Skip to main content
Engineering in Life Sciences logoLink to Engineering in Life Sciences
. 2018 May 21;18(8):589–599. doi: 10.1002/elsc.201700173

An aminoacylase activity from Streptomyces ambofaciens catalyzes the acylation of lysine on α‐position and peptides on N‐terminal position

Léna Dettori 1, Florent Ferrari 1, Xavier Framboisier 1, Cédric Paris 3, Yann Guiavarc'h 1, Laurence Hôtel 2, Arnaud Aymes 1, Pierre Leblond 2, Catherine Humeau 1, Romain Kapel 1, Isabelle Chevalot 1, Bertrand Aigle 2,, Stéphane Delaunay 1,
PMCID: PMC6999544  PMID: 32624939

Abstract

The presence of aminoacylase activities was investigated in a crude extract of Streptomyces ambofaciens ATCC23877. First activities catalyzing the hydrolysis of N‐α or ε‐acetyl‐L‐lysine were identified. Furthermore, the acylation of lysine and different peptides was studied and compared with results obtained with lipase B of Candida antarctica (CALB). Different regioselectivities were demonstrated for the two classes of enzymes. CALB was able to catalyze acylation only on the ε‐position whereas the crude extract from S. ambofaciens possessed the rare ability to catalyze the N‐acylation on the α‐position of the lysine or of the amino‐acid in N‐terminal position of peptides. Two genes, SAM23877_1485 and SAM23877_1734, were identified in the genome of Streptomyces ambofaciens ATCC23877 whose products show similarities with the previously identified aminoacylases from Streptomyces mobaraensis. The proteins encoded by these two genes were responsible for the major aminoacylase hydrolytic activities. Furthermore, we show that the hydrolysis of N‐α‐acetyl‐L‐lysine could be attributed to the product of SAM23877_1734 gene.

Keywords: Acylation, Aminoacylase, Enzymatic synthesis, N‐α‐oleyl‐lysine, Streptomyces ambofaciens


Abbreviations

BACs

bacterial artificial chromosomes

CALB

lipase B of Candida antarctica

1. Introduction

Through their emulsifying, antimicrobial or surfactant activities, N‐(long/short)‐chain‐fatty‐acyl‐L‐amino acids or peptides are of great interest and are suitable for cosmetic, pharmaceutics or food industries 1, 2. N‐acylated amino acids or peptides are currently chemically produced using mainly fatty acid chlorides as acyl donors. This chemical pathway called Schotten Baumann pathway has been already described for the acylation of amino acids and protein hydrolysates 3, 4. Unfortunately, this chemical process has the disadvantage of producing by‐products like salt, which has to be removed in order to obtain valuable final products 2. This process could be advantageously replaced by an enzymatic process. Lipases are the most currently used enzymes to synthesize bioactive molecules, but their use involves the utilization of organic solvent as reaction medium. This limits the acylation of polar molecules such as amino acids or peptides 5. Studies reported the use of neoteric media such as ionic liquids, allowing the improvement of the solubility of peptides such as Lys‐Ser in 1‐butyl‐3‐methylimidazolium hexafluorophosphate ([Bmim]+[PF6]) in comparison with 2‐methyl‐2‐butanol and of the reaction performances 6. However, depending on the peptide, the solubility can be still low and the viscosity of ionic liquids can lead to mass transfer limitations 7. An alternative to lipases is the use of acylases. These enzymes are able to catalyze the acylation of amino acids or peptides with fatty acids in aqueous media 1, 8, 9, 10, 11, 12. These enzymes are produced by various microorganisms including the filamentous bacteria from Streptomyces genus. Four acylases able to catalyze the N‐acylation of amino acids have been previously identified from Streptomyces mobaraensis. The first one is Sm‐AA, a monomer of 55 kDa belonging to the peptidase M20 family. This enzyme has an optimal pH from 7 to 8 and an optimal temperature of 50°C. SmAA has the ability to hydrolyze amino acids acylated with long or short fatty chains (C2 to C16) 12. The second enzyme is Sm‐eLA (55 kDa monomer) which has been identified as a ε‐lysine‐acylase (Nε‐acyl‐L‐lysine amidohydrolase). SmeLA presents an optimal pH at 8 and is stable at temperatures up to 50°C for 1 h at pH 8. This enzyme efficiently catalyzes the N‐acylation of the lysine side chain with fatty acids or aromatic compounds as acyl donors in an aqueous buffer. The reaction yield can reach 90% or even higher values using 10 mM of fatty acid and 0.5 M of L‐lysine 1. The third acylase is Sm‐PVA (61 kDa, 19 kDa dimer) which belongs to the penicillin V acylase family. It has an optimal pH of 8 and is stable at temperatures up to 55°C. It efficiently catalyzes the synthesis of β‐lactam antibiotics, capsaicin derivatives, N‐lauroyl‐amino acid. This enzyme was also shown to catalyze the acylation of lysine‐containing dipeptides, only on the side chain of lysine, with lauric acid as acyl donor 9. The last enzyme (short‐chain‐acyl aminoacylase) is a metallo‐enzyme (100 kDa monomer) which is stable at temperatures up to 60°C for 1h at pH 7.2. It catalyzes the hydrolysis of the amide bonds in various N‐α‐acylated‐L‐amino acids except the N‐acetyl‐L‐proline. This acylase also catalyzes the deacylation of 7‐aminocephalosporanic acid and cephalosporin C 8. Contrary to the three previous enzymes, the gene encoding this aminoacylase has not been identified in S. mobaraensis genome. Another acylase, the FR901379 acylase which is able to deacylate a precursor of micafungin, an antifungal drug used in the treatment of candidaemia, has also been found in the culture broth of Streptomyces sp. no. 6907 13.

These studies suggested that the Streptomyces genus is likely an interesting bacterial source of original aminoacylases. For this reason, the presence of such enzymes in another species of Streptomyces, Streptomyces ambofaciens ATCC23877 whose genome sequence is available 14, has been investigated.

Both hydrolytic and synthetic activities of these enzymes were studied. More particularly, abilities of S. ambofaciens extracts to catalyse the acylation of aminoacids and peptides were compared to that of lipase B from Candida antarctica (CALB).

