Abstract
Giardia duodenalis is a common enteric protozoan that infects a range of hosts including humans and other mammals. Multilocus genotyping of G. duodenalis in captive non-human primates (NHPs) from zoos in China is limited. In this study, we evaluated 302 NHP fecal samples collected from 32 different NHP species. The primates were from 12 zoos distributed across eight provinces and two municipalities (Chongqing and Beijing) of China. The overall infection rate was 8.3% (25/302). The six G. duodenalis-positive zoos and their infection rates were: Suzhou Zoo (40.0%, 4/10), Yangzhou Zoo (22.2%, 2/9), Dalian Zoo (16.7%, 4/24), Chengdu Zoo (12.8%, 6/47), Guiyang Forest Wildlife Zoo (12.1%, 7/58), and Changsha Zoo (4.7%, 2/43). Molecular analysis of three loci, beta-giardin (bg), triose phosphate isomerase (tpi), and glutamate dehydrogenase (gdh), showed high genetic heterogeneity, and seven novel subtypes (BIII-1, MB10-1, WB8-1, B14-1, MB9-1, DN7-1, and BIV-1) were detected within assemblage B. Additional analysis revealed 12 different assemblage B multilocus genotypes (MLGs), one known MLG and 11 novel MLGs. Based on phylogenetic analysis, 12 assemblage B MLGs formed two main clades, MLG-SW (10–12, 18) and MLG-SW (13, 14, 16, 17), the other four MLG-SW (15, 19, 20, 21) were scattered throughout the phylogenetic tree in this study. Using multilocus genotyping, this study expands our understanding of the occurrence of Giardia infection and genetic variation in Giardia in captive non-human primates from zoos in China.
Introduction
Giardia duodenalis is an intestinal parasite that causes giardiasis in humans and animals. Giardia duodenalis infection may be asymptomatic or elicit several clinical symptoms including diarrhea, vomiting, weight loss, abdominal cramps, and nutrient malabsorption [1, 2]. Giardia duodenalis commonly infects non-human primates (NHPs), and causes both veterinary and public health problems [3–7]. In NHPs, giardiasis causes diarrhea and ill thrift, especially in young animals [8].
To date, there have been numerous studies about the Giardia duodenalis infection for non-human primates in the world, such as in Thailand (7.0%, 14/200) [9], Uganda (11.1%, 9/81) [10], India (31.2%, 53/170) [11], Netherlands/Belgium (61.6%, 159/258) [12], Italy (50.0%, 5/10) [13] and Spain (70.0%, 14/20) [14]. In China, Giardia duodenalis infection rates in ten zoos are reported between 0% to 44.0%, including Changsha Wild Animal Zoo (44.0%, 33/75), Guiyang Zoo (30.0%, 15/50), Beijing Zoo (22.2%, 16/72), Shanghai Wild Animal Zoo (20.9%, 14/67), Taiyuan Zoo (13.6%, 9/66), Wuhan Zoo (7.6%, 5/66), Shijiazhuang Zoo (11.2%, 10/89), Shanghai Zoo (8.2%, 5/61), Bifengxia Zoo (0%, 0/24) and Chengdu Zoo (0%, 0/11) [8, 15]. Giardia duodenalis has at least eight assemblages (A-H), only assemblages A, B, and E have been detected in NHPs, with assemblage B dominating [8–13, 15–20]. Assemblages A and B, which are consider potentially zoonotic, were reported in NHPs from zoos [8–16], thus, NHPs may play a role in the transmission of G. duodenalis to humans.
To date, most Chinese studies evaluating G. duodenalis infection in NHPs have focused on a single zoo or localized area. Only three studies have extended their investigation to include a larger geographical region [8, 15, 16]. Ongoing epidemiological surveys on intestinal zoonotic parasites of G. duodenalis, expanded previous studies to large-scale investigation of zoos and NHP species in China. We used multilocus genotyping to evaluate 302 NHP fecal samples (including 32 primate species) from 12 zoos distributed across eight Chinese provinces and two municipalities (Chongqing and Beijing), to better understand G. duodenalis infection in captive NHPs throughout China.
Materials and methods
Ethics statement
This study was reviewed and approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University under permit number ZXP-2018303052. Prior to the collection of fecal specimens from NHPs, permission was obtained from the owners.
