Skip to main content
NCBI home page
Molecular Oncology logoLink to Molecular Oncology
. 2019 Dec 29;14(2):426–446. doi: 10.1002/1878-0261.12602

RNA‐sequence‐based microRNA expression signature in breast cancer: tumor‐suppressive miR‐101‐5p regulates molecular pathogenesis

Hiroko Toda 1, Naohiko Seki 2,✉, Sasagu Kurozumi 3, Yoshiaki Shinden 1, Yasutaka Yamada 2, Nijiro Nohata 4, Shogo Moriya 5, Tetsuya Idichi 1, Kosei Maemura 1, Takaaki Fujii 3, Jun Horiguchi 6, Yuko Kijima 1,7, Shoji Natsugoe 1
PMCID: PMC6998431  PMID: 31755218

Abstract

Aberrantly expressed microRNA (miRNA) are known to disrupt intracellular RNA networks in cancer cells. Exploring miRNA‐dependent molecular networks is a major challenge in cancer research. In this study, we performed RNA‐sequencing of breast cancer (BrCa) clinical specimens to identify tumor‐suppressive miRNA in BrCa. In total, 64 miRNA were identified as candidate tumor‐suppressive miRNA in BrCa cells. Analysis of our BrCa signature revealed that several miRNA duplexes (guide strand/passenger strand) derived from pre‐miRNA were downregulated in BrCa tissues (e.g. miR‐99a‐5p/‐3p, miR‐101‐5p/‐3p, miR‐126‐5p/‐3p, miR‐143‐5p/‐3p, and miR‐144‐5p/‐3p). Among these miRNA, we focused on miR‐101‐5p, the passenger strand of pre‐miR‐101, and investigated its tumor‐suppressive roles and oncogenic targets in BrCa cells. Low expression of miR‐101‐5p predicted poor prognosis in patients with BrCa (overall survival rate: P = 0.0316). Ectopic expression of miR‐101‐5p attenuated aggressive phenotypes, e.g. proliferation, migration, and invasion, in BrCa cells. Finally, we identified seven putative oncogenic genes (i.e. High Mobility Group Box 3, Epithelial splicing regulatory protein 1, GINS complex subunit 1 (GINS1), Tumor Protein D52, Serine/Arginine‐Rich Splicing Factor Kinase 1, Vang‐like protein 1, and Mago Homolog B) regulated by miR‐101‐5p in BrCa cells. The expression of these target genes was associated with the molecular pathogenesis of BrCa. Furthermore, we explored the oncogenic roles of GINS1, whose function had not been previously elucidated, in BrCa cells. Aberrant expression of GINS1 mRNA and protein was observed in BrCa clinical specimens, and high GINS1 expression significantly predicted poor prognosis in patients with BrCa (overall survival rate: P = 0.0126). Knockdown of GINS1 inhibited the malignant features of BrCa cells. Thus, identification of tumor‐suppressive miRNA and molecular networks controlled by these miRNA in BrCa cells may be an effective strategy for elucidation of the molecular pathogenesis of this disease.

Keywords: breast cancer, GINS1, microRNA, miR‐101‐5p, pathogenesis, tumor suppressor

We showed that miR‐101‐5p acted as an anti‐tumor miRNA in breast cancer (BrCa) cells through targeting several oncogenic genes (i.e. High Mobility Group Box 3, Epithelial splicing regulatory protein 1, GINS complex subunit 1 (GINS1), Tumor Protein D52, Serine/Arginine‐Rich Splicing Factor Kinase 1, Vang‐like protein 1, and Mago Homolog B). Aberrant expression of GINS1 mRNA and protein was observed in BrCa clinical specimens, and high GINS1 expression significantly predicted poor prognosis in patients with BrCa (overall survival rate: P = 0.0126).

graphic file with name MOL2-14-426-g009.jpg

Abbreviations

BrCa

breast cancer

ESRP1

Epithelial splicing regulatory protein 1

GEO

Gene Expression Omnibus

GINS1

GINS complex subunit 1

HMGB3

High Mobility Group Box 3

MAGOHB

Mago Homolog B

miRNA

microRNA

RISC

RNA‐induced silencing complex

SRPK1

Serine/Arginine‐Rich Splicing Factor Kinase 1

TCGA

The Cancer Genome Atlas

TPD52

Tumor Protein D52

VANGL1

Vang‐like protein 1

1. Introduction

Breast cancer (BrCa) is the most common malignancy among women, and ~ 2 million cases are newly diagnosed each year, resulting in more than 620 000 deaths annually (Bray et al., 2018; Ferlay et al., 2015). In the general population, ~ 12% of women will develop BrCa in their lifetime (Howlader et al., 2017). In contrast, ~ 70% of women who inherit BRCA1 or BRCA2 mutations will develop BrCa by 80 years of age (Kuchenbaecker et al., 2017). A recent study reported that germline mutations in TP53 and PTEN also increase the risk of BrCa development (Economopoulou et al., 2015).

Based on gene expression signature analysis, BrCa can be classified into intrinsic molecular subtypes (Perou et al., 2000; Sotiriou et al., 2003). According to the 12th St Gallen International Breast Cancer Conference, BrCa can be classified into the following five subtypes, which can facilitate the selection of treatment strategies: luminal‐A, luminal‐B [human epidermal growth factor receptor 2 (HER2)‐positive], luminal‐B (HER2‐negative), HER2‐positive, and triple negative (Goldhirsch et al., 2011). These intrinsic molecular subtypes are related to the biological features of BrCa and are essential for treatment selection.

Many studies have indicated that noncoding RNAs derived from the human genome are functional and play pivotal roles in various cellular activities, e.g. cell proliferation, movement, and death (Gebert and MacRae, 2019; Treiber et al., 2019). Among noncoding RNAs, microRNA (miRNA) are short RNA molecules (19–22‐nucleotide single‐stranded RNA molecules) that play roles in regulating protein‐coding and noncoding RNA expression in cells (Gebert and MacRae, 2019; Treiber et al., 2019). Importantly, a single miRNA regulates many RNA transcripts, and bioinformatics studies have shown that more than half of the RNA molecules transcribed from the genome are controlled by miRNA (Bartel, 2009). In cancer cells, intracellular RNA networks are disrupted due to the influence of abnormally expressed miRNA. These aberrantly expressed miRNA play critical roles in the malignant transformation of cancer cells.

To identify tumor‐suppressive or oncogenic miRNA in cancers, miRNA expression signatures provide valuable information. RNA‐sequencing technology is suitable for producing miRNA signatures. Recently, we reported the miRNA expression signature of triple‐negative BrCa (TNBC), and 104 miRNA (56 upregulated miRNA and 48 downregulated miRNA) were found to be significantly dysregulated in TNBC tissues (Toda et al., 2018). TNBC is a subtype of BrCa in which estrogen receptor (ER), progesterone receptor, and HER2 are not expressed; ~ 15–20% of BrCa cases are TNBC (Foulkes et al., 2010; Goldhirsch et al., 2011). TNBC is highly aggressive in nature, and metastases are frequently observed. Therefore, the prognosis of TNBC is worse than that of other subtypes of BrCa (Foulkes et al., 2010; Goldhirsch et al., 2011). Based on our TNBC signatures, we identified tumor‐suppressive miR‐204‐5p and novel oncogenic genes regulated by this miRNA (Toda et al., 2018). Interestingly, several miR‐204‐5p target genes were found to be closely associated with BrCa pathogenesis (Toda et al., 2018). The discovery of oncogenic networks mediated by tumor‐suppressive miRNA will contribute to the elucidation of the molecular mechanisms mediating the pathogenesis of BrCa.

Breast cancer is a heterogeneous cancer, and treatment strategies differ for each subgroup (Foulkes et al., 2010; Goldhirsch et al., 2011; Perou et al., 2000; Sotiriou et al., 2003). Thus, elucidation of the universal molecular pathways mediating BrCa will lead to the development of new treatment strategies for this disease. Accordingly, in this study, we created the RNA‐sequencing‐based miRNA expression signature of BrCa using clinical BrCa specimens, including ER‐positive, HER2‐positive, and TNBC specimens. In total, 64 miRNA were identified as candidate tumor‐suppressive miRNA in BrCa cells. Analysis of our BrCa signature revealed that several miRNA duplexes (guide strand/passenger strand) derived from pre‐miRNA were downregulated in BrCa tissues. Despite the general consensus that passenger strands derived from miRNA duplexes have no regulatory activity, our recent studies have revealed that some passenger strands actually function by targeting several genes (Mah et al., 2010; McCall et al., 2017).

Based on our current miRNA signature of BrCa, the expression levels of both strands of the miR‐101 duplex (miR‐101‐5p: the passenger strand and miR‐101‐3p: the guide strand) were significantly reduced in cancer tissues, suggesting that these miRNA have tumor‐suppressive functions. Many previous reports have demonstrated that miR‐101‐3p acts as a tumor‐suppressive miRNA in various cancers (Wang et al., 2018). In contrast to miR‐101‐3p, the functional significance of miR‐101‐5p and RNA networks regulated by this miRNA in cancer cells is poorly understood. Accordingly, in this study, we showed that ectopic expression of miR‐101‐5p attenuated aggressive phenotypes, e.g. proliferation, migration, and invasion, in BrCa cells. Moreover, GINS complex subunit 1 (GINS1) was directly controlled by miR‐101‐5p in BrCa cells, and its expression contributed to BrCa oncogenesis.

2. Materials and methods

2.1. Collection of clinical breast cancer specimens, breast epithelial specimens, and BrCa cell lines

To construct the miRNA expression signature of BrCa, 20 clinical tissue specimens (five specimens each for ER‐positive BrCa, HER2‐positive BrCa, TNBC, and normal breast epithelium) were collected following surgical resection at Gunma University Hospital.

To validate the expression levels of miRNA and target genes, 27 clinical specimens (18 BrCa specimens and nine normal breast epithelial tissues) were collected at Kagoshima University Hospital. Twenty‐one paraffin blocks of BrCa specimens were used for immunostaining. The clinical features of these patients are shown in Table 1. Informed consent was obtained from all patients. This study was approved by the Bioethics Committee of Gunma University (approval nos 2016‐023 and 2017‐167) and Kagoshima University (approval no. 160038:28‐65). The study methodologies conformed to the standards set by the Declaration of Helsinki.

Table 1.

Clinical features of 50 patients with BrCa.

  Age T factors Lymph node metastasis Stage ER PgR HER2 Ki67 Lymphatic invasion Venous invasion Nuclear Grade Remarks
BC1 66 1 Yes ⅡA Positive Positive Negative 5–10 1 0 3 RNA seq.
BC2 66 1 No Ⅰ Positive Positive Negative 18–23 0 0 2 RNA seq.
BC3 50 2 Yes ⅡB Positive Positive Negative 10–15 1 0 3 RNA seq.
BC4 47 2 Yes ⅡB Positive Positive Negative 15–20 1 0 2 RNA seq.
BC5 70 2 Yes ⅡB Positive Positive Negative 15–20 1 0 2 RNA seq.
BC6 69 2 No ⅡA Negative Negative Positive 58 1 0 3 RNA seq.
BC7 59 2 No ⅡA Positive Positive Positive 50–60 0 0 3 RNA seq.
BC8 48 2 No ⅡA Positive Negative Positive 22–27 1 1 3 RNA seq.
BC9 68 2 Yes ⅡB Positive Negative Positive 83 1 1 3 RNA seq.
BC10 67 2 No ⅡA Negative Negative Positive 20–30 0 0 3 RNA seq.
BC11 58 2 No ⅡA Negative Negative Negative 70–80 0 0 3 RNA seq.
BC12 44 2 No ⅡA Negative Negative Negative 70–80 0 0 3 RNA seq.
BC13 83 2 No ⅡA Negative Negative Negative 60 0 0 3 RNA seq.
BC14 66 2 No ⅡA Negative Negative Negative Unavailable 0 1 3 RNA seq.
BC15 47 2 No ⅡA Negative Negative Negative 70–80 0 0 3 RNA seq.
BC16 79 2 No IIA Positive Positive Negative 11 0 0 1 RT‐PCR/IHC
BC17 49 2 Yes ⅢA Positive Positive Negative 4 1 0 1 RT‐PCR/IHC
BC18 82 1a No Ⅰ Positive Positive Negative 10 0 0 1 RT‐PCR/IHC
BC19 56 2 No IIA Positive Positive Negative 13 0 0 3 RT‐PCR/IHC
BC20 44 1c No Ⅰ Positive Positive Negative 26 1 0 1 RT‐PCR/IHC
BC21 86 1c Yes IIA Positive Positive Negative 26 1 0 3 RT‐PCR/IHC
BC22 63 2 Yes IIIA Positive Negative Negative 90 1 0 3 RT‐PCR/IHC
BC23 46 2 Yes IIIA Positive Positive Negative Unavailable 1 0 3 RT‐PCR/IHC
BC24 62 2 Yes IIIC Positive Positive Negative 39 1 0 3 RT‐PCR/IHC
BC25 73 2 Yes IIIA Positive Positive Positive 8 1 0 1 RT‐PCR/IHC
BC26 43 4c Yes IIIC Negative Negative Positive Unavailable 1 0 3 RT‐PCR/IHC
BC27 46 2 Yes IIB Negative Negative Positive 35 1 0 3 RT‐PCR/IHC
BC28 70 2 No IIA Negative Negative Positive 52 0 0 3 RT‐PCR/IHC
BC29 69 1mi No I Negative Negative Positive 13 0 0 1 RT‐PCR/IHC
BC30 39 2 Yes IIIC Negative Negative Positive 35 1 1 2 RT‐PCR/IHC
BC31 59 1b Yes IIA Negative Negative Negative 98 1 1 3 RT‐PCR/IHC
BC32 64 4b No IIIB Negative Negative Negative 50 1 0 3 RT‐PCR/IHC
BC33 65 1c Yes IIA Negative Negative Negative 91 1 1 3 RT‐PCR/IHC
BC34 41 2 Yes ⅢC Negative Negative Negative Unavailable 1 1 3 IHC
BC35 38 1c No Ⅰ Negative Negative Negative Unavailable 0 0 3 IHC
BC36 39 2 No ⅡA Positive Positive Positive 28 0 0 1 IHC
Ｎ１ 50                     RNA seq.
Ｎ２ 26                     RNA seq.
Ｎ３ 62                     RNA seq.
Ｎ４ 65                     RNA seq.
Ｎ５ 52                     RNA seq.
Ｎ６ 79                     RT‐PCR
Ｎ７ 38                     RT‐PCR
Ｎ８ 85                     RT‐PCR
Ｎ９ 44                     RT‐PCR
Ｎ１０ 61                     RT‐PCR
Ｎ１１ 56                     RT‐PCR
Ｎ１２ 69                     RT‐PCR
Ｎ１３ 62                     RT‐PCR
Ｎ１４ 59                     RT‐PCR
Open in a new tab

Two BrCa cell lines, i.e. MDA‐MB‐231 and MCF‐7, were used in this study. MDA‐MB‐231 cells (acc. no. 92020424, Lot: 15J060) were obtained from Public Health England (Salisbury, UK). MCF‐7 cells (resource no. RCB1904, Lot: 13) were obtained from RIKEN BRC CELL BANK (Tsukuba, Ibaraki, Japan).

2.2. Construction of the miRNA expression signature for BrCa

The miRNA expression signatures of 20 samples with BrCa (Table 1) were generated by small RNA sequencing using HiSeq 2000 (Illumina, San Diego, CA, USA). Small RNA sequencing and data mining were performed as previously described, and a false discovery rate (FDR) less than 0.05 was considered significant (Goto et al., 2017; Koshizuka et al., 2017; Toda et al., 2018; Yonemori et al., 2017).

2.3. RNA preparation and quantitative reverse transcription polymerase chain reaction (qRT‐PCR)

Total RNA including miRNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in clinical specimens and ISOGEN reagent (NIPPON GENE, Tokyo, Japan) in BrCa cells. The qRT‐PCR was performed as previously described (Idichi et al., 2018; Yamada et al., 2018a,b,c). TaqMan probes and primers used in this study are listed in Table S1.

2.4. Transfection of BrCa cells with miRNA, small interfering RNA (siRNA), and plasmid vectors

The miRNA, siRNA, and vectors were transfected into cancer cells as described in our previous reports using the reagents listed in Table S1 (Idichi et al., 2018; Yamada et al., 2018a,b,c).

2.5. Assays of cell proliferation, cell cycle, migration, and invasion

Cell proliferation, migration, and invasion were assessed as described previously (Idichi et al., 2018; Yamada et al., 2018a,b,c).

2.6. Assay of miR‐101‐5p incorporation into the RNA‐induced silencing complex (RISC)

MDA‐MB‐231 cells were transfected with 10 nm control miRNA, miR‐101‐5p, or miR‐101‐3p. After 72 h, miRNA incorporated into the RISC were isolated using a human AGO2 miRNA isolation kit (Wako Pure Chemical Industries, Ltd., Osaka, Japan). Expression miR‐101‐5p was examined as described above (Idichi et al., 2018; Yamada et al., 2018a,b,c).

2.7. Isolation of putative oncogenic targets regulated by miR‐101‐5p in BrCa cells

Putative target genes possessing binding sequences to miR‐101‐5p were isolated using the TargetScan Human database ver.7.1 (http://www.targetscan.org/vert_71/). Gene expression data (protein‐coding RNAs) for BrCa clinical specimens were obtained by oligo‐microarray analyses.

2.8. Evaluation of miR‐101‐5p binding sites by luciferase reporter assays

The 3′ UTR of GINS1 and the 3′‐UTR lacking the putative miR‐101‐5p binding sites were cloned into the psiCHECK‐2 vector (C8021; Promega, Madison, WI, USA). Luciferase reporter assays were performed as previously described (Idichi et al., 2018; Yamada et al., 2018a,b,c). The cloned sequences are shown in Figs 4 and S1.

Figure 4.

Figure 4

Open in a new tab

Direct regulation of GINS1 by miR‐101‐5p in BrCa cells. (A) Downregulation of GINS1 protein 72 h after transfection with miR‐101‐5p in BrCa cells (MDA‐MB‐231 and MCF‐7). GAPDH was used as a loading control. (B) miR‐101‐5p binding site in the 3'‐UTR of GINS1 mRNA. (C) Dual luciferase reporter assays using vectors encoding the wild‐type or mutant miR‐101‐5p target site in the GINS1 3'‐UTR. Renilla luciferase values were normalized to firefly luciferase values. Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test. *P < 0.0001.

2.9. Clinical data analyses of BrCa

The clinical significance of miRNA and their target genes was investigated with The Cancer Genome Atlas (TCGA; https://tcga-data.nci.nih.gov/tcga/) in BrCa. Gene expression levels and clinical information obtained from cBioPortal (http://www.cbioportal.org/) and OncoLnc (http://www.oncolnc.org/) were applied. The data were downloaded on 28 September 2018.

2.10. Western blotting and immunohistochemistry

Western blotting and immunohistochemistry were performed as described previously (Idichi et al., 2018; Yamada et al., 2018a,b,c). Primary antibodies are listed in Table S1.

2.11. Genes affected by GINS1 expression in BrCa cells

Gene expression levels and clinical information were downloaded from cBioPortal (http://www.cbioportal.org/) on 8 January 2019. The normalized mRNA expression levels of RNA‐sequencing data were provided as Z‐scores. Gene set enrichment analysis (GSEA) was performed based on mRNA sequence data from cBioPortal. A heatmap of gene expression was constructed using the BrCa RNA‐sequence database. Overexpressed genes in BrCa tissues showing high GINS1 expression in TCGA were classified into known pathways using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database with the Enrichr program.

2.12. Statistical analysis

Mann–Whitney U tests were applied for comparisons between two groups. For multiple groups, one‐way analysis of variance and Tukey tests for post‐hoc analysis were applied. These analyses were performed with graphpad prism 7 (GraphPad Software, La Jolla, CA, USA) and jmp pro 14 (SAS Institute Inc., Cary, NC, USA). For other analyses, expert statview (version 5, SAS Institute, Inc.) was used.

3. Results

3.1. Creation of a miRNA expression signature for BrCa by small RNA sequencing

RNA sequencing was performed to create the miRNA expression signature of BrCa. We sequenced 20 small RNA libraries (15 BrCa specimens and five normal breast epithelium specimens). The clinical features of the specimens used to create the miRNA signature are summarized in Table 1.

We obtained between 10 112 255 and 15 495 422 total reads in this study. After filtering out noise (fragments that did not completely match the human genome sequence), between 4 781 591 and 13 003 597 miRNA reads were mapped on the human genome sequence (Table S2). Read sequences matching the human genome were categorized into small RNA according to their biological functions (Table S2). Finally, we constructed the miRNA expression signature of BrCa containing miRNA with markedly downregulated expression (Table 2; FDR < 0.05).

Table 2.

Downregulated miRNA in BrCa compared with normal breast.

miRNA miRBase accession Location Log2FC P‐value FDR
hsa‐miR‐204‐5p MIMAT0000265 9q21.12 −4.6141 2.58E‐12 9.51E‐10
hsa‐miR‐551b‐3p MIMAT0003233 3q26.2 −4.0638 7.63E‐13 3.93E‐10
hsa‐miR‐139‐5p MIMAT0000250 11q13.4 −3.9735 3.64E‐24 9.38E‐21
hsa‐miR‐378i MI0016902 22q13.2 −3.8250 9.48E‐07 6.60E‐05
hsa‐miR‐422a MI0001444 15q22.31 −3.8117 2.10E‐07 1.80E‐05
hsa‐miR‐451a MI0001729 17q11.2 −3.6452 2.03E‐12 8.73E‐10
hsa‐miR‐144‐3p MIMAT0000436 17q11.2 −3.5713 2.86E‐10 6.69E‐08
hsa‐miR‐4703‐3p MIMAT0019802 13q14.3 −3.5033 1.47E‐05 6.37E‐04
hsa‐miR‐144‐5p MIMAT0004600 17q11.2 −3.4272 2.24E‐09 3.21E‐07
hsa‐miR‐891a‐5p MIMAT0004902 Xq27.3 −3.3293 8.14E‐06 4.20E‐04
hsa‐miR‐335‐5p MIMAT0000765 7q32.2 −3.1273 8.99E‐09 9.65E‐07
hsa‐miR‐99a‐5p MIMAT0000097 21q21.1 −3.0151 3.80E‐12 1.22E‐09
hsa‐miR‐376c‐5p MIMAT0022861 14q32.31 −2.9571 4.66E‐04 1.13E‐02
hsa‐miR‐486‐5p MIMAT0002177 8p11.21 −2.9506 2.38E‐11 6.83E‐09
hsa‐miR‐944 MI0005769 3q28 −2.9246 1.17E‐07 1.04E‐05
hsa‐miR‐376b‐5p MIMAT0022923 14q32.31 −2.8728 7.38E‐04 1.64E‐02
hsa‐miR‐655‐3p MIMAT0003331 14q32.31 −2.8446 8.96E‐08 8.24E‐06
hsa‐miR‐139‐3p MIMAT0004552 11q13.4 −2.7660 1.69E‐04 4.93E‐03
hsa‐miR‐585‐3p MIMAT0003250 5q35.1 −2.7236 3.02E‐05 1.16E‐03
hsa‐miR‐224‐3p MIMAT0009198 Xq28 −2.6844 3.98E‐05 1.51E‐03
hsa‐miR‐4510 MI0016876 15q14 −2.6373 7.56E‐05 2.53E‐03
hsa‐miR‐202‐5p MIMAT0002810 10q26.3 −2.5628 4.56E‐04 1.12E‐02
hsa‐miR‐483‐3p MIMAT0002173 11p15.5 −2.5243 4.82E‐05 1.77E‐03
hsa‐miR‐215‐5p MIMAT0000272 1q41 −2.5094 1.23E‐08 1.26E‐06
hsa‐miR‐99a‐3p MIMAT0004511 21q21.1 −2.4961 4.85E‐08 4.63E‐06
hsa‐miR‐126‐5p MIMAT0000444 9q34.3 −2.4707 3.72E‐16 4.79E‐13
hsa‐miR‐452‐5p MIMAT0001635 Xq28 −2.3667 8.31E‐04 1.80E‐02
hsa‐miR‐488‐3p MIMAT0004763 1q25.2 −2.3654 1.12E‐03 2.33E‐02
hsa‐miR‐10b‐5p MIMAT0000254 2q31.1 −2.3495 1.11E‐05 5.21E‐04
hsa‐miR‐100‐5p MIMAT0000098 11q24.1 −2.3427 1.27E‐06 8.40E‐05
hsa‐miR‐133a‐3p MIMAT0000427

18q11.2

20q13.33

 −2.3206 5.81E‐07 4.15E‐05
hsa‐miR‐130a‐5p MIMAT0004593 11q12.1 −2.3094 1.26E‐03 2.59E‐02
hsa‐let‐7c‐5p MIMAT0000064 21q21.1 −2.2647 4.27E‐07 3.24E‐05
hsa‐miR‐10b‐3p MIMAT0004556 2q31.1 −2.2553 1.87E‐09 3.01E‐07
hsa‐miR‐5683 MI0019284 6p25.1 −2.1729 9.01E‐04 1.92E‐02
hsa‐miR‐101‐5p MIMAT0004513 1p31.3 −2.1712 2.44E‐10 6.29E‐08
hsa‐miR‐195‐5p MIMAT0000461 17p13.1 −2.0969 3.65E‐08 3.62E‐06
hsa‐miR‐19b‐3p MIMAT0000074

13q31.3

Xq26.2

 −2.0345 1.87E‐05 7.76E‐04
hsa‐miR‐145‐3p MIMAT0004601 5q32 −1.9876 8.16E‐09 9.37E‐07
hsa‐miR‐378a‐5p MIMAT0000731 5q32 −1.9654 2.36E‐05 9.51E‐04
hsa‐miR‐377‐5p MIMAT0004689 14q32.31 −1.9470 9.03E‐04 1.92E‐02
hsa‐miR‐193a‐3p MIMAT0000459 17q11.2 −1.9030 1.24E‐05 5.50E‐04
hsa‐miR‐125b‐2‐3p MIMAT0004603 21q21.1 −1.8634 1.90E‐05 7.76E‐04
hsa‐miR‐376c‐3p MIMAT0000720 14q32.31 −1.8379 2.69E‐04 7.15E‐03
hsa‐miR‐130a‐3p MIMAT0000425 11q12.1 −1.8198 1.61E‐05 6.78E‐04
hsa‐miR‐378a‐3p MIMAT0000732 5q32 −1.7951 7.20E‐04 1.61E‐02
hsa‐miR‐26a‐5p MIMAT0000082

3p22.2

12q14.1

 −1.7197 1.21E‐04 3.72E‐03
hsa‐miR‐497‐5p MIMAT0002820 17p13.1 −1.7189 8.34E‐06 4.21E‐04
hsa‐miR‐126‐3p MIMAT0000445 9q34.3 −1.7138 1.48E‐05 6.37E‐04
hsa‐miR‐154‐5p MIMAT0000452 14q32.31 −1.6895 7.67E‐04 1.69E‐02
hsa‐miR‐376a‐3p MIMAT0000729 14q32.31 −1.6814 1.73E‐03 3.33E‐02
hsa‐miR‐136‐3p MIMAT0004606 14q32.2 −1.5735 3.54E‐04 9.02E‐03
hsa‐miR‐218‐5p MIMAT0000275

4p15.31

5q34

 −1.5112 1.13E‐05 5.22E‐04
hsa‐miR‐299‐3p MIMAT0000687 14q32.31 −1.4961 5.46E‐04 1.28E‐02
hsa‐miR‐143‐3p MIMAT0000435 5q32 −1.4679 2.10E‐04 5.94E‐03
hsa‐miR‐143‐5p MIMAT0004599 5q32 −1.4443 2.24E‐04 6.20E‐03
hsa‐miR‐152‐3p MIMAT0000438 17q21.32 −1.4362 4.80E‐05 1.77E‐03
hsa‐miR‐101‐3p MIMAT0000099

1p31.3

9p24.1

 −1.3746 1.51E‐06 9.59E‐05
hsa‐miR‐195‐3p MIMAT0004615 17p13.1 −1.3699 3.85E‐04 9.62E‐03
hsa‐miR‐30e‐3p MIMAT0000693 1p34.2 −1.3396 5.65E‐07 4.15E‐05
hsa‐miR‐424‐5p MIMAT0001341 Xq26.3 −1.3074 2.40E‐03 4.45E‐02
hsa‐miR‐574‐3p MIMAT0003239 4p14 −1.2822 7.99E‐05 2.64E‐03
hsa‐let‐7g‐3p MIMAT0004584 3p21.2 −1.0676 2.29E‐03 4.31E‐02
hsa‐miR‐374a‐5p MIMAT0000727 Xq13.2 −1.0478 3.51E‐04 9.02E‐03
Open in a new tab

In total, 64 miRNA were significantly downregulated in BrCa tissues (Table 2). Analysis of our BrCa signature revealed that 11 miRNA duplexes (guide strand/passenger strand) derived from pre‐miRNA were downregulated in BrCa tissues (Table S3).

3.2. Expression levels of both strands of the miR‐101 duplex (miR‐101‐5p and miR‐101‐3p) in BrCa tissues and cell lines

In the human genome, pre‐miR‐101 is located at two chromosomal loci, pre‐miR‐101‐1 (1p31.3) and pre‐miR‐101‐2 (9q24.1; Fig. S2). In this study, we focused on miR‐101‐1‐5p (mature sequence: 5′‐caguuaucacagugcugaugcu‐3′) and miR‐101‐3p (5′‐uacaguacugugauaacugaa‐3′). According to the TargetScan database, miR‐101‐5p is the passenger strand (minor strand), whereas miR‐101‐3p is the guide strand (major strand).

To verify the credibility of the BrCa signature, expression levels of miR‐101‐5p and miR‐101‐3p in clinical specimens (18 BrCa specimens and nine normal breast epithelial specimens) and two cell lines (MDA‐MB‐231 and MCF‐7) were measured. Table 1 shows the information on the clinical specimens used for this study. The expression levels of the two miRNA, i.e. miR‐101‐5p (P = 0.0396) and miR‐101‐3p (P = 0.0047), were significantly reduced in BrCa tissues (Fig. 1A,B). Moreover, we confirmed that the expression levels were low in the two cell lines (Fig. 1A,B).

Figure 1.

Figure 1

Open in a new tab

The clinical significance of miR‐101‐5p and miR‐101‐3p expression in BrCa. (A,B) Downregulation of miR‐101‐5p and miR‐101‐3p expression in BrCa specimens and two cell lines (MDA‐MB‐231 and MCF‐7). Expression of RNU48 was used as an internal control. (C,D) Kaplan–Meier overall survival curve analyses of patients with BrCa using data from TCGA database. Patients were divided into two groups according to miRNA expression and analyzed. (E–G) Functional assays of miR‐101‐5p and miR‐101‐3p in BrCa cells (MDA‐MB‐231 and MCF‐7). Cell proliferation, migration, and invasion were significantly blocked by ectopic expression of miR‐101‐5p or miR‐101‐3p. Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test. *P < 0.01, **P < 0.0001.

Next, we analyzed whether miRNA expression affected the prognosis of patients with BrCa by TCGA database analysis. Kaplan–Meier overall survival curves showed that low expression levels of miR‐101‐5p (P = 0.0316) and miR‐101‐3p (P = 0.0280) were associated with overall survival in patients with BrCa (Fig. 1C,D).

3.3. Expression of miR‐101‐5p and miR‐101‐3p inhibited the aggressive phenotypes of BrCa cells

To verify that miR‐101‐3p and miR‐101‐5p had tumor‐suppressor functions in BrCa cells, we performed ectopic expression assays using mature miRNA transfection into BrCa cell lines (MDA‐MB‐231 and MCF‐7). Cell proliferation assays showed that miR‐101‐5p‐ and miR‐101‐3p‐transfected BrCa cells exhibited reduced cell growth compared with miR‐control‐transfected BrCa cells (Fig. 1E). We also performed cell cycle assays to determine the effects of miR‐101‐5p expression. Our data showed that G0/G1 phase arrest was observed following miR‐101‐5p expression in MDA‐MB‐231 cells (Fig. S3).

Additionally, cell migratory and invasive abilities were markedly attenuated in cells transfected with miR‐101‐5p and miR‐101‐3p (Fig. 1F,G).

3.4. MicroR‐101‐5p was incorporated into the RNA‐induced silencing complex (RISC) in BrCa cells

Next, we aimed to verify that miR‐101‐5p (passenger strand) had actual functions in BrCa cells. It is essential that miRNA are incorporated into the RISC to control target genes. Ago2 is a fundamental component of the RISC. Therefore, immunoprecipitation using anti‐Ago2 antibodies was performed after transfection of miR‐101‐5p into MDA‐MB‐231 cells. The amount of miR‐101‐5p incorporated into the protein was measured by PCR. Levels of miR‐101‐5p in the immunoprecipitates were much higher than those in mock‐, miR‐control‐ or miR‐101‐3p‐transfected cells (P < 0.0001; Fig. S4).

3.5. Candidate oncogenic targets regulated by miR‐101‐5p in BrCa cells

The TargetScan Human 7.1 database predicted that 2896 candidate genes had miR‐101‐5p binding sites in the 3′‐UTR. We also investigated genes that were upregulated in clinical BrCa specimens by microarray analysis [Gene Expression Omnibus (GEO) accession number: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE118539] and compiled a list of 1121 genes. Finally, 104 oncogenic targets regulated by miR‐101‐5p were identified in BrCa cells (Table 3). Our selection strategy for miR‐101‐5p targets is shown in Fig. S5.

Table 3.

Identification of target genes (TargetScan + Upregulated mRNA FC > 1.5).

Gene Symbol Ensembl ID Gene name Total sites Fold change
HIST1H2AG ENST00000359193 Histone cluster 1, H2ag 2 5.561
PBK ENST00000301905 PDZ binding kinase 2 4.654
SPP1 ENST00000360804 Secreted phosphoprotein 1 1 4.244
CXCL9 ENST00000264888 Chemokine (C‐X‐C motif) ligand 9 1 3.895
LMNB1 ENST00000460265 Lamin B1 1 3.826
GINS1 ENST00000262460 GINS1 (Psf1 homolog) 1 3.790
HMGB3 ENST00000325307 High Mobility Group Box 3 1 3.380
SBK1 ENST00000341901 SH3 domain binding kinase 1 1 3.313
LRP8 ENST00000306052 Low density lipoprotein receptor‐related protein 8, apolipoprotein e receptor 1 3.285
TRIM59 ENST00000309784 Tripartite motif containing 59 1 3.124
ESRP1 ENST00000517556 Epithelial Splicing Regulatory Protein 1 1 3.081
ESPL1 ENST00000552462 Extra spindle pole bodies homolog 1 (Saccharomyces cerevisiae) 1 3.080
MAD2L1 ENST00000504707 MAD2 mitotic arrest deficient‐like 1 (yeast) 1 2.994
ATAD2 ENST00000287394 ATPase family, AAA domain containing 2 3 2.722
SELL ENST00000236147 Selectin L 1 2.633
COL5A1 ENST00000618395 Collagen, type V, alpha 1 1 2.519
PARPBP ENST00000327680 PARP1 binding protein 1 2.472
TFEC ENST00000393485 Transcription factor EC 3 2.459
PMAIP1 ENST00000316660 Phorbol‐12‐myristate‐13‐acetate‐induced protein 1 1 2.425
SLC7A11 ENST00000280612 Solute carrier family 7 (anionic amino acid transporter light chain, xc‐ system), member 11 2 2.399
SLC37A2 ENST00000526405 Solute carrier family 37 (glucose‐6‐phosphate transporter), member 2 1 2.390
HIST2H4B ENST00000578186 Histone cluster 2, H4b 2 2.370
DONSON ENST00000442660 Downstream neighbor of SON 1 2.336
LAX1 ENST00000442561 Lymphocyte transmembrane adaptor 1 2 2.326
LILRB1 ENST00000421584 Leukocyte immunoglobulin‐like receptor, subfamily B (with TM and ITIM domains), member 1 1 2.318
PNP ENST00000554056 Purine nucleoside phosphorylase 1 2.318
PAG1 ENST00000220597 Phosphoprotein associated with glycosphingolipid microdomains 1 1 2.316
CHML ENST00000366553 Choroideremia‐like (Rab escort protein 2) 3 2.312
HIST1H2AH   0 histone cluster 1, H2ah 1 2.312
DIO2 ENST00000557010 Deiodinase, iodothyronine, type II 1 2.278
ASPN ENST00000375544 asporin 1 2.249
CXADR ENST00000400165 Coxsackie virus and adenovirus receptor 1 2.248
IFI44L ENST00000476521 Interferon‐induced protein 44‐like 1 2.222
KNTC1 ENST00000333479 Kinetochore associated 1 1 2.221
HELLS ENST00000394036 Helicase, lymphoid‐specific 1 2.214
MTL5 ENST00000255087 Metallothionein‐like 5, testis‐specific (tesmin) 1 2.201
CXCR6 ENST00000438735 Chemokine (C‐X‐C motif) receptor 6 1 2.189
ADAM12 ENST00000368679 ADAM metallopeptidase domain 12 1 2.174
LILRB2 ENST00000493242 Leukocyte immunoglobulin‐like receptor, subfamily B (with TM and ITIM domains), member 2 1 2.141
ITGA4 ENST00000614742 Integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA‐4 receptor) 1 2.127
TMEM97 ENST00000226230 Transmembrane protein 97 1 2.121
HIST1H2AK ENST00000618958 Histone cluster 1, H2ak 1 2.118
FAM84A ENST00000331243 Family with sequence similarity 84, member A 1 2.089
CKAP2 ENST00000258607 cytoskeleton associated protein 2 2 2.000
PTPRC ENST00000442510 Protein tyrosine phosphatase, receptor type, C 1 1.989
IGSF6 ENST00000268389 Immunoglobulin superfamily, member 6 1 1.988
TPD52 ENST00000448733 Tumor Protein D52 1 1.958
SLC20A1 ENST00000490674 Solute carrier family 20 (phosphate transporter), member 1 1 1.934
LCP2 ENST00000520322 Lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) 1 1.926
OCIAD2 ENST00000381464 OCIA domain containing 2 1 1.926
SLC17A9 ENST00000488738 Solute carrier family 17 (vesicular nucleotide transporter), member 9 1 1.896
SSTR2 ENST00000357585 Somatostatin receptor 2 2 1.894
NLRC3 ENST00000615877 NLR family, CARD domain containing 3 1 1.874
VANGL1 ENST00000310260 VANGL planar cell polarity protein 1 1 1.861
ZFP69B ENST00000469416 ZFP69 zinc finger protein B 2 1.848
CEACAM7 ENST00000006724 Carcinoembryonic antigen‐related cell adhesion molecule 7 1 1.846
SORD ENST00000562107 Sorbitol dehydrogenase 2 1.844
AARD ENST00000378279 Alanine‐ and arginine‐rich domain containing protein 2 1.830
MMS22L ENST00000275053 MMS22‐like, DNA repair protein 2 1.824
ANGPT2 ENST00000325203 Angiopoietin 2 1 1.824
NCAPG2 ENST00000467785 Non‐SMC condensin II complex, subunit G2 1 1.804
HIST1H2BN ENST00000396980 Histone cluster 1, H2bn 1 1.790
CENPW ENST00000368325 Centromere protein W 2 1.790
IFI44 ENST00000485662 Interferon‐induced protein 44 1 1.779
KCNE4 ENST00000281830 Potassium voltage‐gated channel, Isk‐related family, member 4 1 1.776
MGAT4A ENST00000409391 Mannosyl (alpha‐1,3‐)‐glycoprotein beta‐1,4‐N‐acetylglucosaminyltransferase, isozyme A 2 1.770
TAGAP ENST00000326965 T‐cell activation RhoGTPase activating protein 1 1.760
FYB ENST00000351578 FYN binding protein 1 1.748
CD84 ENST00000368047 CD84 molecule 1 1.746
AMMECR1 ENST00000262844 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 2 1.740
CYTIP ENST00000264192 Cytohesin 1‐interacting protein 2 1.734
SKA2 ENST00000583976 Spindle and kinetochore associated complex subunit 2 3 1.706
ANP32E ENST00000436748 Acidic (leucine‐rich) nuclear phosphoprotein 32 family, member E 1 1.706
FAM83B ENST00000306858 Family with sequence similarity 83, member B 1 1.702
BCL3 ENST00000164227 B‐cell CLL/lymphoma 3 1 1.701
HEYL ENST00000372852 Hairy/enhancer‐of‐split related with YRPW motif‐like 1 1.691
BORA ENST00000613797 Bora, aurora kinase A activator 1 1.658
FAXC ENST00000389677 Failed axon connections homolog (Drosophila) 1 1.657
PRKDC ENST00000338368 protein kinase, DNA‐activated, catalytic polypeptide 1 1.643
SFMBT1 ENST00000394752 Scm‐like with four mbt domains 1 1 1.639
CCRL2 ENST00000400882 Chemokine (C‐C motif) receptor‐like 2 1 1.636
GEN1 ENST00000381254 GEN1 Holliday junction 5' flap endonuclease 1 1.629
MSH2 ENST00000543555 mutS homolog 2 1 1.623
SLC22A15 ENST00000369503 Solute carrier family 22, member 15 1 1.615
TMEM154 ENST00000304385 Transmembrane protein 154 2 1.592
MAGOHB ENST00000537852 Mago‐nashi homolog B (Drosophila) 1 1.583
AK2 ENST00000373449 Adenylate kinase 2 1 1.577
USB1   0 U6 snRNA biogenesis 1 1 1.577
IL10RA ENST00000227752 Interleukin 10 receptor, alpha 1 1.575
FAM122B ENST00000465128 Family with sequence similarity 122B 1 1.574
TRPV2 ENST00000338560 transient receptor potential cation channel, subfamily V, member 2 2 1.559
XRCC3 ENST00000554811