2. Materials and methods

2.1. Bacterial strains and plasmids

Bacterial strains, plasmids and Bacterial Artificial Chromosomes (BACs) used in this study were listed in Table 1. Streptomyces strains were manipulated as previously described 23, 24. Escherichia coli strains were cultivated in LB medium 25. Antibiotics were added to the cultures when appropriate.

Table 1.

List of strains, plasmids and BACs used in this work

Strains, BACs or plasmids Principal characteristicsa Source or reference
S. ambofaciens ATCC23877 Wild‐type (WT) 15
S. ambofaciens ΔSAM23877_1485::scar The SAM23877_1485 gene in‐frame‐deleted This work
S. ambofaciens ΔSAM23877_1734::scar The SAM23877_1734 gene in‐frame‐deleted This work
S. ambofaciens ΔSAM23877_1485::scarΔSAM23877_1734::scar The SAM23877_1485 and SAM23877_11734 genes in‐frame‐deleted This work
S. ambofaciens ΔSAM23877_1485::scarΔSAM23877_1734::scar ΔSAM23877_0977::scarΔSAM23877_6191::scar The four acylase encoding genes of S. ambofaciens are in frame‐deleted This work
E. coliDH5α General cloning strain and strain used in bioassays 16
E. coli ET12567/pUZ8002 Non‐methylating strain with mobilization plasmid for conjugation with Streptomyces 17
E. coli BW25113/pKD20 Strain used for the PCR‐targeting mutagenesis (gam, bet, exo, bla) 18
BAB8ZA11, BAA10ZD3, BAA12ZH2, BAB3ZC8 BACs from the genomic library of S. ambofaciens (cat) carrying acylase gene 19
BAB8ZA11::neo/∆SAM23877_1485::aac(3)IV +oriT SAM23877_1485 replaced by an apramycin cassette and the cat gene by the neo gene This work
BAA10ZD3::neo/∆SAM23877_1734::aac(3)IV+oriT SAM23877_1734 replaced by an apramycin cassette and the cat gene by the neo gene This work
BAB3ZC8::neo/∆SAM23877_0977::aac(3)IV+oriT SAM23877_0977 replaced by an apramycin cassette and the cat gene by the neo gene This work
BAA12ZH2::neo/∆SAM23877_6191::aac(3)IV+oriT SAM23877_6191 replaced by an apramycin cassette and the cat gene by the neo gene This work
pIJ773 oriT, aac(3)IV 20
pPSM88T pOSV503 derivative containing oriT 21; A. Thibessard, pers. com.
pOSK1111 Conjugative plasmid with the xis and int genes of pSAM2 21
pUWLFLP Conjugative plasmid with the synthetic flp(a) gene 22
a

bla, ampicillin resistance gene; neo, kanamycin resistance gene; aac(3)IV, apramycin (apra) resistance gene; oriT, origin of transfer; gam, inhibitor of the host exonuclease V; bet, single‐stranded DNA binding protein; exo, exonuclease promoting recombination along with bet; cat, chloramphenicol resistance gene; xis and int: excisionase and integrase of pSAM2, respectively; flp(a): gene encoding the FLP recombinase.

2.2. DNA manipulation

Isolation, cloning, and manipulation of DNA were carried out as previously described in 24 for Streptomyces and in 25 for E. coli. Amplification of DNA fragments by PCR was performed with Taq DNA polymerase (NEB) or Takara polymerase (Fermentas), according to the manufacturer's instructions. When needed, PCR products and restriction fragments were purified from agarose gels with the High Pure PCR product purification kit (Roche).

2.3. In‐frame deletion of genes encoding acylase in S. ambofaciens

The REDIRECT system 20 was used to make an in‐frame deletion of the four genes encoding acylase in S. ambofaciens ATCC23877, SAM23877_1485, SAM23877_0977, SAM23877_1734 and SAM23877_6191, as described in previous works for other genes 26, 27. The aac(3)‐IV‐oriT mutagenesis cassette used for gene replacement was synthesized by PCR using pSPM88T (for the three first genes; A. Thibessard, personal comunication; 21) or pIJ773 (for SAM23877_6191; 20) as templates and the primer pairs described in Table 2. E. coli BW251113/pKD20 18) was first transformed with the BAC containing the acylase gene of interest, and then with the PCR product (aac(3)‐IV‐oriT mutagenesis cassette) to replace the targeted gene by homologous recombination. The chloramphenicol resistance gene of the vector pBelo‐BAC11 was replaced by a kanamycin resistance gene, using the same strategy. E. coli ET12567/pUZ8002 was transformed with the mutated BACs for conjugation with S. ambofaciens ATCC23877. Gene replacements were confirmed by PCR analysis using primer sets flanking the targeted genes and/or Southern blot analyses. To get in frame deleted mutants, the cassette was removed using the excisionase and integrase of pSAM2 as described in 21, except for SAM23877_6191, for which the cassette was removed using the synthetic gene encoding the Flp recombinase optimized for expression in high‐GC bacteria 21. Only the start and stop codons of the genes remained after deletion. All primers used to confirm the gene deletion are described in Table 2. Single mutants were obtained for SAM23877_1485 and SAM23877_1734. A double mutant strain for these genes was obtained from the single mutant strain S. ambofaciens ΔSAM23877_1485::scar (Table 1) in which the SAM23877_1734 gene was replaced by the aac(3)‐IV‐oriT mutagenesis cassette. The cassette was then removed as described above. A quadruple mutant in which the four genes encoding acylase identified in the genome of S. ambofaciens was also constructed in this way (Table 1).

Table 2.

Oligonucleotide primers used in this work

Primers Nucleotide sequence (5′→3′)
Gene replacement:
disrupt_sam1485_F TGCCGGCCGGTCCGCGCGAGGGGCGAGACTGGTGCCATGATCGCGCGCGCTTCGTTCGGGACGAA
disrupt_sam1485_R CCCGGGAGAAGATCATCGCCCCGTCGGCCGCCGAGATCAATCTGCCTCTTCGTCCCGAAGCAACT
disrupt_sam1734_F AGCAGGGACACCAGCAGTGACAGCGGGAGGAACCACGTGATCGCGCGCGCTTCGTTCGGGACGAA
disrupt_sam1734_R CTCGGGCGGTTCAGGACGCGTCGAATCTCGGGCGGTTCAATCTGCCTCTTCGTCCCGAAGCAACT
disrupt_sam0977_F TCAGCCGCCCCTTCCCCAAAGACGTCGGGAGGCACGATGATCGCGCGCGCTTCGTTCGGGACGAA
disrupt_sam0977_R GCTCGGCGCCGGGCGGGTCGCGGGACGGGCGCGGTCTCAATCTGCCTCTTCGTCCCGAAGCAACT
disrupt_sam6191_F TCACCACGATCGCCTCCGCCGCCGTGGAGGAGCAGTATGATTCCGGGGATCCGTCGACC
disrupt_sam6191_R TCGTTTCTGGGCCGTGCGCTCCGGGACCGTGCGGTCCTATGTAGGCTGGAGCTGCTTC
verif_sam1485_F* TGGTGCTGTCCACGCCCTAC
verif_sam1485_R* TGTCAACAGTCGTGCGACCT
verif_sam1734_F* CTCAAGCTAGCGCGTCTGCC
verif_sam1734_R* GCACACGCGAGCGAATAGCA
verif_sam0977_F* GTCGACCGTGCTGCCGTGTC
verif_sam0977_R* ATCTTTCCCGGATCGCCGTG
verif_samL0890_R* ATCTTTCCCGGATCGCCGTG
verif_samL0890_F* GTCGACCGTGCTGCCGTGTC
verif_sam6191_F* ACCGGGGAGCGGAAGGTGGCGT
verif_sam6191_R* CGACGGGCGAGGGCCACGA

The bold nucleotides are identical to the sequences at the extremities of the acylase genes. The primers labeled with an asterisk were used to check the in‐frame deletion.

2.4. Media and culture conditions for aminoacylase production

S. ambofaciens strains were stored as spore suspensions (107 to 108 Units Forming Colony/mL) at −80°C. The first step of the culture protocol was a culture in the ICS medium. This medium consisted of sucrose 15 g/L, corn steep 5 g/L, (NH4)2SO4 10 g/L, KH2PO4 1 g/L, NaCl 3 g/L, MgSO4·7H2O 0.2 g/L and CaCO3 0.2 g/L. Medium pH was adjusted at 6.8 prior to sterilization at 121°C for 20 min. Fourty mL of this medium were inoculated with 100 μL of spore suspension. After 48 h culture, 2.5 mL of ICS medium were transferred in 25 mL of culture medium for the pre‐culture step. The composition of this culture medium was: meat extract 40 g/L, soluble starch 40 g/L, casein hydrolysate 20 g/L, MgSO4 20 g/L, and K2HPO4 2 g/L 1. The pH of the culture medium was set at 7 before sterilization at 121°C for 20 min. The preculture was performed for 48 h and then, 5 ml of this preculture were used to inoculate 95 ml of the same fresh culture medium for the main culture step. This last culture was maintained for 7 days as a maximum production of enzymes was identified at this time. All the cultures were carried out in baffled flasks, except the main one, at 250 rpm and 28°C. All the components of the culture media were purchased from Sigma‐Aldrich, except sucrose and yeast extract, from Fluka, (NH4)2SO4 (99%), NaCl, CaCO3 and acetonitrile, from Carlo Erba.

2.5. Preparation of enzyme solution

At the end of the main culture, in order to disrupt the bacterial cells, the whole suspension was submitted to four passages in a Cell disrupter (Constant system Cell‐D) at 2.5 kbars. Then, the cellular debris were removed by centrifugation at 8600 × g, at 4°C for 20 min. Thereafter, ammonium sulfate was added to the supernatant to 60% of saturation to precipitate proteins of the supernatant including acylases and agitation was maintained for 1 h, at room temperature. The precipitate was recovered by centrifugation at 8600  × g at 4°C for 20 min and was dissolved in 25 mM Tris‐HCl buffer, NaCl 50 mM, at pH 8. The solution was dialyzed seven times (cutoff at 12.5 kDa) against the same buffer. This solution will be mentioned as S. ambofaciens crude extract in the following experiments.

The protein separation step was carried out on a low‐pressure ion exchange liquid chromatography (AKTA purifier 100, GE Healthcare) on a Q Sepharose (quaternary aminomethyl Sepharose) column (1.6 × 10 cm, column, volume: 20 mL). Mobile phase consisted of Tris‐HCl 25 mM and NaCl 50 mM. The column was loaded with 5 mL of the protein solution. Proteins were eluted using a stepwise procedure (step: 0, 0.1, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5 and 1.0 M of NaCl) at a flow rate of 2 mL/min. Each step of the gradient was held during one column volume.

Each collected fraction was concentrated using Amicon® ultra‐15 centrifugal filter devices (molecular weight cutoff: 10 K, Millipore). Fifteen milliliters of the protein solution were transferred into the device and centrifuged for 30 min at 5000 × g at room temperature. Protein concentrations were assayed according to the Bradford method using bovine serum albumin as standard 28.

2.6. Enzyme assays

The hydrolytic activity of aminoacylases was determined in each sample using N‐α‐acetyl‐L‐lysine or N‐ε‐acetyl‐L‐lysine as substrate. The enzymatic hydrolysis of N‐α/ε‐acetyl‐L‐lysine was carried out in test tubes. In a typical reaction, 0.2 mL of the substrate (40 mM) and 0.3 mL of enzymatic sample were added in 1.5 mL of Tris‐HCl (25 mM) NaCl (50 mM) at pH 8. The hydrolysis reaction was started by the addition of the enzyme sample. Reaction media were kept at 37°C and stirred at 250 rpm. Samples of 50 μL were withdrawn for analyses. The reaction was stopped after 24 h by soaking in cold water and stored at −18°C before HPLC analysis. Each reaction was performed in triplicate.

The enzymatic acylations of lysine, Ser‐Tyr‐Lys (SYK) and Leu‐Gln‐Lys‐Trp (LQKW) were carried out in test tubes. With S. ambofaciens crude extract as biocatalyst, the reaction medium consisted of the acyl‐acceptor (0.12 M) and acyl‐donor (0.24 M) in 2 mL of Tris‐HCl (25 mM), NaCl (50 mM) at pH 8. Reaction media were stirred at 250 rpm and kept at 45°C. With CALB‐catalyzed reactions, substrates were added in 2 mL of M2B2 previously dehydrated on 4 Å molecular sieves. The initial water activity of the medium was decreased below 0.1 to limit the hydrolytic activity of CALB. Triethylamine was added to the reaction media in a large excess (2.4 mol/L) to favor the neutral form of amino groups. After solubilization of the substrates for 12 h at 55°C, the acylation was started by the addition of 10 g/L of CALB. Reaction media were stirred at 250 rpm and kept at 55°C for CALB‐catalyzed reactions. Fifty μL samples were withdrawn over time for analyses. These samples were diluted with methanol/water (80/20, v/v) and stored at −18°C before LC–MS analysis. Each reaction was repeated at least twice. Novozym 435® (lipase B from C. antarctica immobilized on an acrylic resin) with propyl laurate synthesis activity of 7000 PLU g‐1 and protein grade of 1–10% was from Novo Nordisk A/S. Lysine and oleic acid were purchased from Sigma‐Aldrich, K, SYK and LQKW with 99% of purity were acquired from Bachem.

2.7. Analysis of the reaction media

Quantitative analysis of the lysine, produced in hydrolysis reaction, was performed by high‐pressure liquid chromatography (HPLC). The separation of sample constituents was carried out according to the Shimadzu method® by derivatization of amino acids with the ortho‐phtaldehyde (OPA) which, once excited with a wavelength of 350 nm, emits fluorescence to 460 nm. In hydrolytic reactions, the production of lysine of each reaction was monitored using HPLC (LC 20 AD – VP, Shimadzu, France) equipped with a fluorescence detector (RF‐10A): excitation wavelength: 350 nm, emission wavelength: 460 nm. The column used was a C18 (150 × 4.6 mm–5 μm, Apollo, France) maintained at 45°C. The elution was performed using a gradient fed at a constant flow rate of 1.0 mL/min as following: 95% reagent A and 5% reagent B for 1 min, 95–0% reagent A and 5–100% reagent B for 9 min, 100% buffer B for 5 min, 100–0% reagent B for 1 min. The column was then washed with acetonitrile (80%) for 5 min. The column temperature was controlled at 45°C. Mobile phases consisted of NaH2PO4 0.78 g/L, Na2HPO4 1.79 g/L for A phase and 600 mL of A phase added at 300 mL of acetonitrile for B phase.

Qualitative and semi quantitative analysis of aminoacid and peptide acylated derivatives were carried out on an HPLC–MS system (ThermoFisher Scientific, San Jose, CA, USA) consisting in a binary delivery pump connected to a photodiode array detector (PDA) and a LTQ ion trap as mass analyzer (Linear Trap Quadrupole) equipped with an atmospheric pressure ionization interface operating in positive electrospray mode (ESI+). Chromatographic separation was performed on a C18 amide column (150 mm × 2.1 mm, 5 μm porosity – Grace/Alltech, Darmstadt, Germany) equipped with a C18 amide pre‐column (7.5 mm × 2.1 mm, 5 μm porosity – Grace/Alltech Darmstadt, Germany) at 25°C. Mobile phases consisted of methanol/water/TFA (80:20:0.1, v/v/v) for A and methanol/TFA (100:0.1, v/v) for B. Acylated peptides were eluted using a linear gradient from 0 to 100% of B for 5 min and then an isocratic step at 100% of B for 10 min, at a flow rate of 0.2 mL/min. Mass spectrometric conditions were as follows: spray voltage was set at +4.5kV; source gases were set for sheath gas, auxiliary gas and sweep gas at 30, 10 and 10, respectively (in arbitrary units min−1); capillary temperature was set at 250°C; capillary voltage was set at 48 V; tube lens, split lens and front lens voltages were set at 120 V, −34 V and −4.25 V, respectively. Ion optic parameters were optimized by automatic tuning using a standard solution of oleoyl SYK at 0.1 g/L infused in mobile phase (A/B, 50:50) at a flow rate of 5 μL/min. Full scan MS spectra were performed from 100 to 1000 m/z and additional MS2 scans were realized in order to get structural information based on daughter ions elucidation. Raw data were processed using Xcalibur software (version 2.1 Thermo Scientific).

3. Results and discussion

3.1. Research for an aminoacylase activity in a crude extract of Streptomyces ambofaciens ATCC23877

Aminoacylase activities and regio‐selectivity were studied according to the Koreishi method 1, 8, 11, performing hydrolytic reactions using both N‐α‐ and N‐ε‐acetyl‐L‐lysine as substrates. Hydrolytic reactions were followed by the analysis of the lysine release. After 7 days of culture, the crude extract from the culture of S. ambofaciens ATCC23877 presented an aminoacylase activity which catalyzed the hydrolysis of amide bond in both N‐α and N‐ε‐acetyl‐L‐lysine. A specific hydrolytic activity of 0.13 mmollys/(h gprotein) was observed with N‐α‐acetyl‐L‐lysine, and 0.11 mmollys/(h gprotein) with N‐ε‐acetyl‐L‐lysine. Similar hydrolytic activities were previously identified in S. mobaraensis crude extract 8. The hydrolysis of the amide bond of N‐α‐acetyl‐L‐lysine was assigned to both a short‐chain‐acyl aminoacylase 8 and ε‐lysine acylase (SmeLA) 11 whereas the hydrolysis of the amide bond of N‐ε‐acetyl‐L‐lysine was only catalyzed by SmeLA 11.

Aminoacylase synthetic activities of S. ambofaciens crude extract regarding the acylation of lysine by oleic acid was also investigated. The regio‐selectivity of the reaction catalyzed by S. ambofaciens crude extract was compared to that obtained with the commonly used CALB 6, 7, 29. A mass spectrometry based method has previously been developed and validated to determine enzyme regio‐selectivity from fragments provided by LC‐MS‐MS 6, 30. The acylation of lysine by oleic acid catalyzed by the S. ambofaciens crude extract led to the formation of one mono‐acylated product with a molecular mass of 410 which was detected at a retention time of 7.84 min. The fragmentation of this pseudo molecular [M+H]+ parent ion (m/z = 411) led to one major daughter ion (m/z = 375) corresponding to [(Oleoyl‐K) – 2H2O + H]+, and two minor daughter ions (m/z = 147 and m/z = 348) corresponding to [(Oleoyl‐K) + H]+ and [(Oleoyl‐K) – H2O – COOH + H]+, respectively (Fig. 1B). With CALB, a different mono‐acylated product was detected at a retention time of 8,18mn. The same molecular mass was measured (MM = 410) but the MS2 profile is different, presenting only one daughter ion (m/z = 348), corresponding to [(Oleoyl‐K) – H2O – COOH + H]+ (Fig. 1D). The comparison of this fragmentation profile with that of both standard molecules of α‐oleoyl‐lysine and ε‐oleoyl‐lysine confirmed that CALB preferentially catalyzes acylation on the ε amino group of lysine whereas S. ambofaciens crude extract catalyzes acylation on α position (Fig. 1A and 1C).

Figure 1.

Figure 1

Mass analysis of oleoyl‐lysine synthesized using either the crude extract of S. ambofaciens ATCC23877 (B) or CALB (D) and standards (A and C). A and C: MS2 spectra obtained after fragmentation of ion parent (m/z = 410) relative to the standards α‐oleoyl‐lysine and ε‐oleoyl‐lysine, respectively; B and D: MS2 spectra of the products obtained after acylation reaction catalyzed by S. ambofaciens crude extract and CALB, respectively (ion parents m/z = 410).

To confirm these enzymatic specificities, reactions were performed with two peptides including a lysine residue in their sequence, i.e. SYK and LQKW. SYK acylation with oleic acid catalyzed by S. ambofaciens crude extract led to the formation of one mono‐acylated product characterized by a molecular mass of 660 and a retention time of 5.39 min. This was identified as a product acylated on the serine residue. Indeed, the MS2 profile showed the presence of an oleoyl‐serine fragment [(Oleoyl‐SY)‐H2O+H]+ (m/z = 515.10) and of YK peptidic fragments [(YK) – H2O + H]+ (m/z = 291,91) and [(YK) + H]+ (m/z = 309.94). The same MS2 profile was obtained by fragmenting the standard molecule N‐α‐oleoyl‐SYK (Fig. 2). In previous study, CALB was shown to catalyze SYK acylation mainly on the lysine side chain 30. These results suggested the selective N‐acylation on α position for aminoacylases.

Figure 2.

Figure 2

Mass analysis of oleoyl‐SYK synthesized using the crude extract of S. ambofaciens ATCC23877. (A) single ion chromatogram of the acylated product [M+H]+ parent ion (m/z = 661); (B) MS2 spectrum after fragmentation of the ion parent; (C) MS2 spectrum after fragmentation of the standard N‐α‐oleoyl‐SYK.

This trend was confirmed with the tetrapeptide LQKW which was acylated on the α‐amino group of leucine by the crude extract of S. ambofaciens (Fig. 3). Indeed, analysis of the product highlighted the formation of one mono‐acylated molecule and the MS2 profile showed the presence of the fragments [(KW) + H]+ (m/z = 332.93), [(QKW) + H]+ (m/z = 460.93), [(Oleoyl‐LQ) + H]+ (m/z = 505.86), and [(Oleoyl‐LQK) + H]+ (m/z = 633.97).

Figure 3.

Figure 3

Mass analysis of oleoyl‐LQKW synthesized using the crude extract of S. ambofaciens ATCC23877. (A) single ion chromatogram [M+H]+ parent ion (m/z = 703); (B) MS2 spectrum after fragmentation of the ion parent.

This specificity differs from the one of CALB as a previous study showed that CALB catalyzed LQKW acylation mainly on the lysine side chain 30. It has also to be noticed that no acylation of peptides on N‐terminal position occurred with Sm‐PVA from S. mobaraensis. This enzyme was shown to catalyze only the acylation of the lysine side chain whatever the position of this amino acid in a dipeptide 9.

Thus, the present study showed that the enzymes of the crude extract of S. ambofaciens ATCC23877 catalyzed the acylation of the amino group located in α position of lysine or of the amino‐acid in the N‐terminal position of a peptide such as SYK and LQKW whereas CALB and Sm‐PVA led to the selective acylation of lysine in ε position whatever the peptidic sequence. This regio‐selectivity is of great interest because aminoacylases from S. ambofaciens appear to be susceptible to catalyze the acylation of any peptides or amino acids, on their α‐amino group, preserving the functional side chains that may be responsible for biological activities.

3.2. Partial purification of amino acylases from S. ambofaciens ATCC23877

Four different aminoacylases were identified or detected in S. mobaraensis extracts 1, 9, 12. To check the presence of several enzymes in S. ambofaciens ATCC23877, proteins from S. ambofaciens crude extracts were fractionated by ionic low pressure chromatography on a Q Sepharose column. The determination of aminoacylase activity in each fraction showed that α‐aminoacylase activity could be separated from ε‐aminoacylase activity (Table 3). The α‐aminoacylase activity was mainly measured in fractions 5 and 6 (respectively 2.9 and 1.8 mmollys/(h gprotein) whereas the ε‐aminoacylase activity was found in the fractions 3 and 4 (respectively 0.49 and 0.45 mmollys/(h gprotein). This result suggested that several aminoacylases might be synthesized by S. ambofaciens ATCC23877.

Table 3.

Hydrolytic activity towards N‐α/ε‐acetyl‐L‐lysine in each collected fraction during low‐pressure ion exchange liquid chromatography of the S. ambofaciens ATCC23877 crude extract

Fraction number Specific activity (mmollys/(h gprotein)
N‐α‐acetyl‐L‐lysine N‐ε‐acetyl‐L‐lysine
0 0.1 0.27
1 0.07 0.04
2 0.03 a
3 0.05 0.49
4 0.06 0.45
5 2.9 0.13
6 1.8 0.09
7 0.9 0.1
8 0.3 0.18
9 0.09 a
a

Presence of an enzyme activity, which was not quantifiable.

Two aminoacylases from S. mobaraensis are known to catalyze the hydrolysis of N‐α/ε‐acetyl‐L‐lysine. The S. mobaraensis short‐chain‐acyl aminoacylase catalyzes mainly the hydrolysis of N‐α‐acetyl‐L‐lysine with a specific activity of 41 units/mg and Sm‐eLA is characterized by a specific activity of 3370 units/mg for the hydrolysis of N‐ε‐acetyl‐L‐lysine. Sm‐eLA has been biochemically and genetically characterized. To date, the gene coding the short‐chain‐acyl aminoacylase has not been identified. However, two other acylases, the N‐(short/long)‐chain‐fatty‐acyl‐L‐amino acids acylase (Sm‐AA) and the penicillin V acylase (Sm‐PVA), have been described in S. mobaraensis and their respective genes have been identified.

3.3. Analysis of the S. ambofaciens ATCC23877 genes encoding acylase

The genome of S. ambofaciens ATCC23877 has been sequenced 14. Therefore, the genes potentially encoding acylases have been searched using tblastn and the products of the S. mobaraensis genes as “baits”. As mentioned above, three acylases have been identified and characterized in S. mobaraensis, Sm‐PVA, Sm‐AA and Sm‐eLA (accession numbers: BAF51977, BAI44523.1 and BAH59036, respectively).

The tblastn analysis revealed that the genome of S. ambofaciens ATCC23877 contains three genes encoding acylases which share high level of identity and similarity with the S. mobaraensis enzymes (Supporting Information Fig. 1). Thus, the product of SAM23877_1734 showed 86% identity (93% similarity) with Sm‐AA while the protein SAM23877_1485 shared 80% identity (85% similarity) with Sm‐eLA. The third identified acylase, SAM23877_0977, was homologous to Sm‐PVA (69% identity/77% similarity). Interestingly, another gene product of S. ambofaciens ATCC23877 (SAM23877_6191) has also homology with Sm‐AA but with a lower level of identity/similarity (55%/68%, Supporting Information Fig. 1D) suggesting the presence of a fourth enzyme with a potential acylase activity. Like SAM23877_1734 and Sm‐AA, this last protein belongs to the M20 Peptidase, carboxypeptidase yscS‐like family (cd05675). One candidate product of this last gene could be a protein similar to the short‐chain‐acyl amino acylase detected but not characterized in S. mobaraensis 8.

To correlate the acylase activities observed in the crude extract of the wild‐type strain S. ambofaciens ATCC23877 with the putative genes encoding acylase identified from the genome analysis, several deletion mutants were constructed. A quadruple mutant in which the four genes encoding acylase were in frame deleted (ΔSAM23877_1485::scarΔSAM23877_1734::scarΔSAM23877_0977::scarΔSAM23877_6191::scar strain) as well as a double mutant, ΔSAM23877_1485::scarΔSAM23877_1734::scar, have been constructed. In addition, SAM23877_1485 and SAM23877_1734 were in‐frame deleted (see Materials and Methods) giving rise to the mutants ΔSAM23877_1485::scar and ΔSAM23877_1734::scar (Table 1).

The hydrolytic activity against N‐α and N‐ε‐acetyl‐L‐lysine as substrates was determined in the crude extract from each mutant. As expected, no hydrolytic activity was found with the quadruple mutant. These results confirmed that this enzymatic activity was due to at least one of these four genes encoding acylase. We then analyzed the aminoacylase activity of the crude extract from the double mutant strain ΔSAM23877_1485::scarΔSAM23877_1734::scar. The concomitant deletion of SAM23877_1485 and SAM23877_1734 resulted in a dramatic decrease in the hydrolytic activity against both α and ε acetyl‐lysine. Indeed, the deletion of these two genes induced an 85% loss in the specific hydrolysis of N‐α‐acetyl‐L‐lysine (0.02 mmollys/(h gprotein vs 0.13 mmollys/(h gprotein) and a 75% reduction of N‐ε‐acetyl‐L‐lysine hydrolysis (0.03 mmollys/(h gprotein vs 0.11 mmollys/(h gprotein). From these results, it can be concluded that the aminoacylase activities are in large part due to the products of the genes SAM23877_1485 and SAM23877_1734. Consequently, the activities of the products of these two genes were further characterized.

3.4. Partial purification and research for a SAM23877_1485 and SAM23877_1734 specific activity

Two single mutant strains deleted either for SAM23877_1485 or SAM23877_1734 were analyzed for their aminoacylase activities to precise the enzyme activity related to each of these genes. Before the enzyme activity determination, a separation of the proteins from the crude extract was performed by ionic low pressure chromatography following the same protocol as with the wild‐type strain. The enzyme activity was then assayed in each collected fraction. The Table 4 highlighted the fractions in which the enzyme activity was significantly different compared to the wild‐type strain.

Table 4.

Hydrolysis of N‐α‐acetyl‐L‐lysine or N‐ε‐acetyl‐L‐lysine in selected fractions resulting from the separation of the proteins of the crude extracts of the S. ambofaciens wild‐type strain and mutant strains

Bacterial strain Aminoacylase activity with N‐ε‐acetyl‐L‐lysine as substrate (mmollys/(h gprotein) Aminoacylase activity with N‐α‐acetyl‐L‐lysine as substrate (mmollys/(h gprotein)
Fraction 3 Fraction 4 Fraction 5 Fraction 6
S. ambofaciens ATCC23877 0.49 0.45 2.9 1.8
Δ SAM23877_1485::scar 0.02 0.02 1.1 1.8
ΔSAM23877_1734::scar 0.68 0.54 0.04 0

Concerning the hydrolysis of N‐ε‐acetyl‐L‐lysine, a similar enzyme activity was measured in fractions from crude extracts from S. ambofaciens ATCC23877 and from the ΔSAM23877_1734::scar mutant. On the contrary, a dramatic decrease in the enzyme activity was observed in the fractions collected from the Δ SAM23877_1485::scar mutant (Table 4). This result showed that the product of the SAM23877_1485 gene is likely an amino‐acylase catalyzing the specific hydrolysis of N‐ε‐acetyl‐L‐lysine.

Regarding hydrolysis of N‐α‐acetyl‐L‐lysine, although the enzyme activity was quite similar in the fractions from the wild‐type strain and that from the Δ SAM23877_1485::scar mutant, a low activity was measured in the same fractions from a crude extract from the ΔSAM23877_1734::scar mutant. This result supported the hypothesis that SAM23877_1734 likely encodes a second aminoacylase, different from the product of SAM23877_1485 and specific for the hydrolysis of N‐α‐acetyl‐L‐lysine. This regio‐specificity of the enzyme encoded by SAM23877_1734 is surprising because the enzyme Sm‐AA produced by S. mobaraensis was not able to catalyze N‐acetyl‐L‐lysine hydrolysis 12.

To conclude, two aminoacylases catalyzing the hydrolysis of N‐acetyl‐L‐lysine have been identified in S. ambofaciens ATCC23877. The first one, the product of SAM23877_1734, has the propensity to hydrolyse the α amide bond of N‐α‐acetyl‐L‐lysine, whereas the second one, encoded by SAM23877_1485, mainly catalyzes the hydrolysis of N‐ε‐acetyl‐L‐lysine. These two enzymes were the source of most of the hydrolytic activity of S. ambofaciens crude extract. However, a probable existence of other aminoacylases potentially able to catalyze the hydrolysis of N‐α/ε‐acetyl‐L‐lysine has been highlighted. These last enzymes could also be responsible for the interesting acylation activity that was determined with lysine, SYK or LQKW as acyl acceptors. Indeed, this original regiospecificity of these aminocylases, different from that of lipases such as CALB, led to the N‐acylation in amino group and then preserve the functional side chains of any amino acids or peptides. However, further characterization and use of these enzymes imply the heterologous production of each of the aminoacylases identified in S. ambofaciens and their purification. This would broaden the perspectives of enzymatic acylation of bioactive molecules with enzymes exhibiting original selectivity.

Practical application

The potential of aminoacylase activities from Streptomyces ambofaciens, for the acylation of amino acids and peptides, was investigated. At least one enzyme of a crude extract from S. ambofaciens (probably the product of SAM23877_1734 gene) was able to catalyze the acylation of lysine on the amine group of the ε‐carbon but also of the α‐carbon in a buffered medium. Interestingly, the crude extract from S. ambofaciens also catalyzed the acylation of two peptides on their N‐terminal position. Such an original and interesting enzyme activity could constitute an alternative to chemical acylation of amino‐acids and peptides. It could allow the development of enzymatic processes for the acylation of a wide variety of amino‐acids (in α position) and peptides (in N‐terminal position) in an environmentally friendly medium.

Supporting information

Supporting information.

Acknowledgments

This work was supported partly by the “impact biomolecules” project of the « Lorraine Université d'Excellence » (PIA‐ANR), the French National Research Agency (ANR) through the “ISEAPIM3” project (ANR‐15‐CE07‐0023‐01), the “Structure Fédérative de Recherche Ecosystèmes Forestiers, Agroressources, Bioprocédés et Alimentation” of the University of Lorraine, the “Région Lorraine” and the European Union through the “Programme Opérationnel FEDER FSE Lorraine et Massif des Vosges 2014–2020”. The authors would like to thank Cécile Ritt, Julie Challant and Emilie Morel for their help in some of the manipulations.

The authors have declared no conflict of interest.

4 References

  • 1. Koreishi, M. , Kawasaki, R. , Imanaka, H. , Imamura, K. , et al., A novel ∈‐lysine acylase from Streptomyces mobaraensis for synthesis of N‐ε‐acyl‐l‐lysines. J. Am. Oil Chem. Soc. 2005, 82, 631–637. [Google Scholar]
  • 2. Wada, E. , Handa, M. , Imamura, K. , Sakiyama, T. , et al., Enzymatic synthesis of N‐acyl‐l‐amino acids in a glycerol‐water system using acylase I from pig kidney. J. Am. Oil Chem. Soc. 2002, 79, 41–46. [Google Scholar]
  • 3. George, A. , Modi, J. , Jain, N. , Bahadur, P. , A comparative study on the surface activity and micellar behavior of some N‐acylamino acid based surfactants. Ind. J. Chem. Sect. A. 1998, 37, 985–992. [Google Scholar]
  • 4. Rondel, C. , Alric, I. , Mouloungui, Z. , Blanco, J.‐F. , et al., Synthesis and properties of lipoamino acid–fatty acid mixtures: influence of the amphiphilic structure. J. Surfact. Deterg. 2009, 12, 269–275. [Google Scholar]
  • 5. Soo, E. , Salleh, A. , Basri, M. , Rahman, R.N.Z ., et al., Response surface methodological study on lipase‐catalyzed synthesis of amino acid surfactants. Process Biochem. 2004, 39, 1511–1518. [Google Scholar]
  • 6. Husson, E. , Humeau, C. , Paris, C. , Vanderesse, R. , et al., Enzymatic acylation of polar dipeptides: influence of reaction media and molecular environment of functional groups. Process Biochem. 2009, 44, 428–434. [Google Scholar]
  • 7. Husson, E. , Humeau, C. , Harscoat, C. , Framboisier, X. , et al., Enzymatic acylation of the polar dipeptide, carnosine: reaction performances in organic and aqueous media. Process Biochem. 2011, 46, 945–952. [Google Scholar]
  • 8. Koreishi, M. , Asayama, F. , Imanaka, H. , Imamura, K. , et al., Purification and characterization of a novel aminoacylase from Streptomyces mobaraensis . Biosci. Biotechnol. Biochem. 2005, 69, 1914–1922. [DOI] [PubMed] [Google Scholar]
  • 9. Koreishi, M. , Zhang, D. , Imanaka, H. , Imamura, K. , et al., A Novel acylase from Streptomyces mobaraensis that efficiently catalyzes hydrolysis/synthesis of capsaicins as well as N‐acyl‐l‐amino acids and N‐acyl‐peptides. J. Agric. Food Chem. 2006, 54, 72–78. [DOI] [PubMed] [Google Scholar]
  • 10. Koreishi, M. , Tani, K. , Ise, Y. , Imanaka, H. , et al., Enzymatic synthesis of β‐lactam antibiotics and N‐fatty‐acylated amino compounds by the acyl‐transfer reaction catalyzed by penicillin V acylase from Streptomyces mobaraensis . Biosci. Biotechnol. Biochem. 2007, 71, 1582–1586. [DOI] [PubMed] [Google Scholar]
  • 11. Koreishi, M. , Kawasaki, R. , Imanaka, H. , Imamura, K. , et al., Efficient N‐ɛ‐lauroyl‐l‐lysine production by recombinant ɛ‐lysine acylase from Streptomyces mobaraensis . J. Biotechnol. 2009, 141, 160–165. [DOI] [PubMed] [Google Scholar]
  • 12. Koreishi, M. , Nakatani, Y. , Ooi, M. , Imanaka, H. , et al., Purification, characterization, molecular cloning, and expression of a new aminoacylase from Streptomyces mobaraensis that can hydrolyze N‐(middle / long)‐chain‐fatty‐acyl‐L‐amino acids as well as N‐short‐chain‐acyl‐L‐amino acids. Biosci. Biotechnol. Biochem. 2009, 73, 1940–1947. [DOI] [PubMed] [Google Scholar]
  • 13. Ueda, S. , Kinoshita, M. , Tanaka, F. , Tsuboi, M. , et al., Strain selection and scale‐up fermentation for FR901379 acylase production by Streptomyces sp. no. 6907. J. Biosci. Bioeng. 2011, 112, 409–414. [DOI] [PubMed] [Google Scholar]
  • 14. Thibessard, A. , Haas, D. , Gerbaud, C. , Aigle, B. , et al., 2015. Complete genome sequence of Streptomyces ambofaciens ATCC 23877, the spiramycin producer. J. Biotechnol. 214, 117–118. [DOI] [PubMed] [Google Scholar]
  • 15. Pinnert‐Sindico, S. , Une nouvelle espèce de Streptomyces productrice d'antibiotiques: Streptomyces ambofaciens n. sp., caractères culturaux. Ann Inst Pasteur Paris 1954, 87, 702–707. [PubMed] [Google Scholar]
  • 16. Hanahan, D. , Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 1983, 166, 557–580. [DOI] [PubMed] [Google Scholar]
  • 17. Macneil, D. , Gewain, K. , Ruby, C. , Dezeny, G. , et al., Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 1992, 111, 61–68. [DOI] [PubMed] [Google Scholar]
  • 18. Datsenko, K.A. , Wanner, B.L. , One‐step inactivation of chromosomal genes in Escherichia coli K‐12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97, 6640–6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Choulet, F. , Aigle, B. , Gallois, A. , Mangenot, S. , et al., Evolution of the terminal regions of the Streptomyces linear chromosome. Mol. Biol. Evol. 2006, 23, 2361–2369. [DOI] [PubMed] [Google Scholar]
  • 20. Gust, B. , Challis, G.L. , Fowler, K. , Kieser, T. , et al., PCR‐targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 1541–1546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Raynal, A. , Karray, F. , Tuphile, K. , Darbon‐Rongere, E. , et al., Excisable cassettes: New tools for functional analysis of Streptomyces genomes. Appl. Environ. Microbiol. 2006, 72, 4839–4844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Fedoryshyn, M. , Petzke, L. , Welle, E. , Bechthold, A. , et al., Marker removal from actinomycetes genome using Flp recombinase. Gene 2008, 419, 43–47. [DOI] [PubMed] [Google Scholar]
  • 23. Bunet, R. , Riclea, R. , Laureti, L. , Hotel, L. , et al., A Single Sfp‐Type Phosphopantetheinyl transferase plays a major role in the biosynthesis of PKS and NRPS derived metabolites in Streptomyces ambofaciens ATCC23877. Plos One 2014, 9, e87607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Kieser, T. , Bibb, M.J. , Buttner, M.J. , Chater, K.F. , et al., Practical Streptomyces genetics. Int. Microbiol. 2000, 3, 260–261. [Google Scholar]
  • 25. Sambrook, J. , Fritsch, E.F. , Maniatis, T. , Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory, Green Publishing Associates and John Wiley and sons, New York, 1989. [Google Scholar]
  • 26. Bunet, R. , Mendes, M.V. , Rouhier, N. , Pang, X. , et al., Regulation of the synthesis of the angucyclinone antibiotic alpomycin in Streptomyces ambofaciens by the autoregulator receptor AlpZ and its specific ligand. J. Bacteriol. 2008, 190, 3293–3305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Pang, X. , Aigle, B. , Girardet, J.‐M. , Mangenot, S. , et al., Functional angucycline‐Like antibiotic gene cluster in the terminal inverted repeats of the Streptomyces ambofaciens linear chromosome. Antimicrob. Agents Chemother. 2004, 48, 575–588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Bradford, M.M. , A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein‐dye binding. Anal. Biochem. 1976, 72, 248–254. [DOI] [PubMed] [Google Scholar]
  • 29. Izumi, T. , Yagimuma, Y. , Haga, M. , Enzymatic syntheses of N‐lauroyl‐β‐alanine homologs in organic media. J. Am. Oil Chem. Soc. 1997, 74, 875–878. [Google Scholar]
  • 30. Ferrari, F. , Paris, C. , Maigret, B. , Bidouil, C. , et al., Molecular rules for chemo‐ and regio‐selectivity of Candida antarctica lipase B in peptide acylation reactions. J. Mol. Catal. B Enzym. 2014, 101, 122–132. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting information.


Articles from Engineering in Life Sciences are provided here courtesy of Maximum Academic Press

RESOURCES