Sample collection
Fecal samples from 302 NHPs (including 32 primate species) were collected from March 2018 to January 2019 (S1 Table). The samples from 12 zoos are distributed throughout China (Fig 1), including Beijing Zoo (n = 12), Chengdu Zoo (n = 47), Changsha Zoo (n = 43), Chongqing Zoo (n = 33), Dalian Zoo (n = 24), Guiyang Forest Wildlife Zoo (n = 58), Guangzhou Zoo (n = 8), Kunming Zoo (n = 16), Nanjing Zoo (n = 16), Shaanxi Rare and Wildlife Zoo (n = 26), Suzhou Zoo (n = 10), and Yangzhou Zoo (n = 9). The 12 zoos have adequate facilities to accommodate the different species of primates in indoor enclosure, different species live on separated places, and the feed managements are according to the Standard Rule of Chinese Association of Zoological Gardens. All animals’ samples were collected by visiting once. At the time of faecal collections, there were no reported case of diarrhoea in the NHPs. Fresh feces were collected and packed in clear, self-sealing, disposable plastic bags marked with ID numbers, and transported in ice-filled foam boxes. Samples were stored in 2.5% potassium dichromate at 4°C until DNA was extracted.
Fig 1. Distribution of sampling sites from 12 zoos in China in this study.
Sampling sites are indicated by black triangles.
DNA extraction and polymerase chain reaction (PCR)
Fecal samples were washed in distilled water to remove the potassium dichromate. Genomic DNA was then extracted using the PowerSoil® DNA Isolation Kit (MoBio, Carlsbad CA, USA), following manufacturer’s instructions. DNA was stored at -20°C prior to PCR analysis.
The PCR primers and protocol used in this study were previously described [15]. The PCR reactions for the bg, tpi and gdh loci were conducted in 25 μL reaction mixtures containing of 12.5 μL 2× Taq PCR Master Mix (KT201-02, Tiangen, Beijing, China), 8.5 μL deionized water (Tiangen, Beijing, China), 2 μL DNA, and 1 μL each of set primers, respectively. The primers and annealing temperatures for the three genes were listed in Table 1. Secondary PCR products were visualized by 1% agarose gel electrophoresis and staining with Golden View.
Table 1. Primer sequences, annealing temperatures and the fragment lengths of the genes used in this study.
| Gene | Primers | Sequence(5’-3’) | Annealing Temperature(˚C) | Fragment Length(bp) |
|---|---|---|---|---|
| bg | F1 | AAGCCCGACGACCTCACCCGCAGTGC | 60 | 530 |
| R1 | GAGGCCGCCCTGGATCTTCGAGACGAC | |||
| F2 | GAACGAACGAGATCGAGGTCCG | 55 | ||
| R2 | CTCGACGAGCTTCGTGTT | |||
| tpi | F1 | AAATIATGCCTGCTCGTCG | 50 | 530 |
| R1 | CAAACCTTITCCGCAAACC | |||
| F2 | CCCTTCATCGGIGGTAACTT | 50 | ||
| R2 | GTGGCCACCACICCCGTGCC | |||
| gdh | F1 | TTCCGTRTYCAGTACAACTC | 50 | 511 |
| R1 | ACCTCGTTCTGRGTGGCGCA | |||
| F2 | ATGACYGAGCTYCAGAGGCACGT | 50 | ||
| R2 | GTGGCGCARGGCATGATGCA |
Sequence analysis
All positive secondary PCR products were sequenced by BGI Tech Solutions (Liuhe Beijing) Co., Limited and were sequenced in both directions. Sequences were aligned with reference sequences from the GenBank database using BLAST (http://blast.ncbi.nlm.nih.gov) and Clustal X (http://www.clustal.org/). To evaluate the MLGs of G. duodenalis, we only included specimens that were successfully subtyped at all three loci and sequences with ambiguous positions (double peaks) were not included for phylogenetic analyses. Sequences were concatenated for each positive isolate to form a multilocus sequence (bg + tpi + gdh). All concatenated MLGs were used in a neighbour-joining analysis using the Kimura-2 parameter model calculated with MEGA 7 (http://www.megasoftware.net/). Representative nucleotide sequences obtained in this study were deposited in GenBank under the accession numbers: MK909127, MK909131, MK909135, MK909136, MK952610, MK952598, and MK952606.
Results and discussion
In this study, infected NHPs were detected from six zoos of the 12 examined zoos. Suzhou Zoo had the highest infection rate (40.0%, 4/10), followed by Yangzhou Zoo (22.2%, 2/9), Dalian Zoo (16.7%, 4/24), Chengdu Zoo (12.8%, 6/47), Guiyang Forest Wildlife Zoo (12.1%, 7/58), and Changsha Zoo (4.7%, 2/43) (Table 2). The infection rate in Suzhou Zoo was closed to Changsha Wild Animal Zoo (44.0%, 33/75) [8]. Yangzhou Zoo and Dalian Zoo were closed to our previous study from Guiyang Zoo (30.0%, 15/50) [15]. Chengdu Zoo and Guiyang Forest Wildlife Zoo were closed to a public park in Guiyang (8.5%, 35/411) [20]. The infection rate in Changsha Zoo was similar to that detected in Wuhan Zoo (7.6%, 5/66) [8] and Guangxi Zoo (2.4%, 5/205) [21]. The various infection rates in different zoos may relate to geographic distribution [8, 11, 12, 14–16].
Table 2. Occurrence and assemblage B of G. duodenalis for NHPs from 12 zoos in China.
| Zoos name | Province | Positive NHPs species (n) | No.tested | No.(%)of positive specimens | 95% CI | Assemblage (n) |
|---|---|---|---|---|---|---|
| Beijing Zoo | Beijing* | – | 12 | 0 (0) | – | – |
| Chengdu Zoo | Sichuan | Golden monkey (6) | 47 | 6 (12.8%) | [2.9, 22.7] | B (6) |
| Changsha Zoo | Hunan | Ring-tailed lemur (2) | 43 | 2 (4.7%) | [-1.9, 11.2] | B (2) |
| Chongqing Zoo | Chongqing* | – | 33 | 0 (0) | – | – |
| Dalian Zoo | Liaoning | Chimpanzee (2) | 24 | 4 (16.7%) | [0.6, 32.7] | B (4) |
| Golden monkey (1) | ||||||
| Ring-tailed lemur (1) | ||||||
| Guiyang Forest Wildlife Zoo | Guizhou | Golden monkey (5) | 58 | 7 (12.1%) | [3.4, 20.7] | B (7) |
| Baboons (1) | ||||||
| White-cheeked gibbon (1) | ||||||
| Guangzhou Zoo | Guangdong | – | 8 | 0 (0) | – | – |
| Kunming Zoo | Yunnan | – | 16 | 0 (0) | – | – |
| Nanjing Zoo | Jiangsu | – | 16 | 0 (0) | – | – |
| Shaanxi Rare and Wildlife Zoo | Shaanxi | – | 26 | 0 (0) | – | – |
| Suzhou Zoo | Jiangsu | Ring-tailed lemur (1) | 10 | 4 (40.0%) | [3.1, 76.9] | B (4) |
| Japanese macaque (1) | ||||||
| Ruffed lemur (1) | ||||||
| Africa black-and-white colobus(1) | ||||||
| Yangzhou Zoo | Jiangsu | Squirrel monkey (1) | 9 | 2 (22.2%) | [-11.7, 56.1] | B (2) |
| Ring-tailed lemur (1) | ||||||
| Total: 12 zoos | Eight provinces and two municipalities | Golden monkey (12) | 302 | 25 (8.3%) | [5.2, 11.4] | B (25) |
| Squirrel monkey (1) | ||||||
| Japanese macaques (1) | ||||||
| Baboons (1) | ||||||
| Africa black-and-white colobus(1) | ||||||
| White-cheeked gibbon (1) | ||||||
| Chimpanzee (2) | ||||||
| Ring-tailed lemur (5) | ||||||
| Ruffed lemur (1) |
“*”: municipality
Twenty-five samples were positive for G. duodenalis, based on positive PCR results at any of the three genetic loci (bg, tpi, and gdh). Average infection rate in this study was 8.3% (25/302), which was lower than a previous study in captive NHPs from seven zoos (18.6%, 92/496) (Shijiazhuang Zoo, Wuhan Zoo, Taiyuan Zoo, Changsha Wild Animal Zoo, Beijing Zoo, Shanghai Zoo and Shanghai Wild Animal Zoo) and also lower than our previous study from three zoos (17.7%, 15/85) in southwestern China (Guiyang Zoo, Bifengxia Zoo and Chengdu Zoo) [8, 15]. Compared with other countries, the average infection rate in this study was closed to that in Thailand (7.0%, 14/200) [9] and Uganda (11.1%, 9/81) [10], but lower than that in North-West India (31.2%, 53/170) [11]. The differences of infection rates in NHPs may be related to animal health status, detection methods, or geo-ecological conditions [2, 8, 15, 16, 22–29]. Nested PCR protocols based on single-copy genes (bg, tpi and gdh) had considerable lower diagnostic sensitivities than those based on multiple-copy genes (e.g. SSU rRNA). In this study, we adopted single-copy genes (bg, tpi and gdh) for genotyping G. duodenalis, not use the multiple-copy gene (SSU rRNA), which may underestimate the true infection rates [19]. Giardia duodenalis infection in NHPs suggests more attention should be paid to the living conditions of NHPs, and a safe distance maintained between NHPs and humans [20].
For PCR analysis of 302 samples from 32 NHP species, only nine species were positive for G. duodenalis, including africa black-and-white colobus (100%, 1/1), ruffed lemur (50.00%, 1/2), ring-tailed lemur (31.25%, 5/16), japanese macaque (33.33%, 1/3), chimpanzee (22.22%, 2/9), golden monkey (17.39%, 12/69), white-cheeked gibbon (7.14%, 1/14), baboons (4.35%, 1/23) and squirrel monkey (3.33%, 1/30). The infection rates ranged from 3.33% to 100% in the nine NHPs species. The infection rates for chimpanzee in this study were higher than that reported in other studies [8, 15–17, 19]. Previous studies reported high infection rates in captive NHPs were concentrated on rhesus macaque (8.49%, 9/106), crab-eating macaque (38.89%, 7/18), pig-tailed macaque (56.25%, 9/16), ring-tailed lemur (57.78%, 26/45), green monkey (20.00%, 3/15), hussar monkey (31.25%, 5/16), yellow baboon (40.00%, 2/5), cheeked gibbon (38.89%, 14/36), and bornean orangutan (21.74%, 5/23) [8, 15–17]. However, the rhesus macaque, crab-eating macaque, pig-tailed macaque, green monkey, mandrill, hussar monkey and Francois' leaf monkey were all found negative in our present study. The variation of infection rate for G. duodenalis in different NHPs species needs more studies to elucidate.
To date, assemblage A, B, and E have been identified in NHPs, with assemblage B dominating in China [8, 15–21]. In this study, all the G. duodenalis-positive specimens were assemblage B, which is consistent with previous studies [15, 16, 18]. Assemblage B is common in humans worldwide [6, 17, 27, 28]; therefore, NHPs may contribute to sporadic human infection [23, 24]. Of the 25 G. duodenalis-positive specimens, the bg, tpi, and gdh loci were successfully amplified and sequenced from 21, 21, and 20 specimens, respectively (Table 3). The bg, tpi, and gdh loci were highly polymorphic, with the greatest genetic variation at the tpi locus. Of the bg subtypes, three had previously been identified and the sequence of the remaining subtype BIII-1 (MK909127) was previously unpublished. Of the four tpi subtypes previously identified and the four remaining sequence subtypes, MB10-1 (MK909131), WB8-1 (MK909135), B14-1 (MK909136), and MB9-1(MK952610) were previously unpublished. Of the gdh subtypes, four were known and two had not been published (BIV-1 [MK952606] and DN7-1 [MK952598]). Twelve single nucleotide polymorphisms (SNPs) were detected within assemblage B at the bg / tpi / gdh loci (S2 Table). At the bg locus, two SNPs detected in isolate DLGB04. At the tpi locus, eight SNPs detected in six isolates (DLGT04, GYGT23, GYGT26, GYGT28, GYGT55 and SZGT10). At the gdh locus, two SNPs detected in three isolates (YZGG05, YZGG06 and GYGG97). Extensive polymorphism at the bg, tpi, and gdh loci in this study may reflect the wide geographic distribution of fecal samples. Previous studies demonstrated more genetic variation at the tpi locus (11, 7, and 3 novel sub-assemblage, respectively) [16, 18, 21]; however, our previous study found more variation at the bg locus [15]. NHPs in seven zoos in China [8]and wild rhesus macaques in India [11] had more genetic variation at the bg locus. The reason for more genetic variations at the bg and tpi loci is not clear.
Table 3. Multi-locus sequences of bg, tpi and gdh genes for 25 G. duodenalis positive faecal samples.
| Geographic source(China) | Isolate | Host | Subtype / Host or source / GenBank accession number | MLGs | ||
|---|---|---|---|---|---|---|
| β-giardin | tpi | gdh | ||||
| Chengdu Zoo | CDZOO36 | Golden monkey | Bb-1/squirrel monkey/ KJ888974 | – | – | – |
| CDZOO38 | Golden monkey | – | B14/rhesus macaque/KF679737 | – | – | |
| CDZOO39 | Golden monkey | Bb-1/squirrel monkey/KJ888974 | B14/rhesus macaque/KF679737 | BIV/rhesus macaque/KF679731 | SW10# | |
| CDZOO40 | Golden monkey | Bb-1/squirrel monkey/KJ888974 | B14/rhesus macaque/KF679737 | BIV/japanese macaque/KF679730 | SW11# | |
| CDZOO42 | Golden monkey | Bb-1/squirrel monkey/KJ888974 | – | – | – | |
| CDZOO47 | Golden monkey | Bb-1/squirrel monkey/KJ888974 | B14/rhesus macaque/KF679737 | B:DN2/Homo sapiens/MG746605 | SW12# | |
| Changsha Zoo | CSZOO23 | Ring-tailed lemur | Bb-4/ring-tailed lemur/ KJ888977 | BIV/Homo sapiens/HG970113 | BIV/japanese macaque/KF679730 | SW13# |
| CSZOO41 | Ring-tailed lemur | Bb-4/ring-tailed lemur/ KJ888977 | BIV/Homo sapiens/HG970113 | Bh-2/ring-tailed lemur/KJ888982 | SW14# | |
| Dalian Zoo | DLZOO1/DLZOO8 | Chimpanzee | B3 like4/Homo sapiens/KT948089 | MB2/rhesus macaque/KF679740 | Bh-1/squirrel monkey/KJ888981 | SW15 |
| DLZOO2 | Golden monkey | B3 like4/Homo sapiens/KT948089 | MB2/rhesus macaque/KF679740 | Bh-1/squirrel monkey/KJ888981 | SW15 | |
| DLZOO4 | Ring-tailed lemur | BIII-1/lemur catta/MK909127# | MB10-1/lemur catta/MK909131# | – | – | |
| Guiyang Forest Wildlife Zoo | GYZOO23 | Golden monkey | B/Homo sapiens/FJ560593 | WB8-1/golden monkey/MK909135# | BIV/rhesus macaque/KF679731 | SW16# |
| GYZOO24 | Golden monkey | B3 like4/Homo sapiens/KT948089 | BIV/Homo sapiens/HG970113 | BIV/rhesus macaque/KF679731 | SW17# | |
| GYZOO25 | Golden monkey | – | – | B/Homo sapiens/KT948096 | – | |
| GYZOO26/GYZOO28 | Golden monkey | Bb-1/squirrel monkey/KJ888974 | B14-1/golden monkey/MK909136# | BIV/japanese macaque/KF679730 | SW18# | |
| GYZOO55 | Baboons | B/Homo sapiens/FJ560593 | WB8-1/baboons/MK909135# | – | – | |
| GYZOO97 | White-cheeked gibbon | – | – | BIV-1/rhesus macaque/MK952606# | – | |
| Suzhou Zoo | SZZOO3 | Japanese macaque | B3 like4/Homo sapiens/KT948089 | BIV/Homo sapiens/HG970113 | BIV/rhesus macaque/KF679729 | SW19# |
| SZZOO5 | Ruffed Lemur | B3 like4/Homo sapiens/KT948089 | BIV/Homo sapiens/HG970113 | BIV/rhesus macaque/KF679729 | SW19# | |
| SZZOO9 | Africa Black-and-white Colobus | B3 like4/Homo sapiens/KT948089 | MB9/ring-tailed lemur/KJ888985 | BIV/japanese macaque/KF679730 | SW20# | |
| SZZOO10 | Ring-tailed lemur | – | MB9-1/ring-tailed lemur/MK952610# | Bh-2/ring-tailed lemur/KJ888982 | – | |
| Yangzhou Zoo | YZZOO5 | Squirrel monkey | B3 like4/Homo sapiens/KT948089 | BIV/Homo sapiens/HG970113 | DN7-1/squirrel monkey/MK952598# | SW21# |
| YZZOO6 | Ring-tailed lemur | B3 like4/Homo sapiens/KT948089 | BIV/Homo sapiens/HG970113 | DN7-1/ring-tailed lemur/MK952598# | SW21# | |
“#”: Novel subtypes and novel MLGs: “MLG-SW” follow by our previous study [15].
To better understand the diversity of G. duodenalis infection, we used multilocus genotyping. Seventeen isolates from NHPs yielded 12 MLGs (MLG-SW10 to MLG-SW21). The most common MLG was MLG-SW15 (17.65%, 3/17), followed by MLG-SW18 (11.76%, 2/17), MLG-SW19 (11.76%, 2/17), and MLG-SW21 (11.76%, 2/17). The remaining MLGs were only detected in one specimen. Moreover, seven MLGs (MLG-SW10-12, 15–18) were identified in golden monkeys and three types of MLGs (MLG-SW13, 14, 21) were identified in ring-tailed lemurs. More MLGs detected in golden monkeys and ring-tailed lemurs implies a higher relative genetic diversity [8].
A phylogenetic, evolutionary tree based on concatenated sequences was constructed to better understand the diversity and relationship between MLGs in NHPs and humans (Fig 2). Of the 12 MLGs we identified, 11 clustered with the NHPs isolates and 1 MLG (MLG21) clustered with human isolates from Sweden. The MLGs formed two main clades, MLG-SW (10–12, 18) and MLG-SW (13, 14, 16, 17). MLG-SW (15, 19, 20, 21) was scattered throughout the phylogenetic tree. The role of NHPs in the transmission of G. duodenalis to humans is not clear; however, the occurrence of assemblage B detected in captive NHPs suggests transmission from humans or an adaptation to primate host [4, 8].
Fig 2. Phylogenetic relationship of G. duodenalis assemblage B multilocus genotypes (MLGs) inferred by the neighbor-joining analysis of concatenated bg, tpi, and gdh sequences.
Reference sequences used are from the studies by Karim et al.[8], Levecke et al.[12], Zhong et al.[15], Chen et al.[18], Ye et al.[21], Lebbadet al.[28] and Du et al.[30]. Bootstrap values greater than 50% from 1000 replicates are shown. Concatenated sequences from this study are marked by filed roundness.
Conclusion
This study evaluated the occurrence of G. duodenalis in NHPs from 12 zoos distributed across 8 provinces and 2 municipalities (Chongqing and Beijing) in China. All G. duodenalis infections belonged to assemblage B, including seven novel subtypes: BIII-1, MB10-1, WB8-1, B14-1, MB9-1, DN7-1, and BIV-1. The tpi locus was the most genetically heterogeneous of the three loci evaluated. Multilocus genotyping identified twelve different assemblage B MLGs (one known MLG and eleven novel MLGs), implied relative higher genetic diversity. This study enlarge our understanding using multilocus genotyping of Giardia infection for captive NHPs from 12 zoos in China. Further research on the potential spread of NHPs G. duodenalis to humans needed more data to elucidate.
Supporting information
(DOC)
(DOCX)
Acknowledgments
We thank Liqin Wang and the zoo staff for their assistance in sample collection during this study.
Data Availability
All relevant data are within the manuscript and its Supporting Information files.
Funding Statement
This work was funded by the National Key Research and Development Program of China (2018YFD0500900, 2016YFD0501009) and the Chengdu Giant Panda Breeding Research Foundation (CPF2017-05, CPF2015-4).
References
- 1.Ma'ayeh SY, Liu J, Peirasmaki D, Hornaeus K, Bergstrom Lind S, Grabherr M, et al. Characterization of the Giardia intestinalis secretome during interaction with human intestinal epithelial cells: the impact on host cells. Plos Neglect. Trop. Dis. 2017;11(12):e0006120 10.1371/journal.pntd.0006120 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Tsui CK, Miller R, Uyaguari-Diaz M, Tang P, Chauve C, Hsiao W, et al. Beaver fever: whole-genome characterization of waterborne outbreak and sporadic isolates to study the zoonotic transmission of Giardiasis. mSphere. 2018;3(2). 10.1128/mSphere.00090-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kowalewski MM, Salzer JS, Deutsch JC, Raño M, Kuhlenschmidt MS, Gillespie TR. Black and gold howler monkeys (Alouatta caraya) as sentinels of ecosystem health: patterns of zoonotic protozoa infection relative to degree of human-primate contact. Am. J. Primatol. 2011;73(1):75–83. 10.1002/ajp.20803 [DOI] [PubMed] [Google Scholar]
- 4.Ryan U, Caccio SM. Zoonotic potential of Giardia. Int. J. Parasit. 2013;43(12–13):943–56. 10.1016/j.ijpara.2013.06.001 . [DOI] [PubMed] [Google Scholar]
- 5.Einarsson E, Ma'ayeh S, Svard SG. An up-date on Giardia and giardiasis. Curr. Opin. Microbiol. 2016;34:47–52. 10.1016/j.mib.2016.07.019 . [DOI] [PubMed] [Google Scholar]
- 6.Mbae C, Mulinge E, Guleid F, Wainaina J, Waruru A, Njiru ZK, et al. Molecular characterization of Giardia duodenalis in Children in Kenya. BMC Infect. Dis. 2016;16:135 10.1186/s12879-016-1436-z ; PMCID: PMC4802924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Al-Mekhlafi HM. Giardia duodenalis infection among rural communities in Yemen: A community-based assessment of the prevalence and associated risk factors. Asian Pac. J. Trop. Med. 2017;10(10):987–95. 10.1016/j.apjtm.2017.09.011 . [DOI] [PubMed] [Google Scholar]
- 8.Karim MR, Wang R, Yu F, Li T, Dong H, Li D, et al. Multi-locus analysis of Giardia duodenalis from nonhuman primates kept in zoos in China: geographical segregation and host-adaptation of assemblage B isolates. Infection, genetics and evolution: Asian Pac. J. Trop. Med. 2015;30:82–8. 10.1016/j.meegid.2014.12.013 . [DOI] [PubMed] [Google Scholar]
- 9.Sricharern W, Inpankaew T, Keawmongkol S, Supanam J, Stich RW, Jittapalapong S.Molecular detection and occurrence rate of Giardia duodenalis and Cryptosporidium spp. among long-tailed macaques (Macaca fascicularis) in Thailand. Infect. Genet. Evol. 2016;40:310–4. 10.1016/j.meegid.2016.02.004 . [DOI] [PubMed] [Google Scholar]
- 10.Johnston AR, Gillespie TR, Rwego IB, McLachlan TL, Kent AD, Goldberg TL. Molecula repidemiology of cross-species Giardia duodenalis transmission in western Uganda. Plos Neglect. Trop. Dis. 2010;4(5):e683 10.1371/journal.pntd.0000683 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Debenham JJ, Tysnes K, Khunger S, Robertson LJ. Occurrence of Giardia, Cryptosporidium, and Entamoeba in wild rhesus macaques (Macaca mulatta) living in urban and semi-rural North-West India. Int. J. Parasit. 2017;6(1):29–34. 10.1016/j.ijppaw.2016.12.002 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Levecke B, Geldhof P, Claerebout E, Dorny P, Vercammen F, Cacciò SM, et al. Molecular characterisation of Giardia duodenalis in captive non-human primates reveals mixed assemblage Aand B infections and novel polymorphisms. Int. J. Parasit. 2009;39(14):1595–601. 10.1016/j.ijpara.2009.05.013 . [DOI] [PubMed] [Google Scholar]
- 13.Cacciò SM, Beck R, Lalle M, Marinculic A, Pozio E. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int. J. Parasit. 2008;38(13):1523–31. 10.1016/j.ijpara.2008.04.008 [DOI] [PubMed] [Google Scholar]
- 14.Martinez-Diaz RA, Sansano-Maestre J, Martinez-Herrero Mdel C, Ponce-Gordo F, Gomez-Munoz MT. Occurrence and genetic characterization of Giardia duodenalis from captive nonhuman primates by multi-locus sequence analysis. Parasitol.Res. 2011;109(3):539–544. 10.1007/s00436-011-2281-z . [DOI] [PubMed] [Google Scholar]
- 15.Zhong Z, Tian Y, Li W, Huang X, Deng L, Cao S, et al. Multilocus genotyping of Giardia duodenalis in captive non-human primates in Sichuan and Guizhou provinces, Southwestern China. PLoS One. 2017;12(9):e0184913 10.1371/journal.pone.0184913 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Karim MR, Zhang S, Jian F, Li J, Zhou C, Zhang L, et al. Multilocus typing of Cryptosporidium spp. and Giardia duodenalis from non-human primates in China. Int. J. Parasit. 2014;44(13):1039–47. 10.1016/j.ijpara.2014.07.006 . [DOI] [PubMed] [Google Scholar]
- 17.Li J, Wang H, Wang R, Zhang L. Giardia duodenalis Infections in humans and other animals in China. Front Microbiol. 2017;8:2004 10.3389/fmicb.2017.02004 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chen L, Zhao J, Li N, Guo Y, Feng Y, Feng Y, et al. Genotypes and public health potential of Enterocytozoon bieneusi and Giardia duodenalis in crab-eating macaques. Parasites Vectors. 2019;12(1):254 10.1186/s13071-019-3511-y . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Brynildsrud O, Tysnes KR, Robertson LJ, Debenham JJ. Giardia duodenalis in primates: classification and host specificity based on phylogenetic analysis of sequence data. Zoonoses Public Health. 2018;65(6):637–47. 10.1111/zph.12470 . [DOI] [PubMed] [Google Scholar]
- 20.Ye J, Xiao L, Ma J, Guo M, Liu L, Feng Y. Anthroponotic enteric parasites in monkeys in public park, China. Emerg Infect Dis. 2012;18(10):1640–3. 10.3201/eid1810.120653 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ye J, Xiao L, Li J, Huang W, Amer SE, Guo Y, et al. Occurrence of human-pathogenic Enterocytozoon bieneusi, Giardia duodenalis and Cryptosporidium genotypes in laboratory macaques in Guangxi, China. Parasitol. Int. 2014;63(1):132–7. 10.1016/j.parint.2013.10.007 . [DOI] [PubMed] [Google Scholar]
- 22.Plutzer J, Ongerth J, Karanis P. Giardia taxonomy, phylogeny and epidemiology: facts and open questions. Int. J. Hyg. Environ. Health. 2010;213(5):321–33. 10.1016/j.ijheh.2010.06.005 . [DOI] [PubMed] [Google Scholar]
- 23.Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and Giardiasis. Clin Microbiol Rev. 2011;24(1):110–40. 10.1128/CMR.00033-10 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Durigan M, Abreu AG, Zucchi MI, Franco RM, de Souza AP. Genetic diversity of Giardia duodenalis: multilocus genotyping reveals zoonotic potential between clinical and environmental sources in a metropolitan region of Brazil. PLoS One. 2014;9(12):e115489 10.1371/journal.pone.0115489 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Certad G, Viscogliosi E, Chabe M, Caccio SM. Pathogenic mechanisms of Cryptosporidium and Giardia. Trends Parasitol. 2017;33(7):561–76. 10.1016/j.pt.2017.02.006 . [DOI] [PubMed] [Google Scholar]
- 26.Ryan U, Hijjawi N, Feng Y, Xiao L. Giardia: an under-reported foodborne parasite. Int. J. Parasit. 2019;49(1):1–11. 10.1016/j.ijpara.2018.07.003 . [DOI] [PubMed] [Google Scholar]
- 27.Naguib D, El-Gohary AH, Roellig D, Mohamed AA, Arafat N, Wang Y, et al. Molecular characterization of Cryptosporidium spp. and Giardia duodenalis in children in Egypt. Parasites Vectors. 2018;11(1):403 10.1186/s13071-018-2981-7 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lebbad M, Petersson I, Karlsson L, Botero-Kleiven S, Andersson JO, Svenungsson B, et al. Multilocus genotyping of human Giardia isolates suggests limited zoonotic transmission and association between assemblage B and flatulence in children. Plos Neglect. Trop. Dis. 2011;5(8):e1262 10.1371/journal.pntd.0001262 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Prystajecky N, Tsui CK, Hsiao WW, Uyaguari-Diaz MI, Ho J, Tang P, et al. Giardia spp. Are Commonly Found in mixed assemblages in surface water, as revealed by molecular and whole-genome characterization. Appl Environ Microbiol. 2015;81(14):4827–34. 10.1128/AEM.00524-15 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Du SZ, Zhao GH, Shao JF, Fang YQ, Tian GR, Zhang LX, et al. Cryptosporidium spp., Giardia intestinalis, and Enterocytozoon bieneusi in captive non-human primates in Qinling mountains. Korean J Parasitol. 2015;53(4):395–402. 10.3347/kjp.2015.53.4.395 . [DOI] [PMC free article] [PubMed] [Google Scholar]


