. (A) Genome-wide analysis of differences in gene expression levels between metR mutant ZK66 and wild-type strain JNB5-1. The x axis represents the logarithmic-transformed value of gene expression levels in strain JNB5-1. The y axis represents log2-transformed fold change value of gene expression between strains ZK66 and JNB5-1. Different pathways genes are represented by different color shapes. Gray represents other genes outside the specified pathways genes. (B) KEGG_B_class analysis of genes with significant differences affecting the cell metabolic pathway. Blue color indicates the genes with significantly reduced expression levels. Green color indicates the genes with significantly elevated expression levels.

MetR directly repressed the expression of the prodigiosin positive regulator PigP.

To explore whether MetR interacts directly with the pig operon to inhibit prodigiosin production, the MetR protein was purified via a His tag and used in an electrophoretic mobility shift assay (EMSA) (see Fig. S1 in the supplemental material). The gel mobility shift patterns showed that the MetR protein did not bind to the promoter region of the pig operon, indicating that there could be an intermediate gene targeted by MetR, which directly affected prodigiosin synthesis (Fig. 4A).

FIG 4.

MetR indirectly controls prodigiosin synthesis in S. marcescens. (A) EMSA for MetR protein binding to the promoter region of the pig operon. (B) Image of prodigiosin production of different strains in LB agar medium. (C) Prodigiosin production analysis of different strains in LB medium. JNB5-1 is wild-type S. marcescens, JNB5-1 ΔpigP is the pigP mutant, JNB5-1 Δhfq is the hfq mutant, JNB5-1 ΔslyA is the slyA mutant, JNB5-1 Δcrp is the crp mutant, JNB5-1 ΔrsmA is the rsmA mutant, JNB5-1 ΔpstS is the pstS mutant, and ZK66 ΔpigP is the metR pigP double mutant. (D) RT-qPCR analysis of the changes in pigP, hfq, and slyA gene expression levels in the metR mutant ZK66 compared with that in the wild-type strain JNB5-1. (E to G) EMSAs for MetR protein binding to the promoter regions of the pigP gene (E), slyA gene (F), and hfq gene (G). (H) The regulatory network of MetR controls prodigiosin production in S. marcescens. The pigA-pigN operon includes genes pigA, pigB, pigC, pigD, pigE, pigF, pigG, pigH, pigI, pigJ, pigK, pigL, pigM, and pigN. PigP is the prodigiosin production positive regulator. MetR is the prodigiosin production negative regulator. Arrows indicate positive regulations, and T-shaped lines indicate negative regulations. X denotes an unknown prodigiosin synthesis regulator controlled by MetR. Dotted lines indicate additional pathways that influence MetR control of prodigiosin production. For panel C, the experiments were performed in biological triplicates. Error bars indicate the standard deviations. One-way ANOVA was used to examine the mean differences between the data groups. ****, P < 0.001; **, P < 0.01; ns, no significant differences.

According to the transcriptome data (Fig. 3A), the upregulated genes pigP, slyA, hfq, rsmA, crp, and pstS were selected for deletion to construct JNB5-1 ΔpigP, JNB5-1 ΔslyA, JNB5-1 Δhfq, JNB5-1 ΔrsmA, JNB5-1 Δcrp, and JNB5-1 ΔpstS mutants, respectively. The ability of these deletion mutants to synthesize prodigiosin was determined, and results showed that the pigP, slyA, and hfq genes positively regulated prodigiosin production, while the rsmA and pstS genes negatively regulated prodigiosin synthesis in S. marcescens JNB5-1. Additionally, the crp mutation conferred no significant effect on prodigiosin synthesis in strain JNB5-1 (Fig. 4B and C). These results suggested that MetR binds to the promoter regions of the genes pigP, slyA, or hfq and hence affects prodigiosin synthesis.

Furthermore, genes encoding the positive regulators of prodigiosin synthesis PigP, SlyA, and Hfq were chosen to demonstrate their expression levels in strains JNB5-1 and ZK66 by RT-qPCR analysis. Results showed that pigP, slyA, and hfq genes yielded 32.81, 34.06, and 19.30 times higher expression in the metR mutant ZK66 than in the wild-type strain JNB5-1 (Fig. 4D) (P ≤ 0,001). EMSA of the ability of MetR to bind the pigP, slyA, and hfq promoter regions revealed that MetR recognized and bound to the promoter region of the pigP gene but did not recognize and bind to the promoter regions of the slyA and hfq genes (Fig. 4E to G). Taken together, these data suggested that MetR negatively regulated the expression level of the pig gene cluster by directly binding to the promoter region of the positive regulator PigP. When metR was disrupted, the expression level of the pigP gene in the mutant ZK66 was significantly upregulated, resulting in the upregulation of the expression level of the pig gene cluster and thus significantly increased prodigiosin production (Fig. 4H).

Given that several hundred genes have altered expression in the metR mutant (Fig. 3), it is a clear possibility that the increased prodigiosin production in the metR mutant is partially dependent on PigP. To determine whether the effect of MetR on prodigiosin production was completely dependent on PigP, a pigP metR double mutant, ZK66 ΔpigP, was constructed, and prodigiosin synthesis of mutant ZK66 ΔpigP was determined. The yield of prodigiosin produced by mutant ZK66 ΔpigP was 1.32 times higher than wild-type strain JNB5-1 (Fig. 4C) but lower than the ZK66 mutant (which was 1.92 times that of JNB5-1), indicating partial recovery to JNB5-1 levels. These results suggested that additional pathways independent of PigP probably exist that control prodigiosin synthesis by MetR (Fig. 4H).

MetR contributes to methionine biosynthesis in S. marcescens.

Based on the transcriptomic analysis, the impact of MetR on other selected phenotypes was investigated. The role of MetR in the regulation of methionine biosynthesis in Escherichia coli and Salmonella enterica serovar Typhimurium has extensively been studied previously (31, 32). To investigate the effect of metR on methionine biosynthesis in S. marcescens, transcriptomic data between wild-type strain JNB5-1 and metR mutant ZK66 were analyzed, and the results showed that the expression levels of the methionine synthesis-related genes metE, metQ, and metR were significantly downregulated in metR mutant (log2FC < −1 and FDR < 0.05) (Fig. 5A and Table S3). Furthermore, metA, metB, metC, metE, metF, metG, metH, metI, metJ, metK, metL, metN, metQ, and glyA genes were selected, and the expression differences of these genes between strains JNB5-1 and ZK66 were verified by RT-qPCR. As shown in Fig. 5B, the results revealed that only the metE gene expression decreased more than 2-fold in the metR mutant, while that for the other 13 genes was <2-fold, suggesting that MetR was not required for the expression of these 13 genes in S. marcescens.

FIG 5.

MetR positively regulates methionine biosynthesis in S. marcescens. (A) Comparative transcriptome analysis revealed that methionine metabolism-related genes metE, metQ, and metR were significantly downregulated in the metR mutant. (B) RT-qPCR analysis of the changes in metA, metB, metC, metE, metF, metG, metH, metI, metJ, metK, metL, metN, metQ, and glyA gene expression levels in the metR mutant ZK66 compared with those in the wild-type strain JNB5-1. (C) Wild-type strain JNB5-1, metR mutant ZK66, and complementary strain ZK66/pXW1706 grown on glucose minimal medium (GMM) or GMM supplemented with 5 mM l-methionine. For panels B and C, the experiments were performed in biological triplicates. Error bars indicate the standard deviations. FPKM, fragments per kilobase per million.

Furthermore, the growth curves of wild-type strain JNB5-1, metR mutant ZK66, and complementary strain ZK66/pXW1706 in glucose minimal medium (GMM) or GMM supplemented with 5 mM l-methionine were determined. It was found that the growth of the metR-disrupted mutant ZK66 was affected in the absence of l-methionine and restored by the addition of exogenous l-methionine (Fig. 5C). Collectively, these results indicated that MetR positively regulated the expression level of the metE gene and hence influenced the biosynthesis of methionine in S. marcescens.

When metR was disrupted, the mutant ZK66 possibly accumulated a large amount of l-homocysteine. Analysis of the effects of l-methionine and l-homocysteine on prodigiosin synthesis in JNB5-1 and metR mutant ZK66 strains revealed that l-methionine played a positive role in prodigiosin synthesis for both JNB5-1 and ZK66 strains, which was consistent with a previous report (33). However, l-homocysteine had no significant effects on prodigiosin synthesis in either JNB5-1 or ZK66 (see Fig. S2). These results indicated that the high yield of prodigiosin in the metR mutant was not associated with the accumulation of the methionine metabolic intermediate l-homocysteine.

MetR positively regulates cell motility.

Multiple cellular systems contribute to the motility of S. marcescens, especially the presence of functional flagellar. The bacterial flagellum is a supramolecular complex made of at least three parts: the basal body, the hook, and the filament (34). Comparative transcriptomic data revealed that 26 flagellin-related genes were downregulated by at least 2-fold in the metR mutant ZK66 compared to that in its parent strain JNB5-1 (Fig. 6A; see also Table S3). The differentially expressed genes (DEGs) related to basal body synthesis (fliF, fliL, and flgB), hook synthesis (flgE), flagellin type III secretion system protein (flhB), and flagellar motor stator protein (motA) were selected and validated by RT-qPCR analysis. The results showed that the expression of all six genes significantly decreased in the metR-disrupted mutant (Fig. 6B), indicating that metR was involved in flagellar synthesis. When the swimming motility of the JNB5-1, ZK66, and ZK66/pXW1706 strains was tested on a 0.3% semisolid agarose plate, it was found that the swimming zone formed by the metR mutant ZK66 was significantly reduced (Fig. 6C, top; Fig. 6D) (P < 0.001). Analysis of the swarming motility of the three strains showed that the swarming motility of the metR mutant ZK66 also significantly decreased (Fig. 6C, bottom; Fig. 6E) (P < 0.001). The metR mutant swimming and swarming defects were complemented by the wild-type metR gene on a plasmid (Fig. 6C to E). Taken together, these data indicated that MetR plays an important role in influencing the motility of S. marcescens through the regulation of flagellar synthesis.

FIG 6.

MetR regulates cell motility in S. marcescens. (A) Comparative transcriptome analysis revealed that flagellar synthesis-related genes were significantly downregulated in metR mutant. (B) RT-qPCR analysis of the changes in fliF, fliL, flgE, flgB, flhB, and motA gene expression levels in the wild-type strain JNB5-1 compared with those in the metR mutant ZK66. (C) Motility tests for JNB5-1 (left), ZK66 (middle), and ZK66/pXW1706 (right). (Top) Swimming assay. (Bottom) Swarming assay. (D) Colony diameter determination of strains JNB5-1, ZK66, and ZK66/pXW1706 for swimming assay. (E) Colony diameter determination of strains JNB5-1, ZK66, and ZK66/pXW1706 for the swarming assay. For panels B, D, and E, the experiments were performed in biological triplicates. Error bars indicate the standard deviations. One-way ANOVA was used to examine the mean differences between the data groups. ****, P < 0.001.

H₂O₂ tolerance defects of the metR mutant.

Hydrogen peroxide (H₂O₂), which causes damage to virtually all biomolecules such as DNA, RNA, lipid, and protein, is one of the major challenges for living organisms (35). H₂O₂ tolerance was investigated by a spotting assay in the metR mutant. Compared with that in JNB5-1 and ZK66/pXW1706 strains, the ability of the metR mutant ZK66 to tolerate H₂O₂ was significantly decreased (Fig. 7A), indicating that MetR was involved in cellular tolerance to H₂O₂.

FIG 7.

Influence of MetR on H₂O₂ tolerance and heat tolerance. (A) Spot assays showed that MetR is required for S. marcescens to tolerate H₂O₂. (B) Relative expression levels of mRNAs related to catalase and peroxidase genes in the metR mutant strain ZK66 compared with those in the parent strain JNB5-1. (C) Spot assays showed that MetR is required for S. marcescens to tolerate heat. (D) Relative expression levels of mRNAs related to heat shock genes in the metR mutant strain ZK66 compared with those in the parent strain JNB5-1. For panels B and D, the experiments were performed in biological triplicates. Error bars indicate the standard deviations.

In bacteria, cells employ catalase and peroxidase to detoxify H₂O₂. To investigate the mechanisms by which MetR regulates the tolerance of S. marcescens to H₂O₂, RT-qPCR analyses were conducted to determine the transcription levels of the catalase-encoding genes katG and katE and the peroxidase-encoding genes btuE, SMDB11_RS07165, tpx, efeB, SMDB11_RS11425, yfeX, bcp, and SMDB11_RS19860. The results showed that the expression of katG decreased by 6.31-fold in the metR mutant, while the difference of the expression levels for the other 9 genes was <2-fold, indicating that metR potentially affected H₂O₂ tolerance by regulating the expression of katG (Fig. 7B).

MetR controls heat tolerance in S. marcescens.

Adapting to thermal stress is a common feature of all living organisms (36). To determine whether MetR is required for the thermal stress resistance of S. marcescens, the parent strain JNB5-1, metR mutant ZK66, and complementary strain ZK66/pXW1706 were spotted and grown on LB medium after heat treatment (50°C, 30 min). It was observed that the ability of the ZK66 strain with a disrupted metR gene to tolerate high temperature decreased significantly compared to that of JNB5-1 and ZK66/pXW1706 strains (Fig. 7C). RT-qPCR analysis of the expression levels of the heat shock protein-encoding genes ibpA, ibpB, hspQ, hslJ, hslR, and cbpA revealed that the expression levels of the six genes in the metR mutant were 11.71 to 40.96 times lower than in the parent strain JNB5-1 (Fig. 7D), indicating that MetR also positively regulated heat tolerance in S. marcescens.

MetR is essential for exopolysaccharide biosynthesis.

Exopolysaccharides (EPS) have been considered to play important roles in bacterium-host interactions and microbe-mediated immunomodulation (37). To reveal whether metR was required for synthesis of exopolysaccharides in S. marcescens, EPS production was investigated in the JNB5-1, ZK66, and ZK66/pXW1706 strains. Results showed that the dry weight of exopolysaccharides produced by ZK66 strain with a disrupted metR gene was 1,524.33 ng/ml, which was only 46.5% of that of the wild-type strain JNB5-1 (3,277.33 ng/ml), while the concentration of exopolysaccharides produced by the ZK66/pXW1706 strain was restored to 2,924.33 ng/ml (Fig. 8A) (P < 0.001). Further analysis of the EPS produced by JNB5-1, ZK66, and ZK66/pXW1706 strains using scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that the three strains were similar in shape; however, the metR mutant ZK66 possessed a smoother cell surface with fewer small lumps on the surface than JNB5-1 and ZK66/pXW1706 strains (Fig. 8B and C). These data indicated that metR was necessary for synthesis of exopolysaccharides in S. marcescens. Moreover, RT-qPCR analysis of the expression levels of the bacterial exopolysaccharide synthesis pathway genes wzx, wzy, and galU showed that the expression level of O-antigen polymerase-encoding gene wzy in the metR mutant ZK66 was significantly decreased and only 2.18% of that of the wild-type strain JNB5-1 (Fig. 8D), potentially explaining the low production of exopolysaccharides in the metR mutant ZK66.

FIG 8.

Exopolysaccharide synthesis and biofilm formation are severely reduced in the metR mutant. (A) Exopolysaccharide production assay of the strains JNB5-1, ZK66, and ZK66/pXW1706. (B) SEM images of the JNB5-1, ZK66, and ZK66/pXW1706 cells. (C) TEM images of the JNB5-1, ZK66, and ZK66/pXW1706 cells. (D) Relative expression levels of the genes galU, wzx, and wzy related to exopolysaccharide production in the metR mutant ZK66 compared with those in the parent strain JNB5-1. (E) Biofilm formation assay of JNB5-1, ZK66, and ZK66/pXW1706 strains. For panels A, D, and E, the experiments were performed in biological triplicates. Error bars indicate the standard deviations. For panels A and E, one-way ANOVA was used to examine the mean differences between the data groups. ****, P < 0.001.

Biofilm is a complex matrix composed of exopolysaccharides, extracellular DNA, and proteins, and an accumulation of exopolysaccharides can promote biofilm formation. To verify whether MetR, a positive regulator of exopolysaccharide synthesis, affects biofilm formation, we measured biofilm production of JNB5-1, ZK66, and ZK66/pXW1706 strains after 48 h of incubation in 96-well microtiter plates. As shown in Fig. 8E, the metR mutant ZK66 produced less biofilm (P ≤ 0.001) than the JNB5-1 and ZK66/pXW1706 strains. These results indicated that MetR also positively regulated biofilm formation.

DISCUSSION

The natural red linear tripyrrole pigment produced by S. marcescens, prodigiosin, has been reported to have immunosuppressive, antimicrobial, and anticancer biological activities (8). Previous studies have shown that the biosynthesis of prodigiosin by S. marcescens is regulated by a number of transcriptional regulatory factors, including positive regulators EepR (19), PigP (20), GumB (21), and RbsR (22) and negative regulators CopA (13), CRP (14), HexS (15), RssB (16), SmaR (17), and SpnR (18). Among them, regulators HexS, EepR, PigP, and RssB directly bind to the promoter region of the pig operon and regulate prodigiosin production (15, 16, 19, 20). Also, cyclic AMP receptor protein CRP binds to the promoter region of EepR and indirectly regulates the production of prodigiosin (30). In this work, MetR was identified through the screening of a random transposon mutant library as a negative regulator of prodigiosin production. Compared with that of the wild-type strain, the yield of prodigiosin produced by a metR-disrupted mutant was 1.92 times higher in LB medium (Fig. 1B). The β-galactosidase assay, RT-qPCR analysis, comparative transcriptome analysis, and EMSA results showed that the molecular mechanism for negative regulation of prodigiosin production by MetR operated mainly by direct binding to the promoter region of the pigP gene, thus repressing the transcription of the pig operon (Fig. 2C and D and 4). The partial recovery of the ability to produce prodigiosin by the pigP metR double mutant ZK66/pigP indicated that there might be a metabolic pathway independent of PigP which affected the regulation of MetR on prodigiosin synthesis in S. marcescens; thus, further study of these unidentified pathways is still required (Fig. 4C).

MetR, a LysR-type transcription regulator (LTTR), has been extensively studied for its important role in controlling methionine biosynthesis (25, 38). Initially, MetR was identified as an activator of metE and metH, the key genes of the methionine biosynthesis pathway (23). Subsequent studies, however, showed that MetR was also involved in regulating the expression of other genes involved in the methionine biosynthesis pathway, including metA and metF in Salmonella Typhimurium (31, 32) and glyA in Escherichia coli (39). Importantly, besides regulating methionine biosynthesis, MetR was also involved in regulating many other core cellular processes, such as regulating the transcription of the flavohemoglobin-encoding gene hmp in E. coli, which protects bacteria from nitric oxide stress (40), promoting oxidative stress tolerance and virulence in Alternaria alternata (41), restoring selenate tolerance of a laeA mutant in Aspergillus fumigatus (42), and increasing cell virulence in Pseudomonas aeruginosa, Vibrio cholerae, and Aspergillus fumigatus (24, 43, 44). In this work, we confirmed that MetR regulated many unknown cellular processes in S. marcescens, including positive regulation of methionine biosynthesis (Fig. 5C), swarming and swimming motility (Fig. 6C to E), heat tolerance (Fig. 7A), H₂O₂ tolerance (Fig. 7C), exopolysaccharide production (Fig. 8A), and biofilm formation (Fig. 8E) as well as negative regulation of prodigiosin production (Fig. 1B).

The MetE enzyme is a homocysteine S-methyltransferase, encoded by the metE gene, that catalyzes the final step in methionine biosynthesis (45). In this study, we found that MetR positively regulated the expression of the metE gene and hence influenced the biosynthesis of methionine in S. marcescens, as determined by methionine auxotrophy of the metR mutant (Fig. 5).

Motility, the basis of microorganism life processes (46), was also considered to be closely related to the pathogenicity of bacteria (47). A number of transcriptional regulators in S. marcescens were found to be involved in swarming motility, including positive regulators CysE (48), ArcB (49), EepR (19), and PigP (20) and negative regulator SpnR (18). Additionally, the flagellum is one of the most important systems that regulate swarming motility in microorganisms. Transcriptomics and RT-qPCR analysis results for the wild-type strain JNB5-1 and metR mutant ZK66 showed that the expression of fliF and 26 other flagellar genes was significantly downregulated in the metR mutant (Fig. 6A and B), suggesting that metR played a key role in the downregulation of flagellar genes and hence attenuated motility in the metR mutant (Fig. 6C to E).

Oxidative stress and thermal stress are environmental stresses with significant effects on microbial physiology and play important roles in microbial fermentation. To adapt to or resist these environmental stresses, microorganisms have evolved many complex defense systems (50). In this work, we found that MetR positively regulated H₂O₂ tolerance and heat tolerance in S. marcescens (Fig. 7A and C). RT-qPCR analysis showed that MetR directly or indirectly regulated the expression of the katE gene, which is responsible for the synthesis of catalase known to play a key role in H₂O₂ tolerance in bacteria (Fig. 7B). The expression levels of heat shock protein-encoding genes ibpA, ibpB, hspQ, hslJ, hslR, and cbpA also decreased significantly in the metR mutant, suggesting that there is an intermediate gene regulated by MetR that influenced heat tolerance in S. marcescens (Fig. 7D).

Bacteria can grow in different natural habitats and niches in two different ways: as planktonic cells and as biofilm cells. Biofilm matrices vary by species but generally consist of exopolysaccharides, proteins, and DNA molecules. Various transcription regulators have been identified as playing important roles in the biosynthesis of biofilm in different microorganisms, including the positive regulator FleQ in P. aeruginosa (51), the negative regulator LrhA in E. coli (52), SinR in Bacillus subtilis (53), CytR in Vibrio cholerae (54), and Fur in Yersinia pestis (55). In S. marcescens, a few regulators have been identified as playing important roles in biofilm formation, including regulators GumB (21), CpxR (56), OxyR (57), and FlhDC (58). MetR was identified as a positive regulator of both EPS synthesis and biofilm formation in S. marcescens in our work. When metR was disrupted, the ability of S. marcescens to synthesize EPS and biofilm was significantly decreased (Fig. 8A and E). RT-qPCR analysis showed that MetR affected the formation of exopolysaccharides and biofilm likely by directly or indirectly regulating the expression of the wzy gene (Fig. 8D).

As MetR regulates many cellular processes, including prodigiosin production, cell motility, H₂O₂ tolerance, heat tolerance, exopolysaccharide production, and biofilm formation in S. marcescens, further research on MetR and MetR-like proteins is warranted if they are widely present in other bacteria. Therefore, homologs of MetR were searched with an E value lower than the threshold of 1E−57. The top 1,000 proteins showing similarities ranging from 83.99% to 100% were found in the groups of Serratia sp. (mostly S. marcescens), Escherichia sp. (mostly E. coli), Salmonella sp. (mostly S. enterica), Klebsiella sp. (mostly K. pneumoniae), Yersinia sp., and other bacteria, including Rouxiella chamberiensis, Pantoea rwandensis, Nissabacter archeti, and so on (Fig. 9). The fact that the MetR-like proteins are highly homologous suggests that MetR in other bacteria probably controls the same cellular processes as in S. marcescens.

FIG 9.

Diversity analysis of MetR-like proteins. The phylogenetic tree contains the top 1,000 homologous proteins of MetR with E values lower than 1E−57. The dark blue triangle represents the MetR protein studied in this work.

In summary, we described a new regulator which negatively regulates prodigiosin gene expression and production in S. marcescens. This protein, MetR, directly binds to the promoter region of the pigP gene and inhibits the expression of this positive regulator of prodigiosin biosynthesis, leading to our model that MetR regulates prodigiosin production indirectly through the direct transcriptional control of the PigP prodigiosin activator. More importantly, our work extends the roles of the highly conserved MetR in the control of H₂O₂ tolerance, heat tolerance, exopolysaccharide production, and biofilm formation. However, further research is needed to reveal the molecular mechanisms by which MetR protein regulates cellular processes in S. marcescens and to understand the roles played by MetR-like proteins in other bacteria.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

S. marcescens JNB5-1 is a prodigiosin-producing strain collected by our laboratory. Mutant ZK66, a prodigiosin-hyperproducing strain, was selected from a Tn5G transposon insertion mutant library of strain JNB5-1. E. coli DH5α was used for plasmid construction and E. coli BL21(DE3) was used for protein expression. The E. coli strains were grown in LB medium at 37°C, and the S. marcescens strains were grown in LB medium at 28°C. Whenever necessary, the medium was supplemented with spectinomycin (25 μg/ml), streptomycin (25 μg/ml), kanamycin (50 μg/ml), ampicillin (50 μg/ml), or gentamicin (10 μg/ml) for E. coli strain cultivation, and with spectinomycin (50 μg/ml), streptomycin (50 μg/ml), kanamycin (150 μg/ml), apramycin (50 μg/ml), or gentamicin (50 μg/ml) for S. marcescens strain cultivation. The bacterial strains and plasmids used in this study are listed in Table 1.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Description	Source or reference
Strains
E. coli strains
DH5α	hsdR recA lacZYAF80 lacZΔM15	BRL
BL21 (DE3)	F− dcm ompT hsdS (rB− mB−) gal λ (DE3)	Laboratory collection
S17-1	F− recA hsdR RP4-2 (Tc::Mu) (Km::Tn7) lysogenized with λpir phage	Laboratory collection
S. marcescens strains
JNB5-1	S. marcescens wild-type strain	Laboratory collection
ZK66	metR::Gmr mutant of JNB5-1, prodigiosin-hyperproducing mutant	This study
ZK66/pXW1706	Mutant ZK66 containing plasmid pXW1706	This study
JNB5-1/pDN19lacΩ-pPig	S. marcescens JNB5-1 containing plasmid pDN19lacΩ-pPig	This study
ZK66/pDN19lacΩ-pPig	S. marcescens ZK66 containing plasmid pDN19lacΩ-pPig	This study
JNB5-1/pXW1706	S. marcescens JNB5-1 containing plasmid pXW1706	This study
JNB5-1 ΔpigP	pigP deletion mutant of S. marcescens JNB5-1	This study
JNB5-1 Δhfq	hfq deletion mutant of S. marcescens JNB5-1	This study
JNB5-1 ΔslyA	slyA deletion mutant of S. marcescens JNB5-1	This study
JNB5-1 ΔrsmA	rsmA deletion mutant of S. marcescens JNB5-1	This study
JNB5-1 ΔpstS	pstS deletion mutant of S. marcescens JNB5-1	This study
JNB5-1 Δcrp	crp deletion mutant of S. marcescens JNB5-1	This study
ZK66 ΔpigP	pigP metR double mutant of S. marcescens JNB5-1	This study
Plasmids
pRK2013Tn5G	Tn5G-carrying plasmid, Kmr Gmr	59
pMD18T	Cloning vector, 2,692 bp, Ampr, lacZ	TaKaRa
pET28a	E. coli expression vector, Kmr	Laboratory collection
pET28a-MetR	Expression of MetR in E. coli BL21(DE3)	This study
pACYC177	Low-copy-number vector plasmid, Ampr Kmr	Laboratory collection
pXW1706	metR gene with its own promoter cloned in pET28a, Kmr	This study
pDN19lacΩ	Promoterless lacZ fusion vector, Spr Smr Tcr	64
pDN19lacΩ-pPig	pig operon promoter cloned in pDN19lacΩ, Spr Smr Tcr	This study
pUTKm	Tn5-based delivery plasmid with Kmr Ampr	62

Screening of prodigiosin-hyperproducing mutant.

Tn5G transposon was used to mutate S. marcescens JNB5-1 to identify prodigiosin-hyperproducing mutants as described previously (59). After mating, the mutant bank was plated onto LB agar medium with 50 μg/ml gentamicin and 50 μg/ml ampicillin. The grown mutants that formed deep red colonies were selected for fermentation in 48-well plates in order to screen prodigiosin high-yielding mutants. Then, the ability of prodigiosin high-yielding mutants to produce prodigiosin was further determined by shake flask fermentation in LB medium. The method for the determination of prodigiosin yield was by acidified ethanol and absorbance measurement as previously described (60). The amount of prodigiosin produced by different strains was calculated according to the standard curve: Y = 1.1936X − 0.001. (Y [the wavelength measured at A₅₃₄] indicated that the fermentation broth is soluble in acid ethanol at pH 3.0; X indicates the amount of prodigiosin produced by the strains, for which 1 unit equals 10 mg/liter.) Relative prodigiosin production was calculated per cell as A₅₃₄/OD₆₀₀ × 50, where OD₆₀₀ is the optical density at 600 nm.

Identification of the transposon insertion site of mutant ZK66.

Inverse PCR was performed as described previously to identify the insertional site of transposon Tn5G in mutant ZK66 (61). Briefly, mutant ZK66 genomic DNA was isolated, digested by the restriction enzyme TaqI, self-ligated, and amplified using primers OTn1 and OTn2, shown in Table 2. The PCR product was then cloned into the pMD18T vector for sequencing, and the obtained sequences were analyzed by searching the database GenBank of NCBI (https://www.ncbi.nlm.nih.gov/). The primers MetR-F1 and MetR-R1 listed in Table 2 were designed to amplify the metR gene with its own promoter and cloned into the multiple cloning sites of the pACYC177 plasmid. The recombinant plasmid was transformed into the mutant ZK66 for the complementation test and strain JNB5-1 for the construction of the metR overexpression strain JNB5-1/pXW1706.

TABLE 2.

Primers used in this study

Primer	Primer sequence (5′→3′)a	Function
OTn1	GATCCTGGAAAACGGGAAAG	Identification of Tn5G in mutants
OTn2	CCATCTCATCAGAGGGTAGT
MetR-F1	CGCGGATCCGCTCTTCCTGCGTTGAGTTGC	Amplification of gene metR with its native promoter
MetR-R1	CGCGAATTCTTATACGCCGGCCGCCAAC
MetR-F2	CGCGAATTCATGATCGAACTGAAACATTTACGGACG	Overexpression of metR in plasmid pET28a
MetR-R2	CGCAAGCTTTTATACGCCGGCCGCCAAC
PigA-F	CGCGGATCCGACGAACTCCGCCATTGGGT	Amplification of the pig operon promoter region
PigA-R	CGCGAATTCCGGATCGGGGCGGTAATCAG
PigP-F	GAGTGTGGCAATGCCCCCTC	Amplification of the pigP gene promoter region
PigP-R	TGGCTGTCCTTACAAACATTACGCAG
SlyA-F	TTCCAGAGCCACCAACCGGC	Amplification of the slyA operon promoter region
SlyA-R	TTCCCCCTCCTTATAATTAGCATGCTAAC
Hfq-F	ACTAAAATTTCGGGTGAATCGTTGCC	Amplification of the hfq operon promoter region
Hfq-R	GTTTGTAACTAAGAACCTGTCGGCTC

^aUnderlining indicates the added restriction enzyme sites.

Gene deletion in S. marcescens.

The pigP, slyA, hfq, pstS, crp, and rsmA genes of S. marcescens JNB5-1 were inactivated by using a gene replacement method described previously (62). First, approximately 1,000-bp DNA fragments homologous to the 5′ and 3′ terminal and flanking sequences of target genes and aacC3 resistance gene DNA fragments were amplified by PCR method. Second, the aacC3 gene was integrated into the middle of the 5′ and 3′ terminal and flanking sequences by overlap extension PCR. Then, recombinant plasmid was obtained by integrating the DNA fragments into the pUTKm vector, and the recombinant plasmid was transformed into the E. coli S17-1 strain. Finally, using recombinant E. coli S17-1 as the donor strain and S. marcescens JNB5-1 or ZK66 as the recipient strain, the genes mentioned above were knocked out by the mating method. These deletions were in frame and removed A7 to L204 of the total 204 amino acids in PigP, T4 to L133 of the total 143 amino acids in SlyA, Q5 to E102 of the total 102 amino acids in Hfq, R5 to L345 of the total 346 amino acids in PstS, P6 to R210 of the total 210 amino acids in Crp, and R6 to Y61 of the total 61 amino acids in RsmA. Primers used for gene deletion are shown in Table S2 in the supplemental material.

Growth curve assays.

To analyze the growth curve of S. marcescens, the exponential-phase cells (OD₆₀₀ of 0.6) of the strains JNB5-1, ZK66, and ZK66/pXW1706 were inoculated in fresh LB medium at 3% inoculation volume. The growth of S. marcescens cells was determined by monitoring the optical density of cultures at 600 nm (OD₆₀₀) at time intervals of 0, 2, 4, 6, 8, 10, 12, 24, 36, and 48 h, and the growth curves were plotted as the values of OD₆₀₀ versus the incubation time.

Real-time quantitative PCR assay.

After 12 h of shake flask fermentation, JNB5-1 and metR mutant ZK66 cells were collected to analyze the expression levels of prodigiosin synthesis-related genes, motility-related genes, methionine metabolism-related genes, and extracellular polysaccharide synthesis-related genes. To assess H₂O₂ tolerance, log-phase cells (OD₆₀₀ of 0.6) were inoculated in fresh LB medium consisting of 2 mM H₂O₂ for 6 h and then collected to analyze the expression levels of catalase- and peroxidase-coding genes. After heat stimulation at 50°C for 30 min, the cells were collected to analyze the expression levels of heat shock protein-related genes. The total RNA of the collected cells was extracted using an RNAprep pure kit (Tiangen). After treatment with DNase I for 30 min at room temperature, total RNA (0.5 μg) was subjected to reverse transcription to synthesize cDNA using the HiScript II Q RT SuperMix (Vazyme). To ensure that there was no chromosomal DNA contamination in each cDNA sample, a no reverse transcriptase control was performed for each RNA sample, and any samples with detected chromosomal DNA contamination were excluded before experimentation. Then, the cDNA was diluted to 200 ng/μl and subjected to real-time quantitative PCR (RT-qPCR) analysis using ChamQ Universal SYBR qPCR master mix (Vazyme). The 16S rRNA protein-encoding gene was used as an internal control. The primers used for RT-qPCR analysis are listed in Table S1.

Construction of transcription reporters.

The promoter of the prodigiosin-associated pig operon was amplified with the primers PigA-F and PigA-R listed in Table 2. The 498-bp long PCR product upstream of the pigA open reading frame (ORF) was cloned into the lacZ-containing plasmid pDN19lacΩ to construct the recombinant plasmid pDN19lacΩ-pPig. The plasmid pDN19lacΩ-pPig was then introduced into JNB5-1 and ZK66 strains by electroporation. The expression levels of the genes in the pig operon were determined by measuring β-galactosidase activities of the transformants.

Transcriptome analysis.

S. marcescens JNB5-1 and metR mutant ZK66 cells were grown for 12 h to produce prodigiosin prior to harvesting. One milliliter of the collected cells was subjected to snap-freezing in liquid nitrogen, treated via an RNAprep pure kit (Tiangen) to extract total bacterial RNA, and delivered in dry ice to Genewiz for transcriptome resequencing analysis (Genewiz, South Plainfield, NJ). The total RNA extracted from the bacteria was subjected to rRNA removal to obtain mRNA. The obtained mRNA was used as the template for DNA synthesis. Illumina HiSeq platform was used for cDNA library sequencing. For annotation, the genome of S. marcescens WW4 (NC_020211.1) was used as the reference. Using the standards of false discovery rate (FDR) of ≤0.05 and fold change |log2ratio| of ≥1, the differentially expressed genes between sample JNB5-1 and metR mutant ZK66 were determined. To classify genes at the level of KEGG_B_class, the pathway enrichment analysis tool Omicshare was used (http://www.omicshare.com/tools/Home/Soft/pathwaygsea).

Electrophoretic mobility shift assay.

The His-tagged MetR protein was overexpressed via a pET28a expression vector with the primers MetR-F2 and MetR-R2 listed in Table 2. His-tagged MetR proteins were purified through a 1-ml HisTrap HP column on an AKTA purifier system (GE Healthcare, Sweden). The purified proteins were pooled for SDS-PAGE analysis. The promoter regions of the pig operon, pigP, slyA, and hfq genes were amplified using the primers listed in Table 2, which amplified 498-bp, 375-bp, 500-bp, and 476-bp regions of DNA upstream of the pigA, pigP, slyA, and hfq gene open reading frames, respectively. Then, the purified DNA fragments of the promoter regions were mixed with the serial dilutions of the MetR proteins and kept in 2× binding buffer (40 mM Tris-HCl [pH 7.5], 4 mM MgCl₂, 100 mM NaCl, 10% glycerol, 2 mM dithiothreitol [DTT], 0.2 mg/ml bovine serum albumin [BSA], and 1 mM EDTA) for 30 min at room temperature. Electrophoresis was carried out on a 5% native PAGE gel. Finally, the gels were stained with ethidium bromide to visualize the DNA bands.

l-Methionine production assay.

To analyze the effect of MetR on l-methionine biosynthesis in S. marcescens, the growth rates of the JNB5-1, ZK66, and ZK66/pXW1706 strains were analyzed by incubation in 96-well plates in glucose minimal medium (GMM) or GMM supplemented with 5 mM l-methionine. At the beginning of incubation, exponential-phase cells (OD₆₀₀ of 0.6) were transferred to 96-well plates at a 3% inoculation volume and then incubated continuously at 30°C with a shaking speed of 180 rpm. Samples were collected every 30 min to monitor the culture density by measuring OD₆₀₀.

Motility assays.

For swarming and swimming assays, 1 μl of the exponential-phase cells (OD₆₀₀ of 0.6) of JNB5-1, ZK66, and ZK66/pXW1706 strains was spotted onto 0.5% and 0.3% semisolid LB media, respectively. The swarming and swimming zones were measured after incubation at 28°C for 16 h and 24 h, respectively.

H₂O₂ tolerance and heat tolerance assays.

For the H₂O₂ tolerance assay, exponential-phase cells (OD₆₀₀ of 0.6) of the strains JNB5-1, ZK66, and ZK66/pXW1706 were serially diluted (10-fold) in sterile water and spotted onto (1 μl) LB agar medium containing 2 mM H₂O₂ and incubated at 28°C for 24 h. For the heat tolerance assay, the exponential-phase cells (OD₆₀₀ of 0.6) were first kept for 30 min at 50°C and then serially diluted (10-fold) in sterile water, spotted onto (1 μl) LB agar medium, and incubated at 28°C for 24 h.

Extracellular polysaccharide quantitation.

The extracellular polysaccharide assays of S. marcescens were carried out as described previously with slight modification (21). In brief, after overnight incubation in LB medium, the bacteria were centrifuged at 12,000 rpm at 15°C for 15 min. The bacterial pellets were collected and suspended in 30 ml phosphate-buffered saline (PBS) solution and 6 ml 1% Zwittergent 3-14 citric acid solution (100 mM, pH 2.0). After incubation at 50°C for 20 min, the bacteria were centrifuged at 12,000 rpm at 15°C for 30 min. The supernatant cells were transferred to four 50-ml centrifugal bottles. Four volumes of cold ethanol (−20°C) were added to each sample, and each sample was kept at −20°C overnight. After the overnight precipitation, the samples were centrifuged for 45 min at 14,000 rpm and 4°C. After discarding the supernatant, the exopolysaccharides in the sediment were dried in a chemical fume hood, and the polysaccharides were weighed.

Scanning electron microscopy and transmission electron microscopy.

Scanning electron microscopy (SEM) (Hitachi SU8220) and transmission electron microscopy (TEM) (Hitachi H-7650; Hitachi, Tokyo, Japan) were used to observe cell shapes of strains JNB5-1 and metR mutant ZK66. Bacterial cells were cultured in LB medium for 12 h at 28°C with shaking at 200 rpm, and then 100 μl of bacterial cells was plated onto LB agar medium for 12 h at 28°C. Colonies of S. marcescens were resuspended in sterile water and placed on a carbon film-coated copper grid (230 mesh; Beijing Zhongjing Science and Technology Co., Ltd., Beijing, China). Finally, the bacterial liquid on the film was dried at 25°C and observed by TEM and SEM.

Biofilm analysis with the crystal violet staining method.

Biofilm production was assessed in JNB5-1 and metR mutant ZK66 strains as previously described (63). Briefly, 20 μl exponential culture and 200 μl 3-fold diluted LB medium were mixed and added to a 96-well microtiter plate (Corning, NY, USA). After incubation at 37°C for 48 h without shaking, the microplates were washed gently with distilled water three times. Biofilm was stained with 0.1% crystal violet solution for 15 min. Then, 95% ethanol was used to extract crystal violet, and the biofilm content was measured by the optical densities at the wavelength of 595 nm using a BioTek Epoch2 microplate reader.

Role of l-methionine and l-homocysteine on prodigiosin biosynthesis.

To analyze the roles of l-methionine and l-homocysteine in prodigiosin synthesis, different concentrations of l-methionine (0, 0.5, 1.0, and 2.0 mM) and l-homocysteine (0, 0.5, 1.0, and 2.0 mM) were added to LB medium, respectively, and prodigiosin production of JNB5-1 and ZK66 strains was determined after shake flask fermentation for 24 h.

Species diversity analysis of MetR-like proteins.

PSI-BLAST in NCBI was used for the searching of MetR homologous proteins in other bacteria. By setting the E value lower than the threshold of 1E−57, the top 1,000 homologous sequences were selected. The phylogenetic tree of the 1,000 proteins was generated using BLAST pairwise alignments in NCBI and modified using the online software iTOL (http://itol.embl.de/).

Statistical analysis.

The experiments in this study were performed independently three times, and data are expressed as means and standard deviations (SDs). To compare statistical differences between the groups of experiment data, Student's t tests or one-way analyses of variance (ANOVAs) with Tukey’s posttests were used.

Accession number(s).

The transcriptomics raw data have been submitted to the GEO database of NCBI with the accession number GSE133030, and the sequence of the metR gene from strain JNB5-1 was deposited in GenBank with the accession number MN630612.