X‐ray repair complementing defective repair in Chinese

hamster cells 3

 1 1.556
KCTD5 ENST00000301738 Potassium channel tetramerization domain containing 5 1 1.550
MYCBP ENST00000465771 MYC binding protein 1 1.548
NDC1 ENST00000371429 NDC1 transmembrane nucleoporin 2 1.545
SRPK1 ENST00000373822 SRSF protein kinase 1 1 1.532
FGFR1OP ENST00000349556 FGFR1 oncogene partner 1 1.531
PRPS2 ENST00000380668 Phosphoribosyl pyrophosphate synthetase 2 1 1.529
TNFSF13B ENST00000486502 tumor necrosis factor (ligand) superfamily, member 13b 2 1.527
SLC36A1 ENST00000243389 solute carrier family 36 (proton/amino acid symporter), member 1 1 1.526
CBX3 ENST00000481057 Chromobox homolog 3 1 1.516
EPT1 ENST00000613142 ethanolaminephosphotransferase 1 (CDP‐ethanolamine‐specific) 3 1.516
CD300E ENST00000392619 CD300e molecule 1 1.510
WHSC1 ENST00000312087 Wolf‐Hirschhorn syndrome candidate 1 2 1.510
Open in a new tab

Next, we examined the relationship between the pathogenesis of BrCa and these targets using TCGA database. Among 104 targets, seven genes [High Mobility Group Box 3 (HMGB3): P = 0.0013, Epithelial splicing regulatory protein 1 (ESRP1): P = 0.0013, GINS1: P = 0.0126, Tumor Protein D52 (TPD52): P = 0.0223, Serine/Arginine‐Rich Splicing Factor Kinase 1 (SRPK1): P = 0.0225, Vang‐like protein 1 (VANGL1): P = 0.0447, and Mago Homolog B (MAGOHB): P = 0.0471] were significantly associated with poor prognosis in patients with BrCa (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

Relationship between the expression levels of seven genes (HMGB3, ESRP1, GINS1, TPD52, SRPK1, VANGL1, and MAGOHB) and clinical significance based on data from TCGA database. The Kaplan–Meier overall survival curve analyses of patients with BrCa using data from TCGA database. Patients were divided into two groups according to gene expression and analyzed.

Moreover, we confirmed that three genes (i.e. GINS1, TPD52, and SRPK1) were significantly downregulated by miR‐101‐5p transfection into both MDA‐MB‐231 and MCF‐7 cells (Fig. 3). These three genes are essential for biological analysis of BrCa cells. We further analyzed the oncogenic functions of GINS1 in BrCa cells because this gene has not been described frequently in studies of cancer.

Figure 3.

Figure 3

Open in a new tab

Regulation of seven genes (HMGB3, ESRP1, GINS1, TPD52, SRPK1, VANGL1, and MAGOHB) by miR‐101‐5p transfection in BrCa cells (MDA‐MB‐231 and MCF‐7). Expression levels of seven genes were evaluated by qRT‐PCR (72 h after miR‐101‐5p transfection). GUSB was used as a loading control. Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test. *P < 0.01.

3.6. Direct regulation of GINS1 by miR‐101‐5p in BrCa cells

Expression levels of GINS1 mRNA and GINS1 protein were significantly reduced by miR‐101‐5p transfection (Figs 3 and 4A).

TargetScan database analysis showed that one putative miR‐101‐5p binding site was present in the 3′‐UTR of GINS1 (Figs 4B and Fig. S1). Additionally, luciferase reporter assays showed that the luminescence intensity was markedly decreased by cotransfection with miR‐101‐5p and a vector carrying wild‐type GINS1 3′‐UTR. In contrast, the vector with a deleted miR‐101‐5p target site showed no change in luminescence intensity (Fig. 4C). These data indicated that GINS1 was directly regulated by miR‐101‐5p in BrCa cells.

We also investigated the direct regulation of TPD52 and SRPK1 by miR‐101‐5p in BrCa cells. The luminescence intensities were significantly reduced by cotransfection with miR‐101‐5p and vectors carrying wild‐type TPD52 and SRPK1 3′‐UTR, suggesting that these two genes were directly regulated by miR‐101‐5p (Fig. S6).

3.7. Expression and clinical significance of GINS1/GINS1 in BrCa specimens

We evaluated overexpression of GINS1 in BrCa specimens (the same samples used as for validation of miR‐101‐5p expression; Fig. 1A). GINS1 expression was significantly upregulated in BrCa issues compared with normal tissues (P = 0.0020; Fig. 5A). Spearman's rank tests showed a tendency toward an inverse correlation between GINS1 and miR‐101‐5p expression (P = 0.0532, r = −0.379; Fig. 5B). We also investigated the inverse correlation between GINS1 and miR‐101‐5p expression in BrCa clinical specimens using TCGA database. An inverse correlation was detected between expression of miR‐101‐5p and GINS1 by Spearman’s rank tests (P = 0.00103, r = −0.082; Fig. S7).

Figure 5.

Figure 5

Open in a new tab

Expression and significance of GINS1 in BrCa clinical specimens. (A) Expression levels of GINS1 in BrCa clinical specimens and two BrCa cell lines (MDA‐MB‐231 and MCF‐7). GUSB was used as an internal control. (B) Spearman’s rank test showed the negative correlation between GINS1 expression and miR‐101‐5p. (C) Forest plot of multivariate Cox proportional hazards regression analysis of overall survival using data from TCGA database.

A multivariate Cox proportional hazards model showed that high expression of GINS1 was an independent predictive factor for survival [hazard ratio (HR): 1.64, 95% confidence interval (CI): 1.12–2.41, P = 0.0102], as were well‐known clinical prognostic factors such as N stage and M stage (Fig. 5C). Next, we investigated the expression levels of GINS1 in BrCa clinical specimens by immunostaining. GINS1 was strongly overexpressed in several cancer lesions compared with that in adjacent noncancerous lesions (Fig. 6). The clinical features of the specimens used to immunostaining are summarized in Table 1.

Figure 6.

Figure 6

Open in a new tab

Expression of GINS1 in clinical BrCa tissues. Immunohistochemistry staining of GINS1 in BrCa specimens. Overexpression of GINS1 was observed in cancer cells, whereas negative or low expression of GINS1 was observed in normal cells. Scale bars of ×40 and ×400 represent 1 mm and 100 µm, respectively.

3.8. Effects of GINS1 silencing in BrCa cells

To validate the oncogenic functions of GINS1 in BrCa cells, we used knockdown assays with siRNA in two BrCa cell lines, MDA‐MB‐231 and MCF‐7 (Fig. 5A). The two siRNA, siGINS1‐1 and siGINS‐2, used in this assay significantly suppressed GINS1/GINS1 expression in BrCa cells (Fig. 7A,B).

Figure 7.

Figure 7

Open in a new tab

Effects of GINS1 silencing in BrCa cell lines. (A) MicroRNA expression of GINS1 72 h after transfection with si‐GINS1‐1 and si‐GINS1‐2 in two BrCa cell lines (MDA‐MB‐231 and MCF‐7). GUSB was used an internal control (*P < 0.0001). (B) GINS1 protein expression was evaluated by western blot analysis 72 h after transfection with si‐GINS1‐1 and si‐GINS1‐2 into BrCa cell lines. GAPDH was used as a loading control. (C) Cell proliferation was identified by XTT assays 72 h after transfection with siGINS1‐1 and siGINS1‐2 (*P < 0.0001). (D) Cell migration activity was determined using migration assays (*P < 0.001, **P < 0.0001). (E) Cell invasion was determined by Matrigel invasion assays (*P < 0.01, **P < 0.0001). Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test.

Functional assays showed that malignant phenotypes of BrCa cells (e.g. cell proliferation, migration, and invasive abilities) were significantly blocked by siGINS1 transfection in BrCa cells (Fig. 7C–E). Furthermore, cell cycle assays showed that G0/G1 phase arrest was detected in siGINS1‐transfected cells (Fig. S3).

Similar results were observed in another cell line, MDA‐MB‐157. Indeed, ectopic expression of miR‐101‐5p and knockdown of GINS1 significantly blocked cancer cell aggressive phenotypes in MDA‐MB‐157 cells (Fig. S8).

3.9. Genes affected by GINS1 expression in BrCa clinical specimens

Finally, we identified the differentially expressed genes that were affected by GINS1 in BrCa. Our strategy is shown in Fig. S9. GSEA for the differentially expressed genes in BrCa tissues showing high expression of GINS1 in TCGA identified 11 signaling pathways (Fig. S10). We categorized GINS1‐regulated genes using KEGG pathways. In total, seven pathways were identified based on overexpressed genes in BrCa tissues showing high GINS1 expression in TCGA (Fig. 8A). In particular, genes involved in DNA replication pathways were identified by heatmap analysis (Fig. 8B).

Figure 8.

Figure 8

Open in a new tab

Genes affected by GINS1 expression in BrCa clinical specimens. (A) Identification of overexpressed genes affected by GINS1 expression in BrCa tissues in TCGA‐BrCa and categorized by KEGG pathways. (B) Heatmap analysis of genes involved in DNA replication pathways. (C) The clinical significance of MCM4, MCM6, and RFC3 expression in BrCa. Kaplan–Meier overall survival curve analyses of patients with BrCa using data from TCGA database. Patients were divided into two groups according to miRNA expression and analyzed.

Among these genes involved in DNA replication pathways, we investigated the clinical significance of the relationship between gene expression and prognosis of the patients with BrCa by TCGA database analysis. High expression of four genes (GINS1, MCM4, MCM6, and RFC3) was significantly associated with poor prognosis in patients with BrCa (Fig. 8C).

4. Discussion

Notably, a single miRNA regulates a wide range of different RNA transcripts (protein‐coding and non‐protein‐coding genes) in various normal and abnormal cells. Based on the unique nature of miRNA, novel RNA networks in human cancer cells can be identified from analysis of relevant miRNA. Currently available high‐throughput technologies, e.g. oligo‐microarrays, PCR‐based arrays, and RNA‐sequencing, have enabled the construction of miRNA expression signatures of BrCa (Ma et al., 2018), revealing the abnormal expression of many miRNA (Adhami et al., 2018; Gupta et al., 2019; Khordadmehr et al., 2019; Klinge, 2018; Kurozumi et al., 2017; Mehrgou and Akouchekian, 2017). One approach to identify the most important miRNA from a large number of candidate miRNA is to identify crossovers of miRNA that have been reported in multiple independent studies. Previous studies have shown that miR‐139‐5p, miR‐195‐3p, miR‐205‐3p, and miR‐99a‐5p are frequently downregulated and function as tumor‐suppressive miRNA in BrCa cells(Adhami et al., 2018; Gupta et al., 2019; Khordadmehr et al., 2019; Klinge, 2018; Kurozumi et al., 2017; Mehrgou and Akouchekian, 2017). These miRNA were included in the signature we created in this study.

Furthermore, a major advantage of this signature is that it contained multiple passenger strands of miRNA derived from miRNA duplexes, e.g. miR‐99a‐3p, miR‐101‐5p, miR‐144‐5p, and miR‐145‐3p. As a general theory of miRNA biogenesis, the guide strand of miRNA derived from the miRNA duplex is incorporated into the RISC and regulates gene expression (Bhayani et al., 2012; Mah et al., 2010; McCall et al., 2017). In contrast, the passenger strand is degraded and does not regulate genes in cells (Bhayani et al., 2012; Mah et al., 2010; McCall et al., 2017). However, our recent studies have shown that some passenger miRNA have tumor‐suppressive functions in cancer cells (e.g. miR‐144‐5p, miR‐145‐3p, miR‐150‐3p, and miR‐455‐5p) (Arai et al., 2019; Misono et al., 2018; Misono et al., 2019; Uchida et al., 2019). These miRNA and their target oncogenic genes are closely associated with cancer pathogenesis (Arai et al., 2019; Misono et al., 2018; Misono et al., 2019; Uchida et al., 2019). In the future, we will attempt to clarify the new molecular networks of BrCa using passenger strands of miRNA as indicators.

We focused on miR‐101‐5p and explored new aspects of this miRNA in BrCa cells. Many studies have shown that downregulation of miR‐101‐3p (the guide strand) occurs frequently in many cancers and that this miRNA acts as a tumor suppressor (Wang et al., 2018). Previous studies have clarified that miR‐101‐3p regulates various pivotal oncogenes and that downregulation of this miRNA affects cancer cell proliferation, metastasis, drug resistance, and angiogenesis via targeting of several oncogenic targets, e.g. EZH2, STMN1, VHL, SOX2, and DNMT3A (Wang et al., 2018). In BrCa, downregulation of miR‐101‐3p was detected in all subtypes of BrCa tissues, and miR‐101‐3p acted as a tumor suppressor (Liu et al., 2015; Liu et al., 2016; Ren et al., 2012; Zhang et al., 2019, 2015, 2019, 2015). Compared with reports of miR‐101‐3p, few studies have reported the tumor‐suppressive functions of miR‐101‐5p and its target molecules in cancer cells. More recently, downregulation of miR‐101‐5p was reported in non‐small cell lung carcinoma tissues compared with that in normal tissues (Chen et al., 2019). Overexpression of miR‐101‐5p was shown to suppress the aggressive phenotypes of cancer cells (in vitro) and pulmonary metastasis (in vivo) by regulating CXCL6 (Chen et al., 2019). Our data also showed that miR‐101‐5p acted as an antitumor miRNA in BrCa cells. Notably, both strands of miRNA derived from the miR‐101 duplex were found to have tumor‐suppressive functions in cancer cells.

Next, we aimed to elucidate miR‐101‐5p‐regulated oncogenes and oncogenic pathways in BrCa cells. Analysis of our miRNA target search revealed that seven genes (HMGB3, ESRP1, GINS1, TPD52, SRPK1, VANGL1, and MAGOHB) were closely associated with poor prognosis. Among these targets, three genes (GINS1, TPD52, and SRPK1) were strongly controlled by miR‐101‐5p in BrCa cells. Aberrant expression of TPD52 (encoding TPD52) has been reported in a wide range of cancers, including BrCa, and several tumor‐suppressive miRNA have been reported to be involved in regulating the expression of these genes (Balleine et al., 2000; Byrne et al., 2014; Li et al., 2016; Roslan et al., 2014). SRPK1 (encoding serine‐arginine protein kinase 1) is involved in the regulation of several mRNA processing pathways, and its overexpression has been reported in multiple cancers (Patel et al., 2019). High expression of SRPK1 is correlated with poor disease outcomes in patients with BrCa (Hayes et al., 2007; van Roosmalen et al., 2015). Knockdown of SRPK in BrCa cells inhibits metastasis to distant organs (Hayes et al., 2007; van Roosmalen et al., 2015). Further functional analyses of these genes will reveal the biological characteristics of BrCa. Starting from antitumor miRNA and using TCGA database analyses, we were able to identify effective prognostic markers and therapeutic targets for BrCa, indicating that our miRNA‐based strategy was feasible.

In this study, we focused on GINS1 and showed that its aberrant expression was closely related to BrCa malignant phenotypes. Chromosomal DNA replication is a tightly controlled essential process in the eukaryotic cell cycle, and many proteins are involved in each step of DNA replication (Labib and Gambus, 2007; MacNeill, 2010; Seo and Kang, 2018; Sun et al., 2016). The GINS complex (SLD5, GINS1, GINS2, and GINS3) is involved in the minichromosome maintenance complex and Cdc45 with proteins in a replisome progression complex (Labib and Gambus, 2007; MacNeill, 2010; Seo and Kang, 2018; Sun et al., 2016). A previous study of GINS1 in BrCa cells showed that knockdown of GINS1 inhibited BrCa cell growth by delaying DNA replication (Nakahara et al., 2010). This result was consistent with our current data. Another study showed that high expression of GINS1 in cancer cells promoted cell proliferation, transplantation, and metastatic properties (Nagahama et al., 2010). Overexpression of PSF1 was reported non‐small lung cancers, and its expression was useful as a prognostic marker (Kanzaki et al., 2016). These findings indicated that aberrantly expressed GINS1 was involved in cancer pathogenesis.

Anlotinib is a newly developed multitarget receptor tyrosine kinase inhibitor used for patients with treatment failure non‐small cell lung cancer with metastases (Shen et al., 2018). Interestingly, GINS1 was identified as an anlotinib‐mediated downstream gene, and knockdown of GINS1 markedly inhibited the proliferation of synovial sarcoma cells (Tang et al., 2019). Aberrant expression of cell cycle‐regulated genes is a common molecular mechanism of cancer cell malignancies, and these genes are potential cancer therapeutic targets. Cyclin‐dependent kinases, i.e. CDK4 and CDK6, are essential for transition from the G0/G phase to the S phase of the cell cycle. Recently, several CDK4/6 inhibitors (e.g. abemaciclib, palbociclib, and ribociclib) have been developed, and several clinical trials have demonstrated the therapeutic effects of these inhibitors on hormone receptor‐positive/HER‐negative BrCa (Iwata, 2018; Matutino et al., 2018; Spring et al., 2019). Clinical trials of CDK4/6 inhibitors are also progressing in other subtypes of BrCa (Iwata, 2018; Spring et al., 2019). Our current data showed that knockdown of GINS1 could markedly suppress malignant phenotypes in BrCa cells by affecting several cell cycle‐ and DNA replication‐controlled genes. Controlling genes involved in DNA replication may represent a potential approach for cancer treatment. Thus, GINS1 could be a novel diagnostic and therapeutic target for patients with BrCa.

5. Conclusion

We produced a novel RNA‐sequencing‐based BrCa miRNA signature. Our signature revealed that several novel miRNA, including passenger strands of miRNA, were downregulated in BrCa tissues. The BrCa miRNA signature created in this study established a basis for exploring new molecular RNA networks in BrCa. This is the first report demonstrating that miR‐101‐5p (the passenger strand of the miR‐101 duplex) acted as a tumor‐suppressive miRNA in BrCa cells. Several oncogenic targets regulated by miR‐101‐5p were closely associated with BrCa pathogenesis and oncogenesis. Moreover, we demonstrated that GINS1, which we identified from analyses of genes regulated by miR‐101‐5p, may be a novel diagnostic and therapeutic target in BrCa. Our approach based on analysis of miRNA signatures could contribute to elucidation of the molecular pathogenesis of cancer.

Conflict of interest

The authors declare no conflict of interest. NN is an employee of MSD KK, a subsidiary of Merck & Co., Inc., and reports personal fees from MSD KK, outside this study.

Author contributions

Conceptualization, NS, SK, and SN; methodology, NS; validation, HT, SK, and NN; formal analysis, YY, NN, SM, and TI; investigation, HT, YY, NN, SM, and TI; resources, KM, TF, JH, YK, and SN; writing—original draft preparation, HT and NS; writing—review and editing, NS, SK, and SN; visualization, HT, YY, and NN; supervision, NS; funding acquisition, NS, SK, and SN.

Supporting information

Fig. S1 . A partial sequence of the 3′ untranslated region (3′‐UTR) of the GINS1 gene. A putative binding site for miR‐101‐5p is shown in the 3′‐UTR.

Click here for additional data file. (1.9MB, tiff)

Fig. S2 . Sequences of miR‐101‐1 and miR‐101‐2 in the human genome. Stem‐loop sequences of miR‐101‐1 and miR‐101‐2; red characters indicate mature miRNA.

Click here for additional data file. (1.3MB, tiff)

Fig. S3 . Cell cycle assays (flow cytometry) in MDA‐MB‐231 cells with ectopic expression of miR‐101‐5p and siGINS1. Cell cycle phase distributions (G0/G1, S, and G2/M) are shown in the bar chart. By transfection of miR‐101‐5p and siGINS1, G0/G1 phase arrest was detected in MDA‐MB‐231 cells.

Click here for additional data file. (1.7MB, tiff)

Fig. S4 . Incorporation of miR‐101‐5p into the RISC in BrCa cells. Mature miRNA (miR‐101‐5p and miR‐101‐3p) were transfected into MAD‐MB‐231 cells, and incorporated miRNA was immunoprecipitated using anti‐Ago2 antibodies. Incorporated miRNA was evaluated by qRT‐PCR (*P < 0.0001). Expression of miR‐21‐5p was used for normalization. Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test.

Click here for additional data file. (1.5MB, tiff)

Fig. S5 . The strategy for identification of miR‐101‐5p target oncogenes in BrCa cells.

Click here for additional data file. (1.1MB, tiff)

Fig. S6 . Direct regulation of TPD52 and SRPK1 by miR‐101‐5p in BrCa cells. Dual luciferase reporter assays showed that luminescence activities were reduced by cotransfection with wild‐type vectors (A: TPD52 and B: SRPK1) and miR‐101‐5p in MDA‐MB‐231 cells. Normalized data were calculated as Renilla/firefly luciferase activity ratios (*P < 0.001). Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test.

Click here for additional data file. (1.4MB, tiff)

Fig. S7 . Inverse correlation between expression of miR‐101‐5p and GINS1 in BrCa patients (TCGA database analysis, n = 1006), as detected by Spearman’s rank tests (P = 0.00103, r = –0.082).

Click here for additional data file. (1.2MB, tiff)

Fig. S8 . Expression of GINS1 was significantly reduced by siGINS1 transfection into MDA‐MB‐157 cells (A). Functional assays, cell proliferation (B), migration (C), and invasion (D), in MDA‐MB‐157 cells with transfection of miR‐101‐5p and siGINS1. Cell proliferation, migration, and invasion assays were described in Materials and Methods (2.4 and 2.5). *P < 0.001, **P < 0.05. Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test.

Click here for additional data file. (1.4MB, tiff)

Fig. S9 . The strategy for identification of GINS1 affected genes/pathways in BrCa tissues in TCGA.

Click here for additional data file. (1MB, tiff)

Fig. S10 . Gene set enrichment analysis (GSEA) based on mRNA sequence data in TCGA‐BrCa tissues.

Click here for additional data file. (3.1MB, tiff)

Table S1 . Reagents used in this study.

Click here for additional data file. (20.1KB, pdf)

Table S2 . Annotation of reads aligned to small RNA.

Click here for additional data file. (6KB, pdf)

Table S3 . Downregulated miRNA in BrCa compare with normal breast (guide/passenger strand).

Click here for additional data file. (2.8KB, pdf)

Acknowledgements

This study was supported by kakenhi (grant nos 16K19906, 17H04285, 18K16322, 18K09338 and 19K09049).

References

  1. Adhami M, Haghdoost AA, Sadeghi B and Malekpour Afshar R (2018) Candidate miRNA in human breast cancer biomarkers: a systematic review. Breast Cancer 25, 198–205. [DOI] [PubMed] [Google Scholar]
  2. Arai T, Kojima S, Yamada Y, Sugawara S, Kato M, Yamazaki K, Naya Y, Ichikawa T and Seki N (2019) Pirin: a potential novel therapeutic target for castration‐resistant prostate cancer regulated by miR‐455‐5p. Mol Oncol 13, 322–337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Balleine RL, Fejzo MS, Sathasivam P, Basset P, Clarke CL and Byrne JA (2000) The hD52 (TPD52) gene is a candidate target gene for events resulting in increased 8q21 copy number in human breast carcinoma. Genes Chromosomes Cancer 29, 48–57. [DOI] [PubMed] [Google Scholar]
  4. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136, 215–233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhayani MK, Calin GA and Lai SY (2012) Functional relevance of miRNA sequences in human disease. Mutat Res 731, 14–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68, 394–424. [DOI] [PubMed] [Google Scholar]
  7. Byrne JA, Frost S, Chen Y and Bright RK (2014) Tumor protein D52 (TPD52) and cancer‐oncogene understudy or understudied oncogene? Tumour Biol 35, 7369–7382. [DOI] [PubMed] [Google Scholar]
  8. Chen Q, Liu D, Hu Z, Luo C and Zheng SL (2019) miRNA‐101‐5p inhibits the growth and aggressiveness of NSCLC cells through targeting CXCL6. Onco Targets Ther 12, 835–848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Economopoulou P, Dimitriadis G and Psyrri A (2015) Beyond BRCA: new hereditary breast cancer susceptibility genes. Cancer Treat Rev 41, 1–8. [DOI] [PubMed] [Google Scholar]
  10. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F (2015) Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer 136, E359–E386. [DOI] [PubMed] [Google Scholar]
  11. Foulkes WD, Smith IE and Reis‐Filho JS (2010) Triple‐negative breast cancer. N Engl J Med 363, 1938–1948. [DOI] [PubMed] [Google Scholar]
  12. Gebert LFR and MacRae IJ (2019) Regulation of microRNA function in animals. Nat Rev Mol Cell Biol 20, 21–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Goldhirsch A, Wood WC, Coates AS, Gelber RD, Thurlimann B, Senn HJ and Panel Members (2011) Strategies for subtypes—dealing with the diversity of breast cancer: highlights of the St. Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2011. Ann Oncol 22, 1736–1747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Goto Y, Kurozumi A, Arai T, Nohata N, Kojima S, Okato A, Kato M, Yamazaki K, Ishida Y, Naya Y et al (2017) Impact of novel miR‐145‐3p regulatory networks on survival in patients with castration‐resistant prostate cancer. Br J Cancer 117, 409–420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gupta I, Sareyeldin RM, Al‐Hashimi I, Al‐Thawadi HA, Al Farsi H, Vranic S and Al Moustafa AE (2019) Triple negative breast cancer profile, from gene to microRNA, in relation to ethnicity. Cancers Basel, 11, pii: E363 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hayes GM, Carrigan PE and Miller LJ (2007) Serine‐arginine protein kinase 1 overexpression is associated with tumorigenic imbalance in mitogen‐activated protein kinase pathways in breast, colonic, and pancreatic carcinomas. Cancer Res 67, 2072–2080. [DOI] [PubMed] [Google Scholar]
  17. Howlader N, Noone AM, Krapcho M, Miller D, Bishop K, Kosary CL, Yu M, Ruhl J, Tatalovich Z, Mariotto A, Lewis DR, Chen HS, Feuer EJ and Cronin KA eds. (2017) SEER Cancer Statistics Review, 1975–2014. National Cancer Institute, Bethesda, MD, https://seer.cancer.gov/csr/1975_2014/, based on November 2016 SEER data submission, posted to the SEER website. [Google Scholar]
  18. Idichi T, Seki N, Kurahara H, Fukuhisa H, Toda H, Shimonosono M, Okato A, Arai T, Kita Y, Mataki Y et al (2018) Molecular pathogenesis of pancreatic ductal adenocarcinoma: impact of passenger strand of pre‐miR‐148a on gene regulation. Cancer Sci 109, 2013–2026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Iwata H (2018) Clinical development of CDK4/6 inhibitor for breast cancer. Breast Cancer 25, 402–406. [DOI] [PubMed] [Google Scholar]
  20. Kanzaki R, Naito H, Kise K, Takara K, Eino D, Minami M, Shintani Y, Funaki S, Kawamura T, Kimura T et al (2016) PSF1 (partner of SLD five 1) is a prognostic biomarker in patients with non‐small cell lung cancer treated with surgery following preoperative chemotherapy or chemoradiotherapy. Ann Surg Oncol 23, 4093–4100. [DOI] [PubMed] [Google Scholar]
  21. Khordadmehr M, Shahbazi R, Ezzati H, Jigari‐Asl F, Sadreddini S and Baradaran B (2019) Key microRNAs in the biology of breast cancer; emerging evidence in the last decade. J Cell Physiol 234, 8316–8326. [DOI] [PubMed] [Google Scholar]
  22. Klinge CM (2018) Non‐coding RNAs in breast cancer: intracellular and intercellular communication. Noncoding RNA 4, pii: E40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Koshizuka K, Nohata N, Hanazawa T, Kikkawa N, Arai T, Okato A, Fukumoto I, Katada K, Okamoto Y and Seki N (2017) Deep sequencing‐based microRNA expression signatures in head and neck squamous cell carcinoma: dual strands of pre‐miR‐150 as antitumor miRNA. Oncotarget 8, 30288–30304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kuchenbaecker KB, Hopper JL, Barnes DR, Phillips KA, Mooij TM, Roos‐Blom MJ, Jervis S, van Leeuwen FE, Milne RL, Andrieu N et al (2017) Risks of breast, ovarian, and contralateral breast cancer for BRCA1 and BRCA2 mutation carriers. JAMA 317, 2402–2416. [DOI] [PubMed] [Google Scholar]
  25. Kurozumi S, Yamaguchi Y, Kurosumi M, Ohira M, Matsumoto H and Horiguchi J (2017) Recent trends in microRNA research into breast cancer with particular focus on the associations between microRNAs and intrinsic subtypes. J Hum Genet 62, 15–24. [DOI] [PubMed] [Google Scholar]
  26. Labib K and Gambus A (2007) A key role for the GINS complex at DNA replication forks. Trends Cell Biol 17, 271–278. [DOI] [PubMed] [Google Scholar]
  27. Li G, Yao L, Zhang J, Li X, Dang S, Zeng K, Zhou Y and Gao F (2016) Tumor‐suppressive microRNA‐34a inhibits breast cancer cell migration and invasion via targeting oncogenic TPD52. Tumour Biol 37, 7481–7491. [DOI] [PubMed] [Google Scholar]
  28. Liu P, Ye F, Xie X, Li X, Tang H, Li S, Huang X, Song C, Wei W and Xie X (2016) mir‐101‐3p is a key regulator of tumor metabolism in triple negative breast cancer targeting AMPK. Oncotarget 7, 35188–35198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liu X, Tang H, Chen J, Song C, Yang L, Liu P, Wang N, Xie X, Lin X and Xie X (2015) MicroRNA‐101 inhibits cell progression and increases paclitaxel sensitivity by suppressing MCL‐1 expression in human triple‐negative breast cancer. Oncotarget 6, 20070–20083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ma L, Liang Z, Zhou H and Qu L (2018) Applications of RNA indexes for precision oncology in breast cancer. Genomics Proteomics Bioinformatics 16, 108–119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. MacNeill SA (2010) Structure and function of the GINS complex, a key component of the eukaryotic replisome. Biochem. J 425, 489–500. [DOI] [PubMed] [Google Scholar]
  32. Mah SM, Buske C, Humphries RK and Kuchenbauer F (2010) miRNA*: a passenger stranded in RNA‐induced silencing complex? Crit Rev Eukaryot Gene Express 20, 141–148. [DOI] [PubMed] [Google Scholar]
  33. Matutino A, Amaro C and Verma S (2018) CDK4/6 inhibitors in breast cancer: beyond hormone receptor‐positive HER2‐negative disease. Ther Adv Med Oncol 10 https://doi.org/10.1758835918818346 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. McCall MN, Kim MS, Adil M, Patil AH, Lu Y, Mitchell CJ, Leal‐Rojas P, Xu J, Kumar M, Dawson VL et al (2017) Toward the human cellular microRNAome. Genome Res 27, 1769–1781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mehrgou A and Akouchekian M (2017) Therapeutic impacts of microRNAs in breast cancer by their roles in regulating processes involved in this disease. J Res Med Sci 22, 130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Misono S, Seki N, Mizuno K, Yamada Y, Uchida A, Arai T, Kumamoto T, Sanada H, Suetsugu T and Inoue H (2018) Dual strands of the miR‐145 duplex (miR‐145‐5p and miR‐145‐3p) regulate oncogenes in lung adenocarcinoma pathogenesis. J Hum Genet 63, 1015–1028. [DOI] [PubMed] [Google Scholar]
  37. Misono S, Seki N, Mizuno K, Yamada Y, Uchida A, Sanada H, Moriya S, Kikkawa N, Kumamoto T, Suetsugu T et al (2019) Molecular pathogenesis of gene regulation by the miR‐150 duplex: miR‐150‐3p regulates TNS4 in lung adenocarcinoma. Cancers 11, 601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Nagahama Y, Ueno M, Miyamoto S, Morii E, Minami T, Mochizuki N, Saya H and Takakura N (2010) PSF1, a DNA replication factor expressed widely in stem and progenitor cells, drives tumorigenic and metastatic properties. Cancer Res 70, 1215–1224. [DOI] [PubMed] [Google Scholar]
  39. Nakahara I, Miyamoto M, Shibata T, Akashi‐Tanaka S, Kinoshita T, Mogushi K, Oda K, Ueno M, Takakura N, Mizushima H et al (2010) Up‐regulation of PSF1 promotes the growth of breast cancer cells. Genes Cells 15, 1015–1024. [DOI] [PubMed] [Google Scholar]
  40. Patel M, Sachidanandan M and Adnan M (2019) Serine arginine protein kinase 1 (SRPK1): a moonlighting protein with theranostic ability in cancer prevention. Mol Biol Rep 46, 1487–1497. [DOI] [PubMed] [Google Scholar]
  41. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA et al (2000) Molecular portraits of human breast tumours. Nature 406, 747–752. [DOI] [PubMed] [Google Scholar]
  42. Ren G, Baritaki S, Marathe H, Feng J, Park S, Beach S, Bazeley PS, Beshir AB, Fenteany G, Mehra R et al (2012) Polycomb protein EZH2 regulates tumor invasion via the transcriptional repression of the metastasis suppressor RKIP in breast and prostate cancer. Cancer Res 72, 3091–3104. [DOI] [PubMed] [Google Scholar]
  43. Roslan N, Bieche I, Bright RK, Lidereau R, Chen Y and Byrne JA (2014) TPD52 represents a survival factor in ERBB2‐amplified breast cancer cells. Mol Carcinog 53, 807–819. [DOI] [PubMed] [Google Scholar]
  44. Seo YS and Kang YH (2018) The human replicative helicase, the CMG complex, as a target for anti‐cancer therapy. Front Mol Biosci 5, 26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Shen G, Zheng F, Ren D, Du F, Dong Q, Wang Z, Zhao F, Ahmad R and Zhao J (2018) Anlotinib: a novel multi‐targeting tyrosine kinase inhibitor in clinical development. J Hematol Oncol 11, 120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sotiriou C, Neo SY, McShane LM, Korn EL, Long PM, Jazaeri A, Martiat P, Fox SB, Harris AL and Liu ET (2003) Breast cancer classification and prognosis based on gene expression profiles from a population‐based study. Proc Natl Acad Sci USA 100, 10393–10398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Spring LM, Wander SA, Zangardi M and Bardia A (2019) CDK4/6 inhibitors in breast cancer: current controversies and future directions. Cyrr Oncol Rep 21, 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Sun J, Yuan Z, Georgescu R, Li H and O'Donnell M (2016) The eukaryotic CMG helicase pumpjack and integration into the replisome. Nucleus 7, 146–154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Tang L, Yu W, Wang Y, Li H and Shen Z (2019) Anlotinib inhibits synovial sarcoma by targeting GINS1: a novel downstream target oncogene in progression of synovial sarcoma. Clin Transl Oncol 21, 1624–1633. [DOI] [PubMed] [Google Scholar]
  50. Toda H, Kurozumi S, Kijima Y, Idichi T, Shinden Y, Yamada Y, Arai T, Maemura K, Fujii T, Horiguchi J et al (2018) Molecular pathogenesis of triple‐negative breast cancer based on microRNA expression signatures: antitumor miR‐204‐5p targets AP1S3. J Hum Genet 63, 1197–1210. [DOI] [PubMed] [Google Scholar]
  51. Treiber T, Treiber N and Meister G (2019) Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat Rev Mol Cell Biol 20, 5–20. [DOI] [PubMed] [Google Scholar]
  52. Uchida A, Seki N, Mizuno K, Misono S, Yamada Y, Kikkawa N, Sanada H, Kumamoto T, Suetsugu T and Inoue H (2019) Involvement of dual‐strand of the miR‐144 duplex and their targets in the pathogenesis of lung squamous cell carcinoma. Cancer Sci 110, 420–432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. van Roosmalen W, Le Devedec SE, Golani O, Smid M, Pulyakhina I, Timmermans AM, Look MP, Zi D, Pont C, de Graauw M et al (2015) Tumor cell migration screen identifies SRPK1 as breast cancer metastasis determinant. J Clin Invest 125, 1648–1664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wang CZ, Deng F, Li H, Wang DD, Zhang W, Ding L and Tang JH (2018) MiR‐101: a potential therapeutic target of cancers. Am J Transl Res 10, 3310–3321. [PMC free article] [PubMed] [Google Scholar]
  55. Yamada Y, Arai T, Kojima S, Sugawara S, Kato M, Okato A, Yamazaki K, Naya Y, Ichikawa T and Seki N (2018a) Regulation of antitumor miR‐144‐5p targets oncogenes: direct regulation of syndecan‐3 and its clinical significance. Cancer Sci 109, 2919–2936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yamada Y, Arai T, Sugawara S, Okato A, Kato M, Kojima S, Yamazaki K, Naya Y, Ichikawa T and Seki N (2018b) Impact of novel oncogenic pathways regulated by antitumor miR‐451a in renal cell carcinoma. Cancer Sci 109, 1239–1253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yamada Y, Sugawara S, Arai T, Kojima S, Kato M, Okato A, Yamazaki K, Naya Y, Ichikawa T and Seki N (2018c) Molecular pathogenesis of renal cell carcinoma: impact of the anti‐tumor miR‐29 family on gene regulation. Int J Urol 25, 953–965. [DOI] [PubMed] [Google Scholar]
  58. Yonemori K, Seki N, Idichi T, Kurahara H, Osako Y, Koshizuka K, Arai T, Okato A, Kita Y, Arigami T et al (2017) The microRNA expression signature of pancreatic ductal adenocarcinoma by RNA sequencing: anti‐tumour functions of the microRNA‐216 cluster. Oncotarget 8, 70097–70115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhang X, Gao D, Fang K, Guo Z and Li L (2019) Med19 is targeted by miR‐101‐3p/miR‐422a and promotes breast cancer progression by regulating the EGFR/MEK/ERK signaling pathway. Cancer Lett 444, 105–115. [DOI] [PubMed] [Google Scholar]
  60. Zhang X, Schulz R, Edmunds S, Kruger E, Markert E, Gaedcke J, Cormet‐Boyaka E, Ghadimi M, Beissbarth T, Levine AJ et al (2015) MicroRNA‐101 suppresses tumor cell proliferation by acting as an endogenous proteasome inhibitor via targeting the proteasome assembly factor POMP. Mol Cell 59, 243–257. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1 . A partial sequence of the 3′ untranslated region (3′‐UTR) of the GINS1 gene. A putative binding site for miR‐101‐5p is shown in the 3′‐UTR.

Click here for additional data file. (1.9MB, tiff)

Fig. S2 . Sequences of miR‐101‐1 and miR‐101‐2 in the human genome. Stem‐loop sequences of miR‐101‐1 and miR‐101‐2; red characters indicate mature miRNA.

Click here for additional data file. (1.3MB, tiff)

Fig. S3 . Cell cycle assays (flow cytometry) in MDA‐MB‐231 cells with ectopic expression of miR‐101‐5p and siGINS1. Cell cycle phase distributions (G0/G1, S, and G2/M) are shown in the bar chart. By transfection of miR‐101‐5p and siGINS1, G0/G1 phase arrest was detected in MDA‐MB‐231 cells.

Click here for additional data file. (1.7MB, tiff)

Fig. S4 . Incorporation of miR‐101‐5p into the RISC in BrCa cells. Mature miRNA (miR‐101‐5p and miR‐101‐3p) were transfected into MAD‐MB‐231 cells, and incorporated miRNA was immunoprecipitated using anti‐Ago2 antibodies. Incorporated miRNA was evaluated by qRT‐PCR (*P < 0.0001). Expression of miR‐21‐5p was used for normalization. Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test.

Click here for additional data file. (1.5MB, tiff)

Fig. S5 . The strategy for identification of miR‐101‐5p target oncogenes in BrCa cells.

Click here for additional data file. (1.1MB, tiff)

Fig. S6 . Direct regulation of TPD52 and SRPK1 by miR‐101‐5p in BrCa cells. Dual luciferase reporter assays showed that luminescence activities were reduced by cotransfection with wild‐type vectors (A: TPD52 and B: SRPK1) and miR‐101‐5p in MDA‐MB‐231 cells. Normalized data were calculated as Renilla/firefly luciferase activity ratios (*P < 0.001). Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test.

Click here for additional data file. (1.4MB, tiff)

Fig. S7 . Inverse correlation between expression of miR‐101‐5p and GINS1 in BrCa patients (TCGA database analysis, n = 1006), as detected by Spearman’s rank tests (P = 0.00103, r = –0.082).

Click here for additional data file. (1.2MB, tiff)

Fig. S8 . Expression of GINS1 was significantly reduced by siGINS1 transfection into MDA‐MB‐157 cells (A). Functional assays, cell proliferation (B), migration (C), and invasion (D), in MDA‐MB‐157 cells with transfection of miR‐101‐5p and siGINS1. Cell proliferation, migration, and invasion assays were described in Materials and Methods (2.4 and 2.5). *P < 0.001, **P < 0.05. Error bars are represented as mean ± SD. P‐values were calculated using Bonferroni‐adjusted Mann‐Whitney U‐test.

Click here for additional data file. (1.4MB, tiff)

Fig. S9 . The strategy for identification of GINS1 affected genes/pathways in BrCa tissues in TCGA.

Click here for additional data file. (1MB, tiff)

Fig. S10 . Gene set enrichment analysis (GSEA) based on mRNA sequence data in TCGA‐BrCa tissues.

Click here for additional data file. (3.1MB, tiff)

Table S1 . Reagents used in this study.

Click here for additional data file. (20.1KB, pdf)

Table S2 . Annotation of reads aligned to small RNA.

Click here for additional data file. (6KB, pdf)

Table S3 . Downregulated miRNA in BrCa compare with normal breast (guide/passenger strand).

Click here for additional data file. (2.8KB, pdf)

Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES