Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Nov 1.
Published in final edited form as: Alcohol Clin Exp Res. 2019 Oct 8;43(11):2332–2343. doi: 10.1111/acer.14200

ALCOHOL’S DYSREGULATION OF MATERNAL-FETAL IL-6 AND p-STAT3 IS A FUNCTION OF MATERNAL IRON STATUS

Nipun Saini 1, Kaylee K Helfrich 1, Sze Ting (Cecilia) Kwan 1, Shane M Huebner 2, Juna Abazi 2, George R Flentke 1, Sharon E Blohowiak 3, Pamela J Kling 3, Susan M Smith 1
PMCID: PMC7001854  NIHMSID: NIHMS1050658  PMID: 31524964

Abstract

Background:

Prenatal alcohol exposure (PAE) causes long-term growth and neurodevelopmental deficits that are worsened by maternal iron deficiency (ID). In our preclinical rat model, PAE causes fetal anemia, brain ID, and elevated hepatic iron via increased maternal and fetal hepcidin synthesis. These changes are normalized by a prenatal iron-fortified (IF) diet. Here, we hypothesize that iron status and PAE dysregulate the major upstream pathways that govern hepcidin production - EPO/BMP6/SMAD and IL-6/JAK2/STAT3.

Methods:

Pregnant, Long-Evans rat dams consumed ID (2–6ppm iron), iron-sufficient (IS, 100ppm iron), or IF (500ppm iron) diets and received alcohol (5 g/kg) or isocaloric maltodextrin daily from gestational days (GD) 13.5–19.5. Protein and gene expression were quantified in the six experimental groups at GD 20.5.

Results:

PAE did not affect Epo or Bmp6 expression, but reduced p-SMAD1/5/8/SMAD1/5/8 protein ratios in both IS and ID maternal and fetal liver (all P’s<0.01). In contrast, PAE stimulated maternal hepatic expression of Il-6 (P=0.03), and elevated p-STAT3/STAT3 protein ratios in both IS and ID maternal and fetal liver (all P’s<0.02). PAE modestly elevated maternal Il-1β, Tnf-α, and Ifn-γ. Fetal cytokine responses to PAE were muted compared with dams, and PAE did not affect hepatic Il-6 (P=0.78) in IS and ID fetuses. Dietary iron fortification sharply attenuated Il-6 expression in response to PAE, with IF driving a 150-fold decrease (P<0.001) in maternal liver and a 10-fold decrease (P<0.01) in fetal liver. The IF diet also normalized p-STAT3/STAT3 ratios in both maternal and fetal liver.

Conclusions:

These findings suggest that alcohol-driven stimulation of the IL-6/JAK2/STAT3 pathway mediates the elevated hepcidin observed in the PAE dam and fetus. Normalization of these signals by IF suggests that dysregulated hepcidin is driven by alcohol’s disruption of the IL-6/JAK2/STAT3 pathway. Prenatal dietary IF represents a potential therapeutic approach for PAE that warrants further investigation.

Keywords: Fetal Alcohol Spectrum Disorder, Iron Deficiency, Hepcidin, IL-6, Iron Fortification

INTRODUCTION

Prenatal alcohol exposure (PAE) causes persistent cognitive, physical, and behavioral deficits (Hoyme et al., 2016), collectively termed fetal alcohol spectrum disorder (FASD). FASD affects 1.1–5.0% of children in the United States (May et al., 2018). Despite public awareness of the negative effects of PAE, 11.5% of pregnant women self-report alcohol consumption and 3.9% of pregnant women self-report binge drinking in the previous month (Denny et al., 2019). Maternal nutrient deficiencies worsen fetal outcomes (May et al., 2016, 2014; May and Gossage, 2011), while clinical studies suggest that nutritional interventions may mitigate FASD outcomes (Coles et al., 2015; Jacobson et al., 2018; Kable et al., 2015). There is no consensus on whether PAE alters micronutrient intake in pregnant women; however, studies in low-income South African populations find no meaningful differences in micronutrient intake in pregnant women consuming alcohol (Carter et al., 2017; May et al., 2016, 2014).

Iron deficiency (ID) is the most common nutritional deficiency worldwide, impacting 12.5% of women of reproductive age in the US (Gordeuk and Brannon, 2017) and rising to a prevalence as high as 39% during the last trimester of pregnancy (Mei et al., 2011). Clinical studies demonstrate an association between maternal ID and adverse offspring outcomes, including small-for-gestational-age infants, poor motor development, worsened attention and recognition memory, and diminished self-regulation abilities (Alwan and Hamamy, 2015). In a clinical cohort of binge-drinking women, PAE reduces newborn size and infant growth primarily in infants with iron deficiency anemia (IDA) (Carter et al., 2007, 2012). PAE also dysregulates iron metabolism, and a higher proportion of pregnant women consuming alcohol develop iron depletion in the third trimester in what appears to be a dose response (Streissguth et al., 1983). Furthermore, in a South African cohort, infants from mothers who drank more than four drinks per occasion were 3.6 times more likely to be IDA than infants from mothers who abstained from drinking or who consumed less alcohol per occasion (Carter et al. 2007). However, binge-drinking in non-pregnant adults causes iron overload (De Feo et al., 2001; Ioannou et al., 2004; Milman and Kirchhoff, 1996), contrasting with PAE’s apparent effects during pregnancy.

Animal models corroborate that the PAE/ID combination synergizes to decrease postnatal growth beyond the effect of PAE or ID alone (Rufer et al., 2012). Furthermore, PAE/ID in rats synergize to reduce white matter formation and worsen associative learning (Huebner et al., 2015; Rufer et al., 2012). Studies in our rat PAE model further find that PAE causes fetal anemia, even when the mothers are iron-sufficient and not anemic (Huebner et al., 2016). The fetal anemia is accompanied by reduced brain iron and increased liver iron, suggesting that PAE dysregulates maternal-fetal iron metabolism (Huebner et al., 2016). The iron regulatory hormone hepcidin controls iron status (Sangkhae and Nemeth, 2017). We found that PAE elevates maternal and fetal hepcidin even in ID states, when hepcidin should be repressed to enhance iron availability (Huebner et al., 2016). Its elevation in the context of PAE suggests hepcidin may be a central driver in these altered iron responses.

Hepcidin maintains systemic iron homeostasis and prevents iron overload and its toxic sequelae (Sangkhae and Nemeth, 2017). Multiple factors regulate hepcidin transcription via two major pathways - the erythropoietin/bone morphogenetic 6/SMAD (EPO/BMP6/SMAD) pathway and the interleukin-6/janus kinase 2/signal transducer and activator of transcription 3 (IL-6/JAK2/STAT3) pathway (Sangkhae and Nemeth, 2017). Liver iron stores, blood iron concentrations, and erythropoiesis control the activity of the EPO/BMP6/SMAD pathway. BMP6 upregulates hepcidin through p-SMAD1/5/8 activation, while erythropoietin (EPO) downregulates hepcidin via diminished p-SMAD1/5/8 activity to increase iron availability for erythropoiesis (Camaschella, 2015; Lombardero et al., 2011; Wang et al., 2017). Upon infection or tissue damage, IL-6 is released from cells due to signals from the binding of lipopolysaccharide to the Toll-like receptor 4 or elevated TNF-α or IL-1β; the released IL-6 activates the JAK2/STAT3 pathway (Kishimoto, 2010). Upregulation of either the EPO/BMP6/SMAD or IL-6/JAK2/STAT3 pathway activates hepcidin transcription, which blocks iron absorption and increases iron storage. Dysregulation of these hepcidin regulatory pathway can lead to iron overload or IDA with subsequent adverse outcomes (Anderson and Frazer, 2017). Studies in nonpregnant animal models and human adults with alcoholic liver disease find that alcohol consumption reduces hepcidin expression with consequent iron overload (Costa-Matos et al., 2012; Harrison-Findik et al., 2007, 2006; Milman and Kirchhoff, 1996); this contrasts with our findings that PAE elevates hepcidin in pregnant rats (Huebner et al., 2016), suggesting an alternative regulatory mechanism in PAE. The primary goal of this study is to identify whether PAE dysregulates either of the two major hepcidin-regulatory pathways under differing conditions of iron status. We previously showed that feeding alcohol-exposed pregnant rats with an iron-fortified (IF) diet containing iron 5 times higher than standard iron normalizes fetal iron status as well as maternal and fetal hepcidin expression (Huebner et al., 2018). Thus, a secondary goal of this study is to understand whether IF normalizes PAE’s effect on hepcidin regulatory pathways.

MATERIALS AND METHODS

Animals and diets

We used our established model of dietary iron administration in rats (Huebner et al., 2018, 2016). Nulliparous, 8-week old Long-Evans female rats (Envigo, Richmond IN) were randomly assigned to consume one of three diets ad libitum: the iron-sufficient (IS) diet (containing 100 ppm iron; TD.06016); the iron-deficient (ID) diet (containing 100 ppm iron from GD0.5–5 [TD.06016], 20 ppm iron from GD5–13.5 [TD.06013], and 2–6 ppm iron from GD13.5–20.5 [TD.80396]); or the iron-fortified (IF) diet (containing 500 ppm iron; TD.110880). Diet composition was based on AIN-76A (Huebner et al., 2018, 2016), and diets were produced by Teklad-Envigo (Madison, WI). Rats consumed the assigned diet at least 2 weeks prior to and throughout pregnancy. Gestational day (GD) 0.5 was defined as the morning a vaginal plug was discovered. Litters containing <9 or >15 pups were excluded from analyses to eliminate extremes in iron distribution across litters within a treatment group. On GD20.5, following isoflurane overdose and maternal perfusion, maternal and fetal tissues were collected, flash frozen in liquid nitrogen, and stored at −80°C until further analysis. The Institutional Animal Care and Use Committee approved all protocols.

Alcohol exposure

We used our established model of PAE (Huebner et al., 2018, 2016). Briefly, on GD0.5, IS, ID, and IF dams were randomly assigned to receive either 5.0 g/kg body weight alcohol (PAE; 200 proof ethanol, USP grade; Decon Labs, King of Prussia, PA) given as 40% alcohol in water, or isocaloric maltodextrin (M; Harlan Teklad, Madison, WI) in water. Both alcohol and maltodextrin were administered by gastric gavage and were given daily as two half-doses 2 hours apart on GD13.5 through G19.5. Our prior work did not reveal an effect of gavage per se on the experimental outcomes (Rufer et al., 2012). All comparisons here are made using similarly gavaged animals, and we do not expect a significant impact on the measures in this study.

4Western blot analysis

Fetal and maternal liver tissues were homogenized using an ultra-sonicator in a homogenization buffer described by Huebner et al. (2016) (for SMAD1/5/8 and p-SMAD1/5/8) and in 2% NP-40 buffer containing 50mM Tris-HCl (pH 7.6), 150mM NaCl, 5mM EDTA (pH 7.8) and protease inhibitors (for STAT3 and phosphorylated (p)-STAT3) to reduce band non-specificity. Protein concentrations were quantified using the standard BCA assay. Thirty micrograms of protein per lane were separated on a 7.5% SDS gel. Proteins were transferred using semi-dry electrophoresis (Trans-Blot® Turbo transfer system, Biorad, Hercules, CA) to a PVDF membrane (Immobilon-P, Millipore, Billerica, MA). Primary antibodies against p-SMAD1/5, SMAD5 (#9516 and #12534, respectively, Cell Signaling Technology, Danvers, MA), p-STAT3 (ab76315, Abcam, Cambridge, MA) and STAT3 (60199–1-Ig, Proteintech Group, Inc., Rosemont, IL) were used in a 1:2000 dilution in 5% non-fat dry milk prepared in 0.1% Tris-buffered saline with Tween (TBST) at 4°C, overnight. Immunoreactive bands were visualized utilizing either LiCor Odyssey® imaging system or isotope-specific HRP-conjugated secondary antibodies (1:5000 dilution of Goat Anti-Rabbit Ig #4010–05, Goat Anti-Mouse IgG2a #1081–05, Southern Biotech, Birmingham, AL). Molecular weights for bands of interest were calculated against color-tagged protein standards (Precision-Plus Protein, BioRad, Hercules CA). Band intensities were quantified using AzureSpot Software (Azure Biosystems, Dublin, CA), and were normalized to GAPDH expression (G8795, Sigma-Aldrich, St. Louis, MO), as PAE does not affect GAPDH abundance. Samples were assayed in duplicate.

Real-time Quantitative PCR

Methodology conforms to MIQE (Minimal Information for Publication of Quantitative Real-Time Experiments) guidelines for quantitative PCR analysis (Bustin et al., 2009). The RT-qPCR analysis of maternal and fetal tissues used total RNA isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. cDNA was synthesized from a 1-μg aliquot of RNA using random hexamer primers (Promega, Madison, WI) and Im-Prom II Reverse Transcriptase (Promega, Madison, WI) according to the manufacturer’s directions. Synthesized cDNA was stored at −20°C until use. In the RT-qPCR analysis, reactions contained identical amounts of cDNA template, 2μM each of the forward and reverse primers (IDT, Coralville, IA; primers are listed in Table 1), and the SYBR™ Select Master Mix (Applied Biosystems, Foster City, CA). cDNA was diluted such that the Ct’s of the experimental and reference genes did not differ from each other by more than 5 cycles. Amplification reactions and fluorescent measurements were performed using a CFX384 Touch™ Real-Time PCR Detection System (BioRad, Hercules, CA). Incorporation of fluorescent dye into the cDNA was quantified at the end of each amplification cycle, and, at the completion of the last amplification round, a melting curve analysis was performed to confirm the amplification specificity. Samples were run in triplicate, and target gene expression was normalized to Gapdh expression. All primers had efficiencies between 90–110%, indicating appropriate doubling time of cDNA. The mean relative expression change was calculated using the 2−ΔΔCT method (Livak and Schmittgen, 2001). Neither alcohol nor iron status affected Gapdh transcript abundance in this model.

Table 1:

Primers used in qPCR analysis.

Forward Primer (5’ −3’) Reverse Primer (5’ −3’) Tissues Gene Accession Number
Bone morphogenetic protein 6 (Bmp6) GACAAGGAGTTCTCCCCACG AAACTCCCCACCACACAGTC Maternal liver NM_013107.1
Fetal liver
Erythropoietin (Epo) TACGTAGCCTCACTTCACTGCTT TATCCGCTGTGAGTGTTCGG Maternal kidney NM_017001.1
Fetal liver
Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) TGACAAAGTGGACATTGTTGC CTTGCCGTGGGTAGAGTCAT Maternal liver NM_017008.4
Fetal liver
Fetal brain
Maternal kidney
Interferon-γ (Ifn-γ) AGTCTGAAGAACTATTTTAACTCAAGTAGCAT CTGGCTCTCAAGTATTTTCGTGTTAC Maternal liver NM_138880.2
Fetal brain
Interleukin-1β (Il-1β) TGTGATGAAAGACGGCACAC TGTGCTCTGCTTGAGAGGTGCT Maternal liver NM_031512.2
Fetal liver
Fetal brain
Interleukin-6 (Il-6) ATGAGGTCTACTCGGCAAAC TCTGACCACAGTGAGGAATG Maternal liver NM26744.1
Fetal liver
Fetal brain
Interleukin-10 (Il-10) TGCGACGCTGTCATCGATTT AGACACCTTTGTCTTGGAGCTT Maternal liver NM_012854.2
Fetal liver
Tumor Necrosis Factor-α (Tnf-α) CCGACTCTGACCCCCATTAC CCCAGAGCCACAATTCCCTT Maternal liver NM_012675.3
Fetal liver
Fetal brain
Open in a new tab

Data analysis

In the data analysis, for all fetal measurements, the litter was classified as the experimental unit. Two fetuses were sampled per litter per endpoint; uterine positions of the fetuses were kept constant across a single measure, because previous work showed lower intra-litter variation for experimental endpoints than inter-litter variation within a treatment cohort. All data were analyzed using RStudio v3.5.1. Data normality (Shapiro-Wilk test) and variance (Bartlett’s test) were assessed. If data were normal with equal variance, a two-way ANOVA was employed to determine differences due to dietary iron status and PAE. Fixed effects were iron status, PAE, and the interaction of iron status and PAE. When the effect of iron status, PAE, and/or their interaction was significant (P < 0.05), the ANOVA was followed by a priori comparisons in a planned, pairwise fashion (e.g. IS-M vs. IS-PAE, etc.) utilizing Tukey’s HSD test to identify treatment differences while limiting overall comparison-wide error rate. Differences were considered significant at P < 0.05. If data were not normal and/or had unequal variance, the Kruskal-Wallis test detected overall differences among groups due to iron status and PAE. When the overall effect was significant (P < 0.05), we performed a priori comparisons in a planned, pairwise fashion using Pairwise Wilcoxon Rank Sum Tests. Differences were considered significant at P < 0.05. Values are presented as mean ± SEM unless noted otherwise. For all measures, we used Grubbs’ test for outliers to detect any statistically significant outliers within the data; outliers, if any, were removed from the analysis and noted in the figure legend.

RESULTS

PAE stimulates activity of the IL-6/JAK2/STAT3 pathway but not the EPO/BMP6/SMAD pathway in maternal liver

We tested the impact of PAE on two major pathways regulating hepcidin production, EPO/BMP6/SMAD and IL-6/JAK2/STAT3, and we hypothesized that PAE might dysregulate one or both pathways. PAE had no effect on Epo expression in the maternal kidney (P = 0.537) (Figure 1A), and ID similarly did not affect maternal Epo expression, consistent with our prior demonstration that these rat dams are not anemic (Huebner et al., 2016). As with Epo, PAE had no effect on hepatic Bmp6 expression (P = 0.994), whereas ID reduced Bmp6 (P = 0.028; Figure 1B). PAE downregulated p-SMAD1/5/8 in IS dams (P = 0.007; Figure 1C), suggesting that this pathway was not responsible for the induced hepcidin. As expected, ID downregulated p-SMAD1/5/8 (P = 0.017), consistent with the iron-limited status of these dams. Examination of the JAK/STAT3 pathway revealed that PAE upregulated p-STAT3 in both IS (P = 0.008) and ID (P = 0.001) dams compared to maltodextrin controls (Figure 1D). Consistent with reports that ID itself is proinflammatory (Naito et al., 2009; Toblli et al., 2011), there was a trend for higher p-STAT3 in ID animals (P = 0.062). These data suggest that the JAK2/STAT3 pathway may play a role in the upregulated maternal hepcidin observed in response to PAE.

Figure 1: In dam, PAE elevated activity of JAK2/STAT3 pathway but did not affect EPO/BMP6/SMAD pathway.

Figure 1:

Open in a new tab

(A) Neither PAE nor iron deficiency affected maternal kidney erythropoietin expression. (B) Similarly, PAE did not affect hepatic Bmp6 expression, whereas Bmp6 significantly declined in response to ID. (C) Both PAE and ID reduced the abundance of p-SMAD1/5/8 protein relative to total SMAD1/5/8, whereas (D) they elevated p-STAT3 abundance relative to total STAT3 protein. Bar graphs are means ± SEMs. Individual dots in panels A and B represent mean measurements of individual maternal kidneys and livers. N = 3–5 individuals per treatment for Epo measurement, N = 5 individuals per treatment for Bmp6, N = 6 individuals per treatment for p-SMAD1/5/8, and N = 6–9 individuals per treatment for p-STAT3. Figure panels depict overall P-values as determined by a 2-factor ANOVA (for normal data with equal variance) or Kruskal-Wallis test (for non-normal data and/or data with unequal variance). Post hoc analysis by Tukey’s test (for normal data with equal variance) or Wilcoxon rank-sum test (for non-normal data and/or data with unequal variance) depict means that are significantly different when they do not share a common letter, P<0.05. Data lacked outliers as determined by Grubb’s test. IS, iron-sufficient; ID, iron-deficient; M, maltodextrin; PAE, prenatal alcohol exposure.

Regulation of hepcidin via p-STAT3 is stimulated by proinflammatory cytokines, most prominently interleukin-6 (IL-6), but other cytokines such as TNF-α and IL-1β can indirectly influence hepcidin via induction of IL-6 (Wolf, Rose-John and Garbers, 2014; Hunter and Jones, 2015). IL-6 directly activates STAT3 through binding to the IL-6 receptor and causing JAK2-mediated phosphorylation of STAT3 (Hunter and Jones, 2015). Because alcohol is proinflammatory and can stimulate cytokine production in PAE (Ahluwalia et al., 2000; Sowell et al., 2018), we measured expression of proinflammatory cytokines. PAE upregulated maternal hepatic Il-6 expression 3-fold compared to controls (P = 0.025) (Figure 2A) and consistent with increased p-STAT3. We also observed overall treatment effects of PAE on maternal hepatic Il-1β, Tnf-α, and Ifn-γ expression (Figure 2B–D). However, the fold-changes in these cytokines were modest and below the 3-fold increase in Il-6 expression induced by PAE. ID minimally affected or slightly decreased the maternal hepatic expression of these proinflammatory cytokines. The selective upregulation in Il-6 expression was consistent with the elevated p-STAT3 and implicated the JAK2/STAT3 pathway in the upregulated hepcidin expression in response to PAE.

Figure 2: PAE elevated pro-inflammatory cytokine expression in maternal liver.

Figure 2:

Open in a new tab

PAE elevated Il-6 (A) and Il-1β (B) expression and trended toward increasing Tnf-α (C) and Ifn-γ (D) expression. Iron deficiency did not appreciably affect pro-inflammatory cytokines in maternal liver, except for lowering Il-6 and Tnf-α expression. Bar graphs are means ± SEMs of cytokine expression, and the individual dots represent mean measurements of individual maternal livers. N = 5 dams per treatment. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Data lacked outliers as determined by Grubb’s test. IS, iron-sufficient; ID, iron-deficient; M, maltodextrin; PAE, prenatal alcohol exposure.

The IL-6/JAK2/STAT3 pathway is elevated, but less strongly, in fetal liver

Because fetal hepcidin is also elevated in PAE, we performed a parallel analysis to ascertain whether fetal pathways responded similarly to PAE and ID (Huebner et al., 2016). With respect to EPO/BMP6/SMAD, fetal EPO is produced in the liver until birth, at which point production shifts to the kidney (Jelkmann, 1992). Neither PAE nor ID significantly altered fetal hepatic Epo expression (P = 0.770) (Figure 3A). PAE also did not affect Bmp6 expression (P = 0.371), although ID caused a modest rise in Bmp6 expression (Figure 3B). Downstream of BMP6 and EPO, ID reduced p-SMAD1/5/8 compared to IS (P = 0.013; Figure 3C) and consistent with the fetal iron deficiency. PAE reduced p-SMAD1/5/8 in both IS (P = 0.001) and ID (P < 0.001), suggesting this pathway did not contribute to the elevated fetal hepcidin (Huebner et al., 2016). In contrast, ID increased p-STAT3 in fetal liver (P < 0.001; Figure 3D), as observed in the dam. PAE increased p-STAT3 in both IS (P = 0.016) and ID (P = 0.015) fetal liver compared to controls. Thus, both maternal and fetal liver responded similarly to PAE with upregulated p-STAT3, implicating this pathway as a potential mediator of the upregulated hepcidin.

Figure 3: In fetus, PAE elevated activity of JAK2/STAT3 pathway but did not affect EPO/BMP6/SMAD pathway.

Figure 3:

Open in a new tab

(A) Neither PAE nor iron deficiency affected fetal hepatic Epo expression. (B) PAE did not affect Bmp6 expression, whereas ID elevated Bmp6. (C) Both PAE and ID reduced p-SMAD1/5/8 protein relative to total SMAD1/5/8, whereas (D) they elevated p-STAT3 protein relative to total STAT3. Bar graphs are means ± SEMs. Individual dots in panels A and B represent mean measurements within individual fetal livers. N = 2 fetuses per litter and 4 litters per treatment group for Epo and Bmp6 expression measurements, N = 2 fetuses per litter and 3 litters per treatment group for p-SMAD1/5/8 and p-STAT3 measurements. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Data lacked outliers as determined by Grubb’s test. IS, iron-sufficient; ID, iron-deficient; M, maltodextrin; PAE, prenatal alcohol exposure.

The fetal hepatic proinflammatory cytokine response to PAE was modest and differed from the maternal hepatic cytokine response. Neither PAE nor ID affected Il-6 expression (P = 0.712) (Figure 4A), in contrast to the 3-fold induction in maternal liver. PAE modestly but significantly increased Il-1β expression in IS (P <0.001) and ID (P = 0.006) fetal livers relative to controls (Figure 4B). PAE also increased Tnf-α expression in IS fetal liver (P = 0.010) (Figure 4C). Fetal liver Ifn-γ expression was below the limit of detection. Apart from Il-1β, ID did not significantly affect the expression of these cytokines.

Figure 4: PAE and iron deficiency had a minimal effect on pro-inflammatory cytokine expression in fetal liver.

Figure 4:

Open in a new tab

(A) Neither PAE nor iron deficiency significantly altered fetal Il-6 expression. However, PAE elevated expression of Il-1β (B) and Tnf-α (C). ID had little impact upon fetal cytokine expression. Bar graphs are means ± SEMs. Individual dots represent mean measurements within individual fetal livers. N = 2 fetuses per litter and 6 litters per treatment. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Grubb’s test detected 1 outlier in the ID-M group of Il-1β and 1 outlier each in the ID-PAE and IS-PAE groups of Il-6 which were excluded from the graphs and statistical analyses. IS, iron-sufficient; ID, iron-deficient; M, maltodextrin; PAE, prenatal alcohol exposure.

PAE and ID modestly alter fetal brain proinflammatory cytokines

Because fetal brain also produces cytokines in response to PAE (Pascual et al., 2017; Sowell et al., 2018; Terasaki and Schwarz, 2016), we studied whether these cytokines might contribute to the elevated fetal hepcidin. As in fetal liver, PAE had modest effects on brain cytokine production. Fetal brain Il-6 expression did not change in response to either PAE (P = 0.983) or ID (P = 0.874) (Figure 5A). PAE significantly increased Il-1β expression (P < 0.001) relative to IS controls, as did ID (P < 0.001) (Figure 5B). Similarly, PAE significantly increased Tnf-α (P < 0.001), whereas ID had no effect (P = 0.151) (Figure 5C). Neither ID (P = 0.820) nor PAE (P = 0.709) altered Ifn-γ expression (Figure 5D). Consistent with these modest cytokine changes, we saw little effect of PAE or ID upon the expression of other neuroinflammation markers including Mcp-1, Gfap and Iba-1 (data not shown). Overall, inflammatory responses of fetal brain and liver to PAE were more muted than maternal responses, suggesting that maternal signals might be the more important driver of dysregulated fetal hepcidin.

Figure 5: PAE and iron deficiency had minimal impacts on pro-inflammatory cytokine expression in fetal brain.

Figure 5:

Open in a new tab

(A) Neither PAE nor iron deficiency significantly altered fetal brain Il-6 expression. (B) PAE and ID individually elevated Il-1β expression and interacted to increase its expression. (C) PAE elevated Tnf-α expression, whereas ID did not affect expression. (D) PAE and ID did not affect expression of Ifn-γ. Bar graphs are means ± SEMs. Individual dots represent mean measurements within individual fetal brains. N = 2 fetuses per litter and 5 litters per treatment group. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Grubb’s test detected 1 outlier each in ID-M, ID-PAE, and IS-PAE groups in Ifn-γ and 1 outlier each in ID-PAE and IS-PAE groups in Il-6. These outliers were excluded from the graphs and statistical analyses. IS, iron-sufficient; ID, iron-deficient; M, maltodextrin; PAE, prenatal alcohol exposure.

Iron fortification mitigates maternal-fetal inflammatory and hepcidin regulatory signals

We previously reported that dietary IF prevents the PAE-induced fetal anemia and normalizes hepcidin expression in dam and fetus (Huebner et al., 2018). We tested whether these changes were accompanied by reductions in inflammatory markers, which could not be assumed because excessive iron can be pro-inflammatory (Xiao et al., 2018). In maternal liver, IF caused a remarkable suppression of proinflammatory cytokines. Whereas PAE elevated Il-6 3-fold in IS dams, Il-6 was reduced 150-fold (99.4% reduction) in the IF dams exposed to PAE (P < 0.001) compared to IS controls (Figure 6A). This dramatic reduction was also observed in the IF controls, where Il-6 was reduced 50-fold compared to IS controls (P < 0.001). Other cytokines responded similarly to IF, and the expression of Il-1β, Tnf-α, and Ifn-γ was significantly reduced compared with IS-M in the presence or absence of PAE (all P’s < 0.001) (Figure 6B–D).

Figure 6: Dietary iron fortification mitigated pro-inflammatory cytokines induced by PAE.

Figure 6:

Open in a new tab

Dietary iron fortification (IF) mitigated the elevation of Il-6 (A), Il-1β (B), Tnf-α (C), and Ifn-γ (D) expression in maternal livers exposed to PAE. IF reduced pro-inflammatory cytokines even in the absence of PAE. Values for IS-M and IS-PAE are reproduced from Figure 2, as those data were generated simultaneously. Bar graphs are means ± SEMs, and individual dots represent mean measurements of individual maternal livers. N = 5 dams per treatment. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Data lacked outliers as determined by Grubb’s test. IS, iron-sufficient; IF, iron-fortified; M, maltodextrin; PAE, prenatal alcohol exposure.

Although cytokine responses to PAE were attenuated in the fetus, IF also reduced cytokine production. Fetal hepatic Il-6 expression trended 4-fold lower (75% reduction) vs. IS-M (P = 0.097; Figure 7A). In the PAE fetus, IF reduced Il-6 expression almost 10-fold (90% reduction; P = 0.002), to levels that did not significantly differ from IS-M (P = 0.416). IF did not affect the other cytokines. Although IF had an overall effect on Il-1β (P = 0.009), individual comparisons were not significant (Figure 7B). Neither PAE nor IF affected Tnf-α in fetal liver (P = 0.134) (Figure 7C). Because PAE did not impact fetal brain cytokines (Figure 5), we did not further evaluate the brain response to IF.

Figure 7: Maternal dietary iron fortification selectively reduced Il-6 expression in response to PAE in fetal liver.

Figure 7:

Open in a new tab

(A) Dietary iron fortification mitigated the elevation in Il-6 expression caused by PAE in fetal liver. (B,C) Dietary iron fortification did not significantly affect fetal hepatic expression of Il-1β or Tnf-α. Bar graphs are means ± SEMs of cytokine expression, and the individual dots represent mean measurements within individual fetal livers. N = 2 fetuses per litter and 4 litters per treatment group. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Data lacked outliers as determined by Grubb’s test. IS, iron-sufficient; IF, iron-fortified; M, maltodextrin; PAE, prenatal alcohol exposure.

Because reduced hepatic Il-6 expression in IF dams and fetuses might normalize STAT3 phosphorylation in the hepcidin pathway, we measured p-STAT3. In maternal liver, IF did not further alter p-STAT3/STAT3 ratios in the IF-M group and levels were the same as IS-M (P = 0.826; Figure 8A). In contrast, IF reversed the significant rise in p-STAT3/STAT3 in PAE, and p-STAT3/STAT3 levels did not differ from either IS-M (P = 0.992) or IF-M (P = 0.932). In fetal liver, IF again normalized the elevated p-STAT/STAT ratio in PAE fetuses back to IS-M levels (P = 0.975; Figure 8B). Taken together, the reduced Il-6 expression and p-STAT3/STAT3 in the IF-PAE dam and fetus are consistent with their normalized hepcidin (Huebner et al., 2016), which suggests this pathway may contribute to the aberrant hepcidin upregulation in PAE.

Figure 8: In dams and fetuses, maternal dietary iron fortification mitigated the elevated STAT3 in response to PAE.

Figure 8:

Open in a new tab

PAE elevated p-STAT3 in maternal (A) and fetal (B) livers, and IF normalized p-STAT3 levels to IS-M control levels, even in the presence of PAE. Values for IS-M and IS-PAE are reproduced from Figures 1D (maternal) and 3D (fetal), as these data were generated simultaneously. Bar graphs are means ± SEMs. For maternal data, N = 7–9 individual animals for IS measurements and N= 4 individual animals for IF measurements. For fetal data, N=2 fetuses per litter/6 litters for IS measurements and N=2 fetuses per litter/3 litters for IF measurements. The protein quantification of maternal and fetal IF-M and IF-PAE p-STAT3/STAT3 is represented relative to IS-M p-STAT3/STAT3 abundance from Figures 1 and 3 after normalization to GAPDH abundance within the same lane. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Data lacked outliers as determined by Grubb’s test. IS, iron-sufficient; IF, iron-fortified; M, maltodextrin; PAE, prenatal alcohol exposure.

PAE elevates maternal but not fetal Il-10 expression

To gain additional insights into the actions of IF, we evaluated the impact of iron status and PAE on the anti-inflammatory interleukin-10 (IL-10). IL-10 is the primary anti-inflammatory cytokine in the liver and can activate STAT3 via a parallel pathway to IL-6 (Wang et al., 2011), although it ultimately inhibits an inflammatory response. Alcohol consumption in adults elevates Il-10 expression (Miller et al., 2011). Conversely, in a parallel study of placentas from these pregnant rats, we find that PAE sharply suppresses placental Il-10 expression (Kwan et al., in preparation). With respect to these dams, ID did not affect hepatic Il-10 expression compared to IS controls (P = 0.981; Figure 9A), whereas PAE elevated Il-10 2-fold above control (P = 0.067 for IS, P = 0.038 for ID). IF lowered Il-10 by 6-fold (83% reduction) compared to IS controls (P < 0.001) and suppressed its induction by PAE. In the fetus, hepatic Il-10 responses to PAE were again attenuated compared to the mother (Figure 9B), and hepatic Il-10 expression did not differ in response to ID (P = 0.996), IF (P = 0.207), or PAE (P = 0.519).

Figure 9: PAE elevated maternal Il-10 expression but does not affect fetal Il-10 expression.

Figure 9:

Open in a new tab

(A) PAE elevated Il-10 expression in maternal liver in both IS and ID dams, while dietary iron fortification lowered Il-10 expression. (B) PAE had a minimal impact on fetal Il-10 expression. Bar graphs are means ± SEMs of cytokine expression, and the individual dots represent mean measurements within individual maternal or fetal livers. N = 5 dams per treatment group in panel A. N = 2 fetuses per litter and 4 litters per treatment group in panel B. Statistics were conducted as in Figure 1. Means are significantly different when they do not share a common letter, P<0.05. Data lacked outliers as determined by Grubb’s test. IS, iron-sufficient; IF, iron-fortified; M, maltodextrin; PAE, prenatal alcohol exposure.

DISCUSSION

We previously reported that PAE upregulates maternal and fetal hepcidin expression in IS and ID pregnancies, and that this is normalized by maternal dietary iron fortification (Huebner et al., 2018, 2016). Because hepcidin sequesters iron and limits its availability, this overexpression likely contributes to the anemia and brain ID observed in these alcohol-exposed fetuses. Data reported here strongly point to alcohol’s inflammatory actions as a factor in this dysregulated iron metabolism. Interestingly, in the absence of PAE, fetal hepcidin appears to be primarily responsive to iron rather than to inflammation (Dosch et al., 2016). Although feedback signals including accelerated erythropoiesis and low iron status also regulate hepcidin production, our data here and elsewhere (Huebner et al., 2018, 2016) do not support those alternative mechanisms. Instead, we found that PAE strongly upregulated Il-6 and its downstream effector p-STAT3, the major cytokine driver of elevated hepcidin (Huang et al., 2009; Sangkhae and Nemeth, 2017). Alcohol is an established proinflammatory agent, and it stimulates the production of Il-6, Il-1β, Tnf-α, and Ifn-γ in maternal and fetal tissues during pregnancy (Ahluwalia et al., 2000; Miller et al., 2011; Sowell et al., 2018). Although alcohol in this model also upregulated production of Il-1β, Tnf-α, and Ifn-γ, those effects were relatively modest, and this suggests that the induction of Il-6 was selective. In non-pregnant adults, IL-6 plays an important role in the hepatic response to alcohol, and IL-6 may have protective properties, although elevated pro- to anti-inflammatory cytokines may damage the liver, regardless of the function of individual cytokines (Miller et al., 2011). In alcoholic liver disease, IL-6 is elevated, and its magnitude correlates with the severity of the disease (Hill et al., 1992). In a cohort of African American women, maternal plasma and cord blood from chronic alcohol abusers had significantly elevated cytokines above non-drinking mothers and mothers who consumed moderate amounts of alcohol; furthermore, although all measured plasma cytokines were elevated, IL-6 and IL-1β were 100 times higher than levels in control and moderately drinking mothers (Ahluwalia et al., 2000). In a rat model, acute alcohol exposure increases the number of IL-6 receptors present on hepatocytes and improves the binding affinity of the receptor for IL-6 (Deaciuc et al., 1994). In our model, alcohol significantly elevated fetal liver p-STAT3, and although fetal Il-6 expression was attenuated, this may simply reflect that the fetus experiences lower alcohol exposure than the mother (Zelner and Koren, 2013). Moreover, maternal cytokines readily cross the placenta, and thus these maternal cytokines may impact the fetal STAT3 pathway (Ratnayake et al., 2013; Sowell et al., 2018). Taken together, these findings suggest that the maternal compartment may be a primary driver of alcohol’s effects with respect to fetal hepcidin and iron status. Functional studies of hepcidin signaling in mouse will clarify the mechanisms underlying these alcohol responses and maternal-fetal interactions.

Some populations with the highest rates of FASD also have a high incidence of ID (Popova et al., 2017; World Health Organization, 2015). Thus, our demonstration that dietary iron fortification mitigates alcohol’s inflammatory action should be clinically relevant. ID in infancy worsens the effects of maternal alcohol consumption on infant head circumference, weight, and height (Carter et al., 2012). Both ID and alcohol separately impair brain development (Hoyme et al., 2016; Janbek et al., 2019), and in a preclinical study, they synergize to worsen learning in the offspring (Rufer et al., 2012). The ability of an IF diet to mitigate both the alcohol-induced fetal anemia, brain ID (Huebner et al., 2018), and now to mitigate inflammatory cytokines exemplifies this as a potential intervention to improve gestational outcomes in alcohol-exposed pregnancies. Studies are underway to test whether the IF benefits extend to learning and cognition. Because the IF intervention began two weeks prior to conception, it is not known if an iron intervention occurring only during pregnancy, as is feasible in humans, will be similarly successful. However, we note that well-nourished nonpregnant alcoholics experience iron overload (Ioannou et al., 2004; Milman and Kirchhoff, 1996). We speculate whether increased circulating iron may confer some level of protection to the fetus due to elevated iron transfer to the fetus via transferrin-bound iron (Toblli et al., 2011), perhaps explaining some of the “protective” effects of higher socioeconomic status upon alcohol-exposed pregnancies (Coathup et al., 2017; Kelly et al., 2009, 2012). In a prospective trial, alcoholic mothers randomized to receive micronutrient supplements that included iron have children with improved visual memory and higher scores on cognitive assessments at age 6–12 months, compared with those alcoholic mothers who did not receive supplements (Coles et al., 2015; Kable et al., 2015). Although excessive iron intake can induce oxidative damage and gastrointestinal disturbances (Tolkien et al., 2015), the IF diet used here does not damage the liver (as measured by protein carbonyl) or alter the prevalence of other divalent metals, suggesting this level of fortification is not harmful to the mother or fetus (Huebner et al., 2018). Although alcohol consumption is associated with elevated iron status (Ioannou et al., 2004), for child-bearing aged women this is counterbalanced by the high iron demands imposed by pregnancy (~1040 mg/term pregnancy) and by menstrual losses during the interpregnancy interval. Furthermore, the alcohol-driven elevation in hepcidin described here and elsewhere (Huebner et al., 2018, 2016; Miller et al., 1995) would impair both iron utilization and the mother’s ability to enhance iron absorption and meet these gestational demands. We know little about how alcohol affects the intake or utilization of other micronutrients (Carter et al., 2017; May et al., 2016, 2014), and more research into this question is needed. The postnatal impact of PAE on offspring iron status is even less clear. In rat, PAE causes persistent deficits in postnatal brain iron status (Miller et al., 1995), but whether this reflects a continued dysregulation of hepcidin, and thus increased iron needs, is unknown and requires investigation.

It is unclear how the IF diet – regardless of alcohol exposure – consistently suppressed cytokine production. Few studies have investigated the potential beneficial effects of iron fortification on measures of inflammation. In a preclinical pig model, intramuscular iron injections administered on the third day after birth inhibit the expression of hepatic Il-6, Il-1β, Tnf-α and Ifn-γ (Pu et al., 2015). A larger number of studies find that iron supplementation does not increase inflammatory markers in the plasma or elevate hepatic cytokines, although this lack of a proinflammatory effect is dependent on the source of iron and the dose. A clinical trial of non-anemic females finds that oral administration of iron (40–240mg) does not elevate plasma C-reactive protein (CRP) (Moretti et al., 2015). Similarly, iron supplementation did not elevate plasma CRP in adults and children suffering from infection (de Silva et al., 2003; Schröder et al., 2005). The mechanism by which iron fortification may reduce inflammation is unclear. ID itself is proinflammatory (Naito et al., 2009; Pagani et al., 2011; Toblli et al., 2011), and thus the iron fortification may be reversing a mild ID. Hepcidin itself has been reported to have anti-inflammatory effects (Pagani et al., 2011), and hepcidin rises as iron fortification repletes iron status. However, in our IF model, hepcidin does not rise above levels seen in IS dams and fetuses (Huebner et al., 2018). Furthermore, our model administers the iron as part of the diet instead of as an iron-only supplement, which could decrease adverse reactions sometimes associated with iron supplementation given in bolus form. Further studies are needed to determine iron formulation, method of administration, and dosage to optimize iron status while reducing adverse effects associated with iron supplementation. Studies are underway to examine the utility of direct iron supplementation for mitigating PAE outcomes in this model.

In summary, this study implicates the IL-6/JAK2/STAT3 pathway in mediating the upregulation of maternal and fetal hepatic hepcidin expression (Huebner et al., 2016) in response to prenatal alcohol. Along with Il-6, PAE also increased Il-1β and Tnf-α expression in both maternal and fetal tissues. Most importantly, maternal dietary iron fortification attenuated and even suppressed these inflammatory responses mediated by PAE and also normalized STAT3 phosphorylation. Such mechanistic insights are helpful in designing intervention strategies for alcohol-exposed pregnancies with upregulated hepcidin or inflammation.

Supplementary Material

Supp Info1
Supp Info2
Supp Info3

ACKNOWLEDGEMENTS

The authors have no conflicts of interest to declare. The authors thank Abrar Al-Shaer for her help with the RT-qPCR data analysis.

Supported by NIH awards #R01 AA22999 (SMS), #R01 AA11085 (SMS), #T32-DK007686 (KKH), #F32 AA027121 (STCK), #F32 AA21311 (SMH).

REFERENCES

  1. Ahluwalia B, Wesley B, Adeyiga O, Smith DM, Da-Silva A, Rajguru S (2000) Alcohol modulates cytokine secretion and synthesis in human fetus: an in vivo and in vitro study. Alcohol 21:207–213. [DOI] [PubMed] [Google Scholar]
  2. Alwan N, Hamamy H (2015) Maternal Iron Status in Pregnancy and Long-Term Health Outcomes in the Offspring. J Pediatr Genet 4:111–123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anderson GJ, Frazer DM (2017) Current understanding of iron homeostasis. Am J Clin Nutr 1S–8S. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT (2009) The MIQE Guidelines : Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin Chem 55:1–12. [DOI] [PubMed] [Google Scholar]
  5. Carter RC, Jacobson JL, Molteno CD, Jiang H, Meintjes EM, Jacobson SW, Duggan C (2012) Effects of Heavy Prenatal Alcohol Exposure and Iron Deficiency Anemia on Child Growth and Body Composition through Age 9 Years. Alcohol Clin Exp Res 36:1973–1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Carter RC, Jacobson SW, Molteno CD, Jacobson JL (2007) Fetal Alcohol Exposure, Iron-Deficiency Anemia, and Infant Growth. Pediatrics 120:559–567. [DOI] [PubMed] [Google Scholar]
  7. Carter RC, Senekal M, Dodge NC, Bechard LJ, Meintjes EM, Molteno CD, Duggan CP, Jacobson JL, Jacobson SW (2017) Maternal Alcohol Use and Nutrition During Pregnancy: Diet and Anthropometry. Alcohol Clin Exp Res. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Coathup V, Northstone K, Gray R, Wheeler S, Smith L (2017) Dietary Patterns and Alcohol Consumption During Pregnancy: Secondary Analysis of Avon Longitudinal Study of Parents and Children. Alcohol Clin Exp Res 41:1120–1128. [DOI] [PubMed] [Google Scholar]
  9. Coles CD, Kable JA, Keen CL, Jones KL, Wertelecki W, Granovska IV., Pashtepa AO, Chambers CD, CIFASD T (2015) Dose and Timing of Prenatal Alcohol Exposure and Maternal Nutritional Supplements: Developmental Effects on 6-Month-Old Infants. Matern Child Health J 19:2605–2614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Costa-Matos L, Batista P, Monteiro N, Simões M, Egas C, Pereira J, Pinho H, Santos N, Ribeiro J, Cipriano MA, Henriques P, Girão F, Rodrigues A, Carvalho A (2012) Liver hepcidin mRNA expression is inappropriately low in alcoholic patients compared with healthy controls. Eur J Gastroenterol Hepatol 24:1158–1165. [DOI] [PubMed] [Google Scholar]
  11. De Feo TM, Fargion S, Duca L, Cesana BM, Boncinelli L, Lozza P, Cappellini MD, Fiorelli G (2001) Non-transferrin-bound iron in alcohol abusers. Alcohol Clin Exp Res 25:1494–1499. [DOI] [PubMed] [Google Scholar]
  12. de Silva A, Sunethra A, Irangani W, Namanjeet A (2003) Iron supplementation improves iron status and reduces morbidity in children with or without upper respiratory tract infections: a randomized controlled study in Colombo, Sri Lanka. Am J Clin Nutr 77:234–241. [DOI] [PubMed] [Google Scholar]
  13. Deaciuc IV, Alappat JM, D’Souza NB (1994) Effect of Acute and Chronic Alcohol Administration to Rats on the Expression of Interleukin-6 Cell-Surface Receptors of Hepatic Parenchymal and Nonparenchymal Cells. Alcohol Clin Exp Res 18:1207–1214. [DOI] [PubMed] [Google Scholar]
  14. Denny CH, Acero CS, Naimi TS, Kim SY (2019) Consumption of Alcohol Beverages and Binge Drinking Among Pregnant Women Aged 18–44 Years — United States, 2015–2017. Morb Mortal Wkly Rep 68:365–368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dosch NC, Guslits EF, Weber MB, Murray SE, Ha B, Coe CL, Auger AP, Kling PJ (2016) Maternal obesity affects inflammatory and iron indices in umbilical cord blood. J Pediatr 172:20–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gordeuk VR, Brannon PM (2017) Ethnic and genetic factors of iron status in women of reproductive age. Am J Clin Nutr 2–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Harrison-Findik DD, Klein E, Crist C, Evans J, Timchenko N, Gollan J (2007) Iron-mediated regulation of liver hepcidin expression in rats and mice is abolished by alcohol. Hepatology 46:1979–1985. [DOI] [PubMed] [Google Scholar]
  18. Harrison-Findik DD, Schafer D, Klein E, Timchenko NA, Kulaksiz H, Clemens D, Fein E, Andriopoulos B, Pantopoulos K, Gollan J (2006) Alcohol metabolism-mediated oxidative stress down-regulates hepcidin transcription and leads to increased duodenal iron transporter expression. J Biol Chem 281:22974–22982. [DOI] [PubMed] [Google Scholar]
  19. Hill DB, Marsano L, Cohen D, Allen J, Shedlofsky S, McClain CJ (1992) Increased plasma interleukin-6 concentrations in alcoholic hepatitis. J Lab Clin Med 119:547–552. [PubMed] [Google Scholar]
  20. Hoyme HE, Kalberg WO, Elliott AJ, Blankenship J, Buckley D, Marais A-S, Manning MA, Robinson LK, Adam MP, Abdul-Rahman O, Jewett T, Coles CD, Chambers C, Jones KL, Adnams CM, Shah PE, Riley EP, Charness ME, Warren KR, May PA (2016) Updated Clinical Guidelines for Diagnosing Fetal Alcohol Spectrum Disorders. Pediatrics 138:e20154256–e20154256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Huang H, Constante M, Layoun A, Santos MM (2009) Contribution of STAT3 and SMAD4 pathways to the regulation of hepcidin by opposing stimuli. Blood 113:3593–3599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Huebner SM, Blohowiak SE, Kling PJ, Smith SM (2016) Prenatal Alcohol Exposure Alters Fetal Iron Distribution and Elevates Hepatic Hepcidin in a Rat Model of Fetal Alcohol Spectrum Disorders. J Nutr 146:1180–1188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Huebner SM, Helfrich KK, Saini N, Blohowiak SE, Cheng AA, Kling PJ, Smith SM (2018) Dietary Iron Fortification Normalizes Fetal Hematology, Hepcidin, and Iron Distribution in a Rat Model of Prenatal Alcohol Exposure. Alcohol Clin Exp Res 42:1022–1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Huebner SM, Tran TD, Rufer ES, Crump PM, Smith SM (2015) Maternal Iron Deficiency Worsens the Associative Learning Deficits and Hippocampal and Cerebellar Losses in a Rat Model of Fetal Alcohol Spectrum Disorders. Alcohol Clin Exp Res 39:2097–2107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hunter CA, Jones SA (2015) IL-6 as a keystone cytokine in health and disease. Nat Immunol 16:448–457. [DOI] [PubMed] [Google Scholar]
  26. Ioannou GN, Dominitz JA, Weiss NS, Heagerty PJ, Kowdley KV. (2004) The Effect of Alcohol Consumption on the Prevalence of Iron Overload, Iron Deficiency, and Iron Deficiency Anemia. Gastroenterology 126:1293–1301. [DOI] [PubMed] [Google Scholar]
  27. Jacobson SW, Carter RC, Molteno CD, Stanton ME, Herbert JS, Lindinger NM, Lewis CE, Dodge NC, Hoyme HE, Zeisel SH, Meintjes EM, Duggan CP, Jacobson JL (2018) Efficacy of Maternal Choline Supplementation During Pregnancy in Mitigating Adverse Effects of Prenatal Alcohol Exposure on Growth and Cognitive Function: A Randomized, Double-blind, Placebo-Controlled Clinical Trial. Alcohol Clin Exp Res 42:1327–1341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Janbek J, Sarki M, Specht IO, Heitmann BL (2019) A systematic literature review of the relation between iron status/anemia in pregnancy and offspring neurodevelopment. Eur J Clin Nutr. [DOI] [PubMed] [Google Scholar]
  29. Jelkmann W (1992) Erythropoietin: Structure, Control of Production, and Function. Physiol Rev 72:449–489. [DOI] [PubMed] [Google Scholar]
  30. Kable JA, Coles CD, Keen CL, Uriu-Adams JY, Jones KL, Yevtushok L, Kulikovsky Y, Wertelecki W, Pedersen TL, Chambers CD, CIFASD (2015) The impact of micronutrient supplementation in alcohol-exposed pregnancies on information processing skills in Ukrainian infants. Alcohol 49:647–656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kelly Y, Sacker A, Gray R, Kelly J, Wolke D, Quigley MA (2009) Light drinking in pregnancy, a risk for behavioural problems and cognitive deficits at 3 years of age? Int J Epidemiol 38:129–140. [DOI] [PubMed] [Google Scholar]
  32. Kelly YJ, Sacker A, Gray R, Kelly J, Wolke D, Head J, Quigley MA (2012) Light drinking during pregnancy: still no increased risk for socioemotional difficulties or cognitive deficits at 5 years of age? J Epidemiol Community Health 66:41–48. [DOI] [PubMed] [Google Scholar]
  33. Kishimoto T (2010) IL-6 : from its discovery to clinical applications. Int Immunol 22:347–352. [DOI] [PubMed] [Google Scholar]
  34. Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2 ddCT Method. Methods 25:402–408. [DOI] [PubMed] [Google Scholar]
  35. May PA, Chambers CD, Kalberg WO, Zellner J, Feldman H, Buckley D, Kopald D, Hasken JM, Xu R, Honerkamp-Smith G, Taras H, Manning MA, Robinson LK, Adam MP, Abdul-Rahman O, Vaux K, Jewett T, Elliott AJ, Kable JA, Akshoomoff N, Falk D, Arroyo JA, Hereld D, Riley EP, Charness ME, Coles CD, Warren KR, Jones KL, Hoyme HE (2018) Prevalence of Fetal Alcohol Spectrum Disorders in 4 US Communities. JAMA 319:474–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. May PA, Gossage JP (2011) Maternal risk factors for Fetal Alcohol Spectrum disorders. Alcohol Res Heal 34:15–26. [PMC free article] [PubMed] [Google Scholar]
  37. May PA, Hamrick KJ, Corbin KD, Hasken JM, Marais AS, Blankenship J, Hoyme HE, Gossage JP (2016) Maternal nutritional status as a contributing factor for the risk of fetal alcohol spectrum disorders. Reprod Toxicol 59:101–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. May PA, Hamrick KJ, Corbin KD, Hasken JM, Marais AS, Brooke LE, Blankenship J, Hoyme HE, Gossage JP (2014) Dietary intake, nutrition, and fetal alcohol spectrum disorders in the Western Cape Province of South Africa. Reprod Toxicol 46:31–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mei Z, Cogswell ME, Looker AC, Pfeiffer CM, Cusick SE, Lacher DA, Grummer-Strawn LM (2011) Assessment of iron status in US pregnant women from the national health and nutrition examination survey (NHANES), 1999–2006. Am J Clin Nutr 93:1312–1320. [DOI] [PubMed] [Google Scholar]
  40. Miller AM, Horiguchi N, Jeong W-I, Radaeva S, Gao B (2011) Molecular mechanisms of alcoholic liver disease: innate immunity and cytokines. Alcohol Clin Exp Res 35:787–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Miller MW, Roskams AJI, Connor JR (1995) Iron Regulation in the Developing Rat Brain: Effect of In Utero Ethanol Exposure. J Neurochem 65:373–380. [DOI] [PubMed] [Google Scholar]
  42. Milman N, Kirchhoff M (1996) Relationship between serum ferritin, alcohol intake, and social status in 2235 Danish men and women. Ann Hematol 72:145–151. [DOI] [PubMed] [Google Scholar]
  43. Moretti D, Goede JS, Zeder C, Jiskra M, Chatzinakou V, Tjalsma H, Melse-Boonstra A, Brittenham G, Swinkels DW, Zimmerman MB (2015) Oral iron supplements increase hepcidin and decrease iron absorption from daily or twice-daily doses in iron-depleted young women. Blood 126:1981–1989. [DOI] [PubMed] [Google Scholar]
  44. Naito Y, Tsujino T, Matsumoto M, Sakoda T, Ohyanagi M, Masuyama T (2009) Adaptive response of the heart to long-term anemia induced by iron deficiency. Am J Physiol Heart Circ Physiol 296:H585–H593. [DOI] [PubMed] [Google Scholar]
  45. Pagani A, Nai A, Corna G, Bosurgi L, Rovere-Querini P, Camaschella C, Silvestri L (2011) Low hepcidin accounts for the proinflammatory status associated with iron deficiency. Blood 118:736–746. [DOI] [PubMed] [Google Scholar]
  46. Pascual M, Montesinos J, Montagud-Romero S, Forteza J, Rodríguez-Arias M, Miñarro J, Guerri C (2017) TLR4 response mediates ethanol-induced neurodevelopment alterations in a model of fetal alcohol spectrum disorders. J Neuroinflammation 14:1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Popova S, Lange S, Probst C, Parunashvili N, Rehm J (2017) Prevalence of alcohol consumption during pregnancy and Fetal Alcohol Spectrum Disorders among the general and Aboriginal populations in Canada and the United States. Eur J Med Genet 60:32–48. [DOI] [PubMed] [Google Scholar]
  48. Pu Y, Guo B, Liu D, Xiong H, Wang Y, Du H (2015) Iron Supplementation Attenuates the Inflammatory Status of Anemic Piglets by Regulating Hepcidin. Biol Trace Elem Res 167:28–35. [DOI] [PubMed] [Google Scholar]
  49. Ratnayake U, Quinn T, Walker DW, Dickinson H (2013) Cytokines and the neurodevelopmental basis of mental illness. Front Neurosci 7:1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rufer ES, Tran TD, Attridge MM, Andrzejewski ME, Flentke GR, Smith SM (2012) Adequacy of Maternal Iron Status Protects against Behavioral, Neuroanatomical, and Growth Deficits in Fetal Alcohol Spectrum Disorders. PLoS One 7:1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Sangkhae V, Nemeth E (2017) Regulation of the Iron Homeostatic Hormone Hepcidin. Adv Nutr An Int Rev J 8:126–136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Schröder O, Mickisch O, Seidler U, De Weerth A, Dignass AU, Herfarth H, Reinshagen M, Schreiber S, Junge U, Schrott M, Stein J (2005) Intravenous iron sucrose versus oral iron supplementation for the treatment of iron deficiency anemia in patients with inflammatory bowel disease - A randomized, controