Skip to main content
PLOS One logoLink to PLOS One
. 2020 Feb 4;15(2):e0228643. doi: 10.1371/journal.pone.0228643

Characterizing the role of Zn cluster family transcription factor ZcfA in governing development in two Aspergillus species

Ye-Eun Son 1, He-Jin Cho 1, Mi-Kyung Lee 2, Hee-Soo Park 1,3,*
Editor: Kap-Hoon Han4
PMCID: PMC6999877  PMID: 32017793

Abstract

Filamentous fungi reproduce asexually or sexually, and the processes of asexual and sexual development are tightly regulated by a variety of transcription factors. In this study, we characterized a Zn2Cys6 transcription factor in two Aspergillus species, A. nidulans (AN5859) and A. flavus (AFLA_046870). AN5859 encodes a Zn2Cys6 transcription factor, called ZcfA. In A. nidulans, ΔzcfA mutants exhibit decreased fungal growth, a reduction in cleistothecia production, and increased asexual reproduction. Overexpression of zcfA results in increased conidial production, suggesting that ZcfA is required for proper asexual and sexual development in A. nidulans. In conidia, deletion of zcfA causes decreased trehalose levels and decreased spore viability but increased thermal sensitivity. In A. flavus, the deletion of the zcfA homolog AFLA_046870 causes increased conidial production but decreased sclerotia production; these effects are similar to those of zcfA deletion in A. nidulans development. Overall, these results demonstrate that ZcfA is essential for maintaining a balance between asexual and sexual development and that some roles of ZcfA are conserved in Aspergillus spp.

Introduction

The genus Aspergillus consists of approximately 350 accepted species that are closely related [13]. Several species are useful for fermented food, enzyme production, and pharmaceutical purposes [4]. However, some Aspergillus species have detrimental effects on humans or plants [5]. Several fungi can also produce harmful secondary metabolites called mycotoxins [6, 7]. Aspergillus flavus is one of the key Aspergillus species and an agent of invasive aspergillosis in immunocompromised patients [8, 9]. A. flavus produces harmful secondary metabolites, called aflatoxins, that are potent carcinogens [10, 11]. The contamination of crops such as maize and peanuts with A. flavus causes significant economic loss [12]. Therefore, the control of A. flavus growth and aflatoxin production is crucial to the agricultural industry. To use Aspergillus species for the benefit of humanity, we must understand its biology. A. nidulans is a model organism for studies in fungal developmental biology and gene regulation; therefore, it is one of the best characterized Aspergillus species [13, 14].

The reproductive modes of A. nidulans can be divided into two types, sexual and asexual [15]. After the germ tube is formed from spores, it grows into hyphae, forming the mycelium, a web-like mass of fungal hyphae [16, 17]. After acquiring developmental competence, fungi can produce asexual or sexual developmental structures depending on environmental conditions [18, 19]. During the formation of conidiophores (asexual structures) or sexual fruiting bodies, a variety of genes and proteins participate in these processes [20, 21].

Transcription factors (TFs) are DNA-binding proteins that regulate transcription [22]. These proteins recognize specific DNA sequences in the vicinity of genes and induce or repress mRNA transcription. In the fungal genome database, 80 transcription factor families are found, and various TFs coordinate gene expression during growth and developmental processes [15, 23]. In asexual developmental processes, BrlA is a key TF for the initiation of conidiation [24, 25]. BrlA contains a C2H2 zinc finger DNA-binding domain that recognizes brlA response elements (BREs) in the promoter regions of certain genes, including abaA [26]. AbaA, a TEF1 family TF, activates mRNA expression of wetA and other genes in the middle phase of conidiogenesis [27, 28]. In asexual spores, a spore-specific TF WetA coordinates the mRNA expression of genes associated with spore maturation [29]. TFs BrlA, AbaA, and WetA play key roles in asexual development and are considered the core regulators of conidiation [30]. Together with these three TFs, other TFs play a vital role in the initiation of conidiation. For instance, upstream developmental activators, such as FlbB, FlbC, FlbD, and FlbE, induce brlA expression [31], whereas three key TFs, NsdD, SfgA, and VosA, repress conidiation [32]. In sexual developmental processes, NsdC and NsdD are key TFs that positively regulate sexual developmental processes [3335]. With these genes, a variety of TFs are reported to be involved in sexual reproduction [21].

The Zn cluster family (Zcf) is a fungal-specific family of TFs and is the largest family of TFs known in eukaryotes [23]. Zcf TFs contain several DNA binding motifs, such as the C2H2 zinc finger, the C4 zinc finger, and the C6 zinc finger, and are involved in a variety of cellular processes in fungi [36]. For example, CrzA is a C2H2 zinc finger TF that governs calcium homeostasis, fungal growth, and detoxification in A. nidulans [37, 38]. AflR contains a Cys6Zn2 binuclear cluster motif that activates the sterigmatocystin biosynthesis gene cluster in A. nidulans [39, 40]. Although several Zcf TFs have been characterized, the functions of many other Zcf TFs have not been elucidated. Previous studies have found putative target genes of VosA, a key transcription factor for conidial maturation, in A. nidulans conidia [41]. We screened mRNA levels of putative VosA target genes in conidia and found that one gene (AN5859) affected the mRNA expression of these target genes when vosA or velB were deleted in conidia (S1 Fig). In this study, we characterized the AN5859 gene, which encodes the Zcf protein ZcfA in two Aspergillus species, A. nidulans, and A. flavus.

Materials and methods

Strains, media, and culture conditions

The fungal strains used in this study are listed in Table 1. A. nidulans strains were grown on liquid or solid minimal media with 1% glucose (MMG) for general purposes or sexual medium (SM) for sexual development [42, 43]. To confirm the effects of overexpression of the A. nidulans zcfA (AnizcfA) mRNA under the alcA promoter [44], tested strains were inoculated on MMG, MM with 100 mM threonine as the sole carbon source (MMT), or YLC (0.1% yeast extract, 1.5% lactose, 30 mM cyclopentanone) at 37°C for 5 days [45, 46]. A. flavus strains were grown on MMG with 0.1% yeast extract (MMGY) for general tests. Escherichia coli DH5α cells were grown in Luria-Bertani medium with ampicillin (100 μg/mL) for plasmid amplification.

Table 1. Aspergillus strains used in this study.

Strain name Relevant genotype Referencesa
FGSC4 A. nidulans wild type FGSCb
RJMP1.59 pyrG89; pyroA4 [48]
TNJ36 pyrG89; AfupyrG +; pyroA4 [49]
THS30.1 pyrG89; AfupyrG+ [41]
TYE11.4~6 pyrG89; pyroA4; ΔAnizcfA::AfupyrG+ This study
TYE12.1 pyrG89; pyroA::AnizcfA(p)::zcfA::FLAG3x::pyroAc; ΔAnizcfA::AfupyrG+ This study
TYE17.1 pyrG89; AfupyrG+; pyroA::alc(p)::AnizcfA::FLAG::pyroAb; This study
NRRL 3357 A. flavus wild type ATCC collection
NRRL3357.5 pyrG- [50]
TTJ6.1 pyrG-; AfupyrG+ This study
THJ1.1~3 pyrG-; ΔAflzcfA::AfupyrG+ This study

a All A. nidulans strains carry the veA+ allele.

b Fungal Genetic Stock Center

c The 3/4 pyroA marker causes targeted integration at the pyroA locus.

For mRNA isolation, samples were collected as previously described [47]. For conidia, WT and mutant conidia were inoculated onto solid MMG and incubated for two days at 37°C. Conidia were then collected using Miracloth and stored at −80°C. For mycelia samples, WT and mutant conidia were inoculated into liquid MMG and incubated at 37°C for the indicated times. Cultured mycelia were collected, squeezed to remove moisture, and stored at -80°C. For developmental samples, submerged culture mycelia were filtered, washed, and spread in a monolayer on solid MMG, and the plates were incubated under light condition for asexual developmental induction or cultured under dark condition for sexual developmental induction.

Construction of the AnizcfA mutant strains

The oligonucleotide primers used in this study are listed in Table 2. To generate deletion mutant strains, the double-joint PCR (DJ-PCR) method was used [51]. The 5’- and 3’-flanking regions for AnizcfA were amplified with primer pairs OHS220:OHS222 and OHS221:OHS223, respectively, using A. nidulans FGSC4 (wild type, WT) genomic DNA as a template. The A. fumigatus pyrG (AfupyrG) marker was amplified with the primer pair OHS089:OHS090 using A. fumigatus AF293 genomic DNA as a template. The final PCR construct for the AnizcfA deletion cassette was amplified with the OHS224:OHS225 primer pair using the three DNA fragments from the first round of PCR (the 5’- and 3’-flanking regions and the AfupyrG marker) as the template. The AnizcfA deletion cassette was introduced into A. nidulans RJMP1.59 protoplasts generated by the Vinoflow FCE lysing enzyme (Novozymes) [52, 53]. Success was confirmed by PCR followed by restriction enzyme digestion (S2 Fig).

Table 2. Oligonucleotides used in this study.

Name Sequence (5′ → 3′)a Purpose
OHS0220 CCAATGAGTAGCAGCAACCTTG 5′ AnizcfA DF
OHS0221 GCGTCCGCTATCAGTTCTACCC 3′ AnizcfA DR
OHS0222 GGCTTTGGCCTGTATCATGACTTCA AACGTTCAAGTTGGTGAGAAGG 3′ AnizcfA with AfupyrG tail
OHS0223 TTTGGTGACGACAATACCTCCCGAC CGGCACCATATGTCCAGGAC 5′ AnizcfA with AfupyrG tail
OHS0224 GAGAGCTTGGAGAACAGCGAC 5′ AnizcfA NF
OHS0225 GCCATCGGACGTAGGACAAAC 3′ AnizcfA NR
OHS0395 aatt GCGGCCGC CCTGCAGAGTCCTACTTCCTCC 5′ AnizcfA with promoter & NotI
OHS0396 aatt GCGGCCGC CGCAGATGTAGGCGACAG 3′ AnizcfA with NotI
OHS0741 aatt GGATCC ATGGCTCCATCTTCTCGTCCT 5′ AnizcfA with BamHI
OHS0742 aatt GGATCC TCC TGC AAA CGG CGC AGA 3′ AnizcfA with BamHI
OHS0475 GTAGATCGCTTAGGTGAGCG 5′ AflzcfA DF
OHS0476 GGCTTTGGCCTGTATCATGACTTCA CCAACTCCACACGATCAGAC 3′ AflzcfA with AfupyrG tail
OHS0477 TTTGGTGACGACAATACCTCCCGAC CCACTCGCTCAGATGTAGGC 5′ AflzcfA with AfupyrG tail
OHS0478 CGGGTTGATCACCTTCATGCC 3′ AflzcfA DR
OHS0479 GTCCCACGATCATCTACCCAC 5′ AflzcfA NF
OHS0480 CATGGCTGTGCAGATCGAATAC 3′ AflzcfA NR
OHS0089 GCTGAAGTCATGATACAGGCCAAA 5′ AfupyrG marker_F
OHS0090 ATCGTCGGGAGGTATTGTCGTCAC 3′ AfupyrG marker_R
OHS0044 GTAAGGATCTGTACGGCAAC 5′ Ani_Actin RT_F
OHS0045 AGATCCACATCTGTTGGAAG 3′ Ani_Actin RT_R
OHS0580 CAAGGCATGCATCAGTACCC 5′ Ani_brlA RT_F
OHS0581 AGACATCGAACTCGGGACTC 3′ Ani_brlA RT_R
OHS0777 GGGAGCGAACAGTCTCACTA 5′ Ani_mutA RT_F
OHS0778 GTCGATTCCCGTTTCCTTGG 3′ Ani_mutA RT_R

a Tail sequences are shown in italics. Restriction enzyme sites are in bold.

To generate the ΔAnizcfA complemented strain, the WT AnizcfA gene region, including its predicted promoter, was amplified with the primer pair OHS395:OHS396, digested with NotI, and cloned into pHS13 [54]. The resulting plasmid pYE1.1 was then introduced into the recipient ΔAnizcfA strain TYE11.4 to give rise to TYE12.1. Complemented strains were selected from among the transformants and screened by PCR and quantitative RT-PCR (qRT-PCR) after induction of the promoter (S3 Fig).

Construction of the AnizcfA overexpression strain

To generate the alcA(p)::AnizcfA fusion construct, the AnizcfA open reading frame (ORF) derived from genomic DNA was amplified using the primer pair OHS741:OHS742. The PCR product was then digested with BamHI and cloned into pHS3, which contains the A. nidulans alcA promoter and the trpC terminator [54]. The resulting plasmid pYE2.1 was then introduced into TNJ36 [49]. Strains that overexpress AnizcfA were selected from among the transformants and screened by qRT-PCR after induction of the promoter (S4 Fig).

Construction of the AflzcfA deletion mutant strain

To produce the AflzcfA deletion cassette, the 5’ and 3’ flanking regions of the AflzcfA gene were amplified using the primer pairs OHS0475:OHS0476 and OHS0477:OHS0478, respectively, using A. flavus NRRL3357 genomic DNA as a template. The AfupyrG gene was used as a selective marker. The AflzcfA deletion cassette was amplified with primer pair OHS479:OHS480 and introduced into the recipient strain NRRL3357.5 [50]. Multiple (at least three) mutants were isolated and confirmed by PCR followed by restriction enzyme digestion (S5 Fig).

Nucleic acid isolation and qRT-PCR analysis

To isolate genomic DNA, approximately 106 conidia of WT and mutant strains were inoculated in 2 ml liquid MMG + 0.5% yeast extract medium and allowed to grow in stationary culture at 37˚C for 24 h. The mycelial mat was collected, squeeze-dried, and genomic DNA was isolated as described [53].

For qRT-PCR analyses, total RNA isolation was carried out as previously described [55, 56]. Briefly, fresh conidia were collected and homogenized using a Mini-Bead Beater (BioSpec Products, USA) in the presence of 1 ml of TRIzol reagent (Invitrogen, USA) and 0.3 ml of zirconia/silica beads (RPI Corp., USA). The supernatant was mixed with an equal amount of cold isopropanol. After centrifugation, the supernatant was removed, and the pellet washed with 70% DEPC (diethyl pyrocarbonate)-ethanol. cDNA was synthesized from total RNA using reverse transcriptase (Promega, USA). The qRT-PCR procedure was performed using iTaq Universal SYBR Green Supermix (Bio-Rad, USA) and CFX96 Touch Real-Time PCR (Bio-Rad, USA). For an endogenous control, β-actin gene was used.

Conidial viability assay

To test conidial viability, conidia from two-day-old and ten-day-old cultures of WT and mutant strains were collected using ddH2O with 0.01% Triton X-100 (Sigma, USA) [47]. After counting the number of conidia with a hematocytometer, approximately 100 conidia were inoculated onto solid MMG and incubated at 37˚C for 48 h in triplicate. After incubation, colony-forming units were counted.

Conidia trehalose analysis

The conidia trehalose assay was performed as previously described [57]. Briefly, conidia (2 × 108) from two-day-old cultures of WT and mutant strains were collected, washed with ddH2O, resuspended in 200 μl of ddH2O, and incubated at 95°C for 20 min. The supernatant was collected after centrifugation and was transferred to a new tube. An equal volume of 0.2 M sodium citrate (pH 5.5) was added, and the sample was incubated at 37°C for 8 h with or without (as a negative control) 3 mU of trehalase (Sigma, USA). The amount of glucose generated from the trehalose was assayed with a Glucose Assay Kit (Sigma, USA) in triplicate.

Thermal stress response assay

Thermal tolerance tests were carried out as previously described [57, 58]. Briefly, approximately 103 conidia per ml were incubated for 15 min at 55°C. The conidial suspension was then diluted with ddH2O, and the conidia were inoculated onto solid MMG. After incubation at 37°C for 48 h, colony numbers were counted and calculated as a survival ratio relative to counts obtained from the untreated control.

Sterigmatocystin (ST) extraction and thin-layer chromatography (TLC) analysis

Briefly, 105 conidia of each strain were inoculated into 5 ml liquid complete medium (CM) and cultured at 30°C for 7 days. Secondary metabolites were extracted by adding 5 ml of CHCl3, and the organic phase was separated by centrifugation and transferred to new glass vials. The organic phase was evaporated in an oven, and the residue was resuspended in 100 μl of CHCl3. Secondary metabolites were spotted onto a TLC silica plate that included a fluorescence indicator (Kieselgel 60, 0.25 mm; Merck) and resolved in chloroform:ethyl acetate (9:1, v/v). The images of TLC plates were captured following exposure to ultraviolet illumination at 366 nm. The TLC plate was then treated with 1% aluminum hydroxide hydrate (Sigma, USA). Quantification of ST spot intensity (366 nm on the TLC plates) was calculated using ImageJ software. Experiments were performed in triplicate per strain.

Microscopy

Photographs of colonies were taken with a Pentax MX-1 digital camera. Photomicrographs were taken with a Zeiss Lab.A1 microscope equipped with an AxioCam 105c camera and AxioVision (Rel. 4.9) digital imaging software.

Statistical analysis

Statistical differences between WT and mutant strains were evaluated by Student’s unpaired t-test. Mean ± standard deviation (SD) are shown. P values < 0.05 were considered to be significant. (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Results

ZcfA homologs in Aspergillus species

Previous studies reported that the Zn cluster family TFs are major TFs in fungi and are involved in various biological processes [23, 36]. In this study, we characterized the Zcf TF ZcfA (AN5859) in the model fungus A. nidulans. AN5859 encodes a protein that contains a GAL4-like Zn2Cys6 binuclear cluster DNA-binding domain at the N-terminus and a fungal transcription factor regulatory middle homology region (MHR). To find homologs in other Aspergillus species, we screened the Aspergillus genome database. Interestingly, although most Aspergillus species contain ZcfA homologs, a ZcfA homolog is not seen in Aspergillus strains belonging to the section Fumigati, such as A. fumigatus (Fig 1A). To characterize the zcfA gene in A. nidulans, we first investigated the expression of AnizcfA mRNA during the fungal lifecycle. AnizcfA mRNA levels increase 12 h after induction of asexual development and decrease in conidia (Fig 1B).

Fig 1. mRNA expression and homology analysis of zcfA.

Fig 1

(A) A phylogenetic tree of ZcfA homolog proteins identified in Aspergillus species including A. oryzae (AO090011000890), A. flavus (AFL2T 05600), A. aculeatus (Aacu16872 022319), A. carbonarius (Acar5010 135246), A. brasiliensis (Aspbr1 0342992), A. niger (An05g00720), A. tubingensis (Asptu1 0179334), A. acidus (Aspfo1 0647932), A. kawachii (Aspka1 0176601), A. terreus (ATET 09653), A. nidulans (AN5859), A. sydowii (Aspsy1 0057764), A. versicolor (Aspve1 0131022), A. clavatus (ACLA 079980), A. zonatus (Aspzo1 0147994), A. glaucus (Aspgl1 0124911), and A. wentii (Aspwe1 0118518; Aspwe1 0030707). A phylogenetic tree of ZcfA homologs was generated by MEGA 5 software (http://www.megasoftware.net/) using the alignment data from ClustalW2. The tree results were submitted to iTOL (http://itol.embl.de/) to generate the figure. (B) mRNA levels of zcfA during the lifecycle of A. nidulans. Time (h) of incubation in liquid culture (V) or in post asexual developmental induction (A) is shown. Conidia (asexual spores) are indicated as C.

The role of AnizcfA in fungal growth and asexual development

To further characterize AnizcfA, an AnizcfA deletion (ΔAnizcfA) mutant and complemented strains were generated, and their phenotypes examined. WT, ΔAnizcfA, and complemented (C’ AnizcfA) strains were point-inoculated onto MM solid media, incubated under light and dark conditions, and then colony growth and production of asexual spores were assessed (S6 Fig). As shown in Fig 2, the colony diameter of the ΔAnizcfA strain under both light and dark conditions was less than those of WT and complemented strains. However, the ΔAnizcfA strain produced more conidia per plate under both dark and light conditions. These results indicate that ZcfA is required for proper growth and conidiation in A. nidulans.

Fig 2. Phenotypic analysis of the ΔAnizcfA mutant.

Fig 2

(A) Colony photographs of WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains that were point-inoculated on solid MMG and grown for five days under light or dark conditions. (B) Quantitative analysis of colony diameter for WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains shown in (A). Error bars indicate the standard error of the mean in triplicate samples (Control vs. ΔAnizcfA strains, *** p ≤ 0.001). (C) Quantitative analysis of asexual spore production of WT (FGSC4), ΔAnizcfA (TYE11.4), and the complemented (TYE12.1) strains shown in (A) (Control vs. ΔAnizcfA strains, * p ≤ 0.05; *** p ≤ 0.001).

To further test the role of ZcfA in developmental processes, the ΔAnizcfA strain was inoculated onto SM and incubated under dark conditions. The WT and complemented strains produced more sexual fruiting bodies under these conditions, but the ΔAnizcfA strain produced asexual spores predominantly and a negligible number of sexual fruiting bodies (Fig 3A). To test whether the deletion of AnizcfA affects the expression of genes involved in asexual and sexual development, submerged culture mycelia of WT, ΔAnizcfA, and C’ AnizcfA strains were spread onto solid MMG and cultured under dark conditions to induce sexual development (Fig 3B). After cultivation, the samples were collected, and the mRNA expression of α-1,3-mutanase (mutA), a gene that is specifically expressed in Hülle cells [59], and brlA, a key gene in conidial initiation [24] were measured. As shown in Fig 3C, deletion of AnizcfA leads to reduced (or delayed) mRNA expression of mutA. In contrast, mRNA expression of brlA is induced in the ΔAnizcfA strain. Taken together, these results suggest that ZcfA is critical for fungal growth and maintaining a balance between asexual and sexual development in A. nidulans.

Fig 3. Sexual development phenotypes of the ΔzcfA mutant.

Fig 3

(A) Colony photographs of WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains that were point-inoculated on solid SM and grown for seven days under dark conditions. The bottom panel shows close-up views of the center of the plates. (B) Phenotypes of WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains after induction of sexual development. (C) qRT-PCR analyses of mutA and brlA mRNA levels in WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains. Numbers indicate the time (h) after the induction of sexual development.

Role of AniZcfA in conidial viability and trehalose content

To investigate the role of AniZcfA in conidia, we first examined the viability of conidia produced by the ΔAnizcfA strain. As shown in Fig 4A, the viability of ΔAnizcfA conidia decreased at ten days compared with that at two days. We then measured the amount of trehalose produced by WT, ΔAnizcfA, and C’ strains and found that trehalose levels in ΔAnizcfA conidia were slightly lower than those in WT and complemented conidia (Fig 4B). A previous study reported that conidial trehalose affects tolerance to thermal stresses in A. nidulans conidia [57]. To determine whether the lower level of trehalose in ΔAnizcfA conidia alters their stress response, thermal tolerance was assayed. The ΔAnizcfA conidia were more sensitive to heat stress than WT and C' conidia (Fig 4C). Although the phenotype of the ΔAnizcfA conidia is only slightly changed, these results suggest that ZcfA plays a key role in conidial viability and trehalose levels in A. nidulans.

Fig 4. Role of AniZcfA in conidial viability and trehalose content.

Fig 4

(A) Viability of the conidia of WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains grown for 2 and 10 days (WT vs. ΔAnizcfA strains, * p ≤ 0.05). (B) Amount of trehalose per 108 conidia in the two-day-old conidia of WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains (measured in triplicate) (WT vs. ΔAnizcfA strains, *** p ≤ 0.001). (C) Tolerance of WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) conidia to thermal stress (50°C, triplicate measurements) (WT vs. ΔAnizcfA strains, * p ≤ 0.05).

Overexpression of AnizcfA leads to increased conidia production

To further investigate the role of AnizcfA in fungal development, a strain that overexpresses AnizcfA was developed. Control and AnizcfA overexpression mutant (OEzcfA) strains were inoculated under non-inducing and inducing conditions (Fig 5). Under conditions that induce the alcA promoter (MMT medium), overexpression of AnizcfA results in increased production of asexual spores. In YLC media (another alcA-inducing condition), AnizcfA overexpression strains produced fewer sexual fruiting bodies than WT. These results support the idea that AniZcfA is essential for proper developmental processes.

Fig 5. Effect of AnizcfA overexpression.

Fig 5

(A) Control (THS30) and OEzcfA (AnizcfA overexpression, TYE17.1) strains were point-inoculated on solid MMG (non-inducing), MMT (100 mM threonine, inducing), and YLC (inducing) media and photographed at day 4 or 7. (B) Quantitative analysis of conidial production in control (THS30) and OEzcfA (TYE17.1) strains shown in (A) (** p ≤ 0.01).

Deletion of AnizcfA alters sterigmatocystin production

Because fungal development is associated with secondary metabolism [60], we hypothesized that zcfA might be involved in secondary metabolism. To test whether zcfA affects ST production in A. nidulans, secondary metabolites were extracted from WT, ΔAnizcfA, and C’ strains. Three independent samples were extracted, spotted, and loaded onto TLC plates. The ΔAnizcfA strain produced more ST than WT or complemented strains (Fig 6). However, the overexpression of zcfA did not affect ST production (S7 Fig). This suggests that ZcfA influences the production of ST in A. nidulans.

Fig 6. Sterigmatocystin production in the ΔzcfA mutant.

Fig 6

(A) Thin-layer chromatography (TLC) analysis of sterigmatocystin (ST) produced by WT (FGSC4), ΔAnizcfA (TYE11.4), and C’ AnizcfA (TYE12.1) strains. (B) Intensity of the ST bands using ImageJ software (WT vs. ΔAnizcfA strains, * p ≤ 0.05).

ZcfA homolog is required for development in A. flavus

As mentioned above, ZcfA is conserved in most Aspergillus species and plays a crucial role in fungal development in the model organism, A. nidulans. Therefore, we hypothesized that ZcfA homologs might play similar roles in other Aspergillus species and tested this hypothesis in A. flavus. We generated an A. flavus zcfA deletion mutant strains (ΔAflzcfA) and examined their developmental phenotypes (S8 Fig). WT and ΔAflzcfA mutant strains were inoculated onto MMGY, and the plates were incubated under light and dark conditions (Fig 7A). The deletion of AflzcfA causes increased production of asexual spores in both light and dark conditions (Fig 7B). In addition, the ΔAflzcfA mutant cannot produce sclerotia, or sexual structures, in this condition (Fig 7C and 7D). These results suggest that ZcfA is essential for proper fungal development and that its function is similar among Aspergillus species that contain a homolog of ZcfA.

Fig 7. Roles of ZcfA in A. flavus.

Fig 7

(A) Colony photographs of control (TTJ6.1) and ΔAflzcfA (THJ1.1) strains that were point-inoculated on solid MMGY and grown for five days under light or dark conditions. (B) Quantitative analysis of the colony diameter of the control (TTJ6.1) and ΔAflzcfA (THJ1.1) strains shown in (A) (Control vs. ΔAflzcfA strains, ** p ≤ 0.01; *** p ≤ 0.001). (C) Colony morphology of control (TTJ6.1) and ΔAflzcfA (THJ1.1) strains were point-inoculated on solid MMGY and grown at 37°C under dark conditions for 7 days. The plates were washed with 100% ethanol to enable the visualization of sclerotia. (D) Quantitative analysis of sclerotia production of control (TTJ6.1) and ΔAflzcfA (THJ1.1) strains shown in (C) (Control vs. ΔAflzcfA strains, *** p ≤ 0.001).

Discussion

Zcf proteins are a family of fungal-specific TFs that are the largest known family of TFs among eukaryotes [36]. In the A. nidulans genome, approximately 50 proteins that contain C6 zinc finger motifs have been identified, and these Zcf proteins regulate the expression of genes associated with primary and secondary metabolism. For example, AflR acts as an activator for the ST biosynthesis gene cluster [39]. AmyR is also a Zn2Cys6 transcription activator that regulates amylolytic gene expression [61, 62]. In this study, we characterized the Zn2Cys6 transcription factor ZcfA in two Aspergillus species. In both species, ΔzcfA mutant strains exhibited increased conidial production and decreased formation of sexual fruiting bodies, suggesting that ZcfA may act as an asexual development repressor or a sexual development activator. To further examine the role of ZcfA, phenotypes, zcfA overexpression strains were examined in A. nidulans. Contrary to our expectation, overexpression of zcfA increased asexual spore production but decreased the production of sexual fruiting bodies. This result implies that ZcfA may not be an asexual development repressor or a sexual development activator. Our results suggest that ZcfA appears to be essential for proper fungal development in A. nidulans.

As shown in Fig 1A, zcfA mRNA expression in A. nidulans increases during asexual development, suggesting that zcfA expression might regulate other regulators of asexual development, such as BrlA or AbaA. We examined the zcfA promoter region and found several AbaA response elements (AREs, 5’-CATTCY-3’) [28] but no BrlA response elements (BRE) [26]. Further zcfA expression analysis will be conducted to elucidate how zcfA expression is regulated during asexual development. In conidia, mRNA expression of zcfA was decreased (Fig 1). It is possible that transcription factors (e.g., WetA, VosA, and VelB) that are important for spore maturation are involved in the expression of zcfA mRNA. We have measured zcfA transcript levels in ΔwetA, ΔvosA, and ΔvelB mutant conidia. Our preliminary data (S1 Fig) and published data [29] show that zcfA mRNA levels in conidia from these mutants are increased compared to WT. Overall, these results indicate that zcfA mRNA levels may be regulated by certain asexual regulators in A. nidulans.

In conidia, ZcfA affects spore viability, trehalose contents, and thermal tolerance in A. nidulans. It appears that these roles of ZcfA are conserved in the development of two Aspergillus species; therefore, we hypothesize that the roles of ZcfA might be conserved in conidia. We examined the role of ZcfA in A. flavus conidia and found that trehalose contents, conidial viability, and stress response of ΔAflzcfA mutant conidia were similar to those of WT conidia. These results suggest that the roles of ZcfA role in conidia are not conserved among Aspergillus species.

In summary, we characterized the Zn cluster family transcription factor ZcfA in the model organism A. nidulans and A. flavus. In both species, ZcfA affects fungal differentiation. The deletion of zcfA causes a decrease (or lack of) in the formation of sexual fruiting bodies in both Aspergillus species. ZcfA does not act as a repressor or activator of fungal development, yet it is required for proper asexual and sexual development in Aspergillus species. In A. nidulans, ZcfA is involved in spore viability and secondary metabolism. Although the roles of ZcfA have been characterized in A. nidulans, the regulatory mechanisms of ZcfA function are not yet known. Further genomic and biochemical studies will provide insight into the regulatory mechanisms of ZcfA in Aspergillus species.

Supporting information

S1 Fig. Levels of zcfA mRNAs.

(A) AnizcfA mRNA levels in WT, ΔAnivosA, and ΔAnivelB mutant conidia. (B) AflzcfA mRNA levels in WT, ΔAflvosA, and ΔAflvelB mutant conidia. To calculate the expression levels of the AnizcfA and AflzcfA genes, the 2-ΔΔCT method was used, with β-actin as an endogenous control. Statistical differences between WT and mutant strains were analyzed by the Student’s unpaired t-test. Error bars indicate the standard error of the mean in triplicate samples.

(TIF)

S2 Fig. Verification of the ΔAnizcfA mutant.

(A) Diagram of the strategy used to generate the ΔAnizcfA mutant strain. Arrows indicate the primers used to verify the mutant strain. (B) PCR verification of the ΔAnizcfA mutant strain. (C) Restriction enzyme digestion verification of the ΔAnizcfA mutant strain.

(TIF)

S3 Fig. Verification of the C’AnizcfA strain.

(A) PCR verification of the C’AnizcfA strain. (B) qRT-PCR verification of the C’AnizcfA strain. To calculate the expression levels of AnizcfA, the 2-ΔΔCT method was used, with β-actin as an endogenous control. Statistical differences between WT and mutant strains were analyzed by the Student’s unpaired t-test. Error bars indicate the standard error of the mean in triplicate samples.

(TIF)

S4 Fig. Verification of the OEzcfA mutant strains.

(A) qRT-PCR verification of the OEzcfA strains. (B) Phenotype of the OEzcfA mutant strains. To calculate the expression levels of AnizcfA, the 2-ΔΔCT method was used, with β-actin as an endogenous control. Statistical differences between WT and mutant strains were analyzed by the Student’s unpaired t-test. Error bars indicates the standard error of the mean in triplicate samples.

(TIF)

S5 Fig. Verification of the ΔAflzcfA mutant.

(A) Diagram of the strategy for to generate the ΔAflzcfA mutants. Arrows indicate the primers used to verify the mutant strain. (B) PCR verification of the ΔAflzcfA mutant strain. (C) Restriction enzyme digestion verification of the ΔAnizcfA mutant strain.

(TIF)

S6 Fig. Phenotype of the ΔAnizcfA mutant strains.

Colony photographs of WT (FGSC4) and ΔAnizcfA (TYE11.4–6) that were point-inoculated on solid MMG and grown for five days under light or dark conditions.

(TIF)

S7 Fig. Sterigmatocystin production in the OEzcfA mutant.

(A-B) Thin-layer chromatography (TLC) analysis of sterigmatocystin (ST) produced by WT and OEzcfA strains in MMT (A) or YLC (B) inducing media.

(TIF)

S8 Fig. Phenotype of the ΔAflzcfA mutant strains.

(A) Colony photographs of control (TTJ6.1) and ΔAflzcfA (THJ1.1–3) strains that were point-inoculated on solid MMGY and grown for five days under light or dark conditions. (B) Colony morphology of control (TTJ6.1) and ΔAflzcfA (THJ1.1–3) strains were point-inoculated on solid MMGY and grown at 37°C under dark conditions for 7 days. The plates were washed with 100% ethanol to visualize sclerotia.

(TIF)

Acknowledgments

H.S.P. is supported by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIP: No. 2016010945). M.K.L. is supported by the KRIBB Research Initiative Program (KGM5231921).

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

HSP is supported by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIP: No. 2016010945). MKL is supported by the KRIBB Research Initiative Program (KGM5231921). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Bennett JW. An Overview of the Genus Aspergillus. Aspergillus: Molecular Biology and Genomics. 2010:1–17. ISI:000271175100001. [Google Scholar]
  • 2.Tsang CC, Tang JYM, Lau SKP, Woo PCY. Taxonomy and evolution of Aspergillus, Penicillium and Talaromyces in the omics era—Past, present and future. Comput Struct Biotechnol J. 2018;16:197–210. Epub 2018/07/14. 10.1016/j.csbj.2018.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kocsube S, Perrone G, Magista D, Houbraken J, Varga J, Szigeti G, et al. Aspergillus is monophyletic: Evidence from multiple gene phylogenies and extrolites profiles. Stud Mycol. 2016;85:199–213. Epub 2017/01/14. 10.1016/j.simyco.2016.11.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Park HS, Jun SC, Han KH, Hong SB, Yu JH. Diversity, Application, and Synthetic Biology of Industrially Important Aspergillus Fungi. Adv Appl Microbiol. 2017;100:161–202. Epub 2017/07/25. 10.1016/bs.aambs.2017.03.001 . [DOI] [PubMed] [Google Scholar]
  • 5.Paulussen C, Hallsworth JE, Alvarez-Perez S, Nierman WC, Hamill PG, Blain D, et al. Ecology of aspergillosis: insights into the pathogenic potency of Aspergillus fumigatus and some other Aspergillus species. Microb Biotechnol. 2017;10(2):296–322. Epub 2016/06/09. 10.1111/1751-7915.12367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kamei K, Watanabe A. Aspergillus mycotoxins and their effect on the host. Med Mycol. 2005;43 Suppl 1:S95–9. Epub 2005/08/23. 10.1080/13693780500051547 . [DOI] [PubMed] [Google Scholar]
  • 7.Keller NP. Fungal secondary metabolism: regulation, function and drug discovery. Nat Rev Microbiol. 2019;17(3):167–80. Epub 2018/12/12. 10.1038/s41579-018-0121-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Krishnan S, Manavathu EK, Chandrasekar PH. Aspergillus flavus: an emerging non-fumigatus Aspergillus species of significance. Mycoses. 2009;52(3):206–22. Epub 2009/02/12. 10.1111/j.1439-0507.2008.01642.x . [DOI] [PubMed] [Google Scholar]
  • 9.Rudramurthy SM, Paul RA, Chakrabarti A, Mouton JW, Meis JF. Invasive Aspergillosis by Aspergillus flavus: Epidemiology, Diagnosis, Antifungal Resistance, and Management. J Fungi (Basel). 2019;5(3). Epub 2019/07/04. 10.3390/jof5030055 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Klich MA. Aspergillus flavus: the major producer of aflatoxin. Mol Plant Pathol. 2007;8(6):713–22. Epub 2007/11/01. 10.1111/j.1364-3703.2007.00436.x . [DOI] [PubMed] [Google Scholar]
  • 11.Amaike S, Keller NP. Aspergillus flavus. Annu Rev Phytopathol. 2011;49:107–33. Epub 2011/04/26. 10.1146/annurev-phyto-072910-095221 . [DOI] [PubMed] [Google Scholar]
  • 12.Mitchell NJ, Bowers E, Hurburgh C, Wu F. Potential economic losses to the US corn industry from aflatoxin contamination. Food Addit Contam Part A Chem Anal Control Expo Risk Assess. 2016;33(3):540–50. Epub 2016/01/26. 10.1080/19440049.2016.1138545 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Casselton L, Zolan M. The art and design of genetic screens: filamentous fungi. Nat Rev Genet. 2002;3(9):683–97. Epub 2002/09/05. 10.1038/nrg889 . [DOI] [PubMed] [Google Scholar]
  • 14.Martinelli SD. Aspergillus nidulans as an experimental organism. Prog Ind Microbiol. 1994;29:33–58. Epub 1994/01/01. . [PubMed] [Google Scholar]
  • 15.Ojeda-Lopez M, Chen W, Eagle CE, Gutierrez G, Jia WL, Swilaiman SS, et al. Evolution of asexual and sexual reproduction in the aspergilli. Stud Mycol. 2018;91:37–59. Epub 2018/11/15. 10.1016/j.simyco.2018.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Harris SD. Branching of fungal hyphae: regulation, mechanisms and comparison with other branching systems. Mycologia. 2008;100(6):823–32. Epub 2009/02/11. 10.3852/08-177 . [DOI] [PubMed] [Google Scholar]
  • 17.Harris SD. Hyphal morphogenesis: an evolutionary perspective. Fungal Biol. 2011;115(6):475–84. Epub 2011/06/07. 10.1016/j.funbio.2011.02.002 . [DOI] [PubMed] [Google Scholar]
  • 18.Noble LM, Andrianopoulos A. Reproductive competence: a recurrent logic module in eukaryotic development. Proc Biol Sci. 2013;280(1766):20130819 Epub 2013/07/19. 10.1098/rspb.2013.0819 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Park H-S, Lee M-K, Han K-H, Kim M-J, Yu J-H. Developmental Decisions in Aspergillus nidulans. In: Hoffmeister D, Gressler M, editors. Biology of the Fungal Cell. 3rd ed2019. p. 63–80. [Google Scholar]
  • 20.Adams TH, Wieser JK, Yu JH. Asexual sporulation in Aspergillus nidulans. Microbiol Mol Biol Rev. 1998;62(1):35–54. Epub 1998/04/08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Dyer PS, O'Gorman CM. Sexual development and cryptic sexuality in fungi: insights from Aspergillus species. FEMS Microbiol Rev. 2012;36(1):165–92. Epub 2011/11/19. 10.1111/j.1574-6976.2011.00308.x . [DOI] [PubMed] [Google Scholar]
  • 22.Lambert SA, Jolma A, Campitelli LF, Das PK, Yin YM, Albu M, et al. The Human Transcription Factors. Cell. 2018;172(4):650–65. 10.1016/j.cell.2018.01.029 WOS:000424648800008. [DOI] [PubMed] [Google Scholar]
  • 23.Shelest E. Transcription Factors in Fungi: TFome Dynamics, Three Major Families, and Dual-Specificity TFs. Front Genet. 2017;8 10.3389/fgene.2017.00053 WOS:000402731900001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Adams TH, Boylan MT, Timberlake WE. brlA is necessary and sufficient to direct conidiophore development in Aspergillus nidulans. Cell. 1988;54(3):353–62. Epub 1988/07/29. 10.1016/0092-8674(88)90198-5 . [DOI] [PubMed] [Google Scholar]
  • 25.Adams TH, Deising H, Timberlake WE. brlA requires both zinc fingers to induce development. Mol Cell Biol. 1990;10(4):1815–7. Epub 1990/04/01. 10.1128/mcb.10.4.1815 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chang YC, Timberlake WE. Identification of Aspergillus brlA response elements (BREs) by genetic selection in yeast. Genetics. 1993;133(1):29–38. Epub 1993/01/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Andrianopoulos A, Timberlake WE. ATTS, a new and conserved DNA binding domain. Plant Cell. 1991;3(8):747–8. Epub 1991/08/01. 10.1105/tpc.3.8.747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Andrianopoulos A, Timberlake WE. The Aspergillus nidulans abaA gene encodes a transcriptional activator that acts as a genetic switch to control development. Mol Cell Biol. 1994;14(4):2503–15. Epub 1994/04/01. 10.1128/mcb.14.4.2503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wu MY, Mead ME, Lee MK, Ostrem Loss EM, Kim SC, Rokas A, et al. Systematic Dissection of the Evolutionarily Conserved WetA Developmental Regulator across a Genus of Filamentous Fungi. mBio. 2018;9(4). Epub 2018/08/23. 10.1128/mBio.01130-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mirabito PM, Adams TH, Timberlake WE. Interactions of three sequentially expressed genes control temporal and spatial specificity in Aspergillus development. Cell. 1989;57(5):859–68. Epub 1989/06/02. 10.1016/0092-8674(89)90800-3 . [DOI] [PubMed] [Google Scholar]
  • 31.Etxebeste O, Garzia A, Espeso EA, Ugalde U. Aspergillus nidulans asexual development: making the most of cellular modules. Trends Microbiol. 2010;18(12):569–76. Epub 2010/11/03. 10.1016/j.tim.2010.09.007 . [DOI] [PubMed] [Google Scholar]
  • 32.Lee MK, Kwon NJ, Lee IS, Jung S, Kim SC, Yu JH. Negative regulation and developmental competence in Aspergillus. Sci Rep. 2016;6:28874 Epub 2016/07/02. 10.1038/srep28874 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kim HR, Chae KS, Han KH, Han DM. The nsdC gene encoding a putative C2H2-type transcription factor is a key activator of sexual development in Aspergillus nidulans. Genetics. 2009;182(3):771–83. Epub 2009/05/07. 10.1534/genetics.109.101667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lee MK, Kwon NJ, Choi JM, Lee IS, Jung S, Yu JH. NsdD is a key repressor of asexual development in Aspergillus nidulans. Genetics. 2014;197(1):159–73. Epub 2014/02/18. 10.1534/genetics.114.161430 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Han KH, Han KY, Yu JH, Chae KS, Jahng KY, Han DM. The nsdD gene encodes a putative GATA-type transcription factor necessary for sexual development of Aspergillus nidulans. Mol Microbiol. 2001;41(2):299–309. Epub 2001/08/08. 10.1046/j.1365-2958.2001.02472.x . [DOI] [PubMed] [Google Scholar]
  • 36.MacPherson S, Larochelle M, Turcotte B. A fungal family of transcriptional regulators: The zinc cluster proteins. Microbiol Mol Biol Rev. 2006;70(3):583–+. 10.1128/MMBR.00015-06 WOS:000240533200001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hagiwara D, Kondo A, Fujioka T, Abe K. Functional analysis of C2H2 zinc finger transcription factor CrzA involved in calcium signaling in Aspergillus nidulans. Curr Genet. 2008;54(6):325–38. 10.1007/s00294-008-0220-z WOS:000261027500004. [DOI] [PubMed] [Google Scholar]
  • 38.Spielvogel A, Findon H, Arst HN, Araujo-Bazan L, Hernandez-Ortiz P, Stahl U, et al. Two zinc finger transcription factors, CrzA and SltA, are involved in cation homoeostasis and detoxification in Aspergillus nidulans. Biochem J. 2008;414:419–29. 10.1042/BJ20080344 WOS:000259512500011. [DOI] [PubMed] [Google Scholar]
  • 39.Fernandes M, Keller NP, Adams TH. Sequence-specific binding by Aspergillus nidulans AflR, a C(6) zinc cluster protein regulating mycotoxin biosynthesis. Mol Microbiol. 1998;28(6):1355–65. 10.1046/j.1365-2958.1998.00907.x WOS:000074446800028. [DOI] [PubMed] [Google Scholar]
  • 40.Yu JH, Butchko RAE, Fernandes M, Keller NP, Leonard TJ, Adams TH. Conservation of structure and function of the aflatoxin regulatory gene aflR from Aspergillus nidulans and A. flavus. Curr Genet. 1996;29(6):549–55. 10.1007/bf02426959 WOS:A1996UP31900007. [DOI] [PubMed] [Google Scholar]
  • 41.Park HS, Man Yu Y, Lee MK, Jae Maeng P, Chang Kim S, Yu JH. Velvet-mediated repression of beta-glucan synthesis in Aspergillus nidulans spores. Sci Rep. 2015;5:10199 Epub 2015/05/12. 10.1038/srep10199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kafer E. Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv Genet. 1977;19:33–131. Epub 1977/01/01. 10.1016/s0065-2660(08)60245-x . [DOI] [PubMed] [Google Scholar]
  • 43.Park HS, Nam TY, Han KH, Kim SC, Yu JH. VelC positively controls sexual development in Aspergillus nidulans. PLoS One. 2014;9(2):e89883 Epub 2014/03/04. 10.1371/journal.pone.0089883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.McKnight GL, Kato H, Upshall A, Parker MD, Saari G, O'Hara PJ. Identification and molecular analysis of a third Aspergillus nidulans alcohol dehydrogenase gene. EMBO J. 1985;4(8):2093–9. Epub 1985/08/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Waring RB, May GS, Morris NR. Characterization of an inducible expression system in Aspergillus nidulans using alcA and tubulin-coding genes. Gene. 1989;79(1):119–30. Epub 1989/06/30. 10.1016/0378-1119(89)90097-8 . [DOI] [PubMed] [Google Scholar]
  • 46.Giles SS, Soukup AA, Lauer C, Shaaban M, Lin A, Oakley BR, et al. Cryptic Aspergillus nidulans antimicrobials. Appl Environ Microbiol. 2011;77(11):3669–75. Epub 2011/04/12. 10.1128/AEM.02000-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Park HS, Lee MK, Kim SC, Yu JH. The role of VosA/VelB-activated developmental gene vadA in Aspergillus nidulans. PLoS One. 2017;12(5):e0177099 Epub 2017/05/10. 10.1371/journal.pone.0177099 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Shaaban MI, Bok JW, Lauer C, Keller NP. Suppressor mutagenesis identifies a velvet complex remediator of Aspergillus nidulans secondary metabolism. Eukaryot Cell. 2010;9(12):1816–24. Epub 2010/10/12. 10.1128/EC.00189-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kwon NJ, Shin KS, Yu JH. Characterization of the developmental regulator FlbE in Aspergillus fumigatus and Aspergillus nidulans. Fungal Genet Biol. 2010;47(12):981–93. Epub 2010/09/08. 10.1016/j.fgb.2010.08.009 . [DOI] [PubMed] [Google Scholar]
  • 50.He ZM, Price MS, Obrian GR, Georgianna DR, Payne GA. Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus. BMC Microbiol. 2007;7:104 Epub 2007/11/28. 10.1186/1471-2180-7-104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y, Scazzocchio C. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol. 2004;41(11):973–81. Epub 2004/10/07. 10.1016/j.fgb.2004.08.001 . [DOI] [PubMed] [Google Scholar]
  • 52.Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh N, et al. Fusion PCR and gene targeting in Aspergillus nidulans. Nat Protoc. 2006;1(6):3111–20. Epub 2007/04/05. 10.1038/nprot.2006.405 . [DOI] [PubMed] [Google Scholar]
  • 53.Park HS, Yu JH. Multi-copy genetic screen in Aspergillus nidulans. Methods Mol Biol. 2012;944:183–90. Epub 2012/10/16. 10.1007/978-1-62703-122-6_13 . [DOI] [PubMed] [Google Scholar]
  • 54.Park HS, Ni M, Jeong KC, Kim YH, Yu JH. The role, interaction and regulation of the velvet regulator VelB in Aspergillus nidulans. PLoS One. 2012;7(9):e45935 Epub 2012/10/11. 10.1371/journal.pone.0045935 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Eom TJ, Moon H, Yu JH, Park HS. Characterization of the velvet regulators in Aspergillus flavus. J Microbiol. 2018;56(12):893–901. Epub 2018/10/27. 10.1007/s12275-018-8417-4 . [DOI] [PubMed] [Google Scholar]
  • 56.Kim MJ, Jung WH, Son YE, Yu JH, Lee MK, Park HS. The velvet repressed vidA gene plays a key role in governing development in Aspergillus nidulans. J Microbiol. 2019. Epub 2019/08/30. 10.1007/s12275-019-9214-4 . [DOI] [PubMed] [Google Scholar]
  • 57.Ni M, Yu J-H. A novel regulator couples sporogenesis and trehalose biogenesis in Aspergillus nidulans. PLoS One. 2007;2(10):e970 Epub 2007/10/04. 10.1371/journal.pone.0000970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Sarikaya Bayram O, Bayram O, Valerius O, Park H-S, Irniger S, Gerke J, et al. LaeA control of velvet family regulatory proteins for light-dependent development and fungal cell-type specificity. PLoS Genet. 2010;6(12):e1001226 Epub 2010/12/15. 10.1371/journal.pgen.1001226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Wei H, Scherer M, Singh A, Liese R, Fischer R. Aspergillus nidulans alpha-1,3 glucanase (mutanase), mutA, is expressed during sexual development and mobilizes mutan. Fungal Genet Biol. 2001;34(3):217–27. Epub 2001/12/01. 10.1006/fgbi.2001.1303 . [DOI] [PubMed] [Google Scholar]
  • 60.Calvo AM, Wilson RA, Bok JW, Keller NP. Relationship between secondary metabolism and fungal development. Microbiol Mol Biol Rev. 2002;66(3):447–59, table of contents. Epub 2002/09/05. 10.1128/MMBR.66.3.447-459.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Murakoshi Y, Makita T, Kato M, Kobayashi T. Comparison and characterization of alpha-amylase inducers in Aspergillus nidulans based on nuclear localization of AmyR. Appl Microbiol Biotechnol. 2012;94(6):1629–35. Epub 2012/01/19. 10.1007/s00253-012-3874-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Tani S, Katsuyama Y, Hayashi T, Suzuki H, Kato M, Gomi K, et al. Characterization of the amyR gene encoding a transcriptional activator for the amylase genes in Aspergillus nidulans. Curr Genet. 2001;39(1):10–5. Epub 2001/04/25. 10.1007/s002940000175 . [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Levels of zcfA mRNAs.

(A) AnizcfA mRNA levels in WT, ΔAnivosA, and ΔAnivelB mutant conidia. (B) AflzcfA mRNA levels in WT, ΔAflvosA, and ΔAflvelB mutant conidia. To calculate the expression levels of the AnizcfA and AflzcfA genes, the 2-ΔΔCT method was used, with β-actin as an endogenous control. Statistical differences between WT and mutant strains were analyzed by the Student’s unpaired t-test. Error bars indicate the standard error of the mean in triplicate samples.

(TIF)

S2 Fig. Verification of the ΔAnizcfA mutant.

(A) Diagram of the strategy used to generate the ΔAnizcfA mutant strain. Arrows indicate the primers used to verify the mutant strain. (B) PCR verification of the ΔAnizcfA mutant strain. (C) Restriction enzyme digestion verification of the ΔAnizcfA mutant strain.

(TIF)

S3 Fig. Verification of the C’AnizcfA strain.

(A) PCR verification of the C’AnizcfA strain. (B) qRT-PCR verification of the C’AnizcfA strain. To calculate the expression levels of AnizcfA, the 2-ΔΔCT method was used, with β-actin as an endogenous control. Statistical differences between WT and mutant strains were analyzed by the Student’s unpaired t-test. Error bars indicate the standard error of the mean in triplicate samples.

(TIF)

S4 Fig. Verification of the OEzcfA mutant strains.

(A) qRT-PCR verification of the OEzcfA strains. (B) Phenotype of the OEzcfA mutant strains. To calculate the expression levels of AnizcfA, the 2-ΔΔCT method was used, with β-actin as an endogenous control. Statistical differences between WT and mutant strains were analyzed by the Student’s unpaired t-test. Error bars indicates the standard error of the mean in triplicate samples.

(TIF)

S5 Fig. Verification of the ΔAflzcfA mutant.

(A) Diagram of the strategy for to generate the ΔAflzcfA mutants. Arrows indicate the primers used to verify the mutant strain. (B) PCR verification of the ΔAflzcfA mutant strain. (C) Restriction enzyme digestion verification of the ΔAnizcfA mutant strain.

(TIF)

S6 Fig. Phenotype of the ΔAnizcfA mutant strains.

Colony photographs of WT (FGSC4) and ΔAnizcfA (TYE11.4–6) that were point-inoculated on solid MMG and grown for five days under light or dark conditions.

(TIF)

S7 Fig. Sterigmatocystin production in the OEzcfA mutant.

(A-B) Thin-layer chromatography (TLC) analysis of sterigmatocystin (ST) produced by WT and OEzcfA strains in MMT (A) or YLC (B) inducing media.

(TIF)

S8 Fig. Phenotype of the ΔAflzcfA mutant strains.

(A) Colony photographs of control (TTJ6.1) and ΔAflzcfA (THJ1.1–3) strains that were point-inoculated on solid MMGY and grown for five days under light or dark conditions. (B) Colony morphology of control (TTJ6.1) and ΔAflzcfA (THJ1.1–3) strains were point-inoculated on solid MMGY and grown at 37°C under dark conditions for 7 days. The plates were washed with 100% ethanol to visualize sclerotia.

(TIF)

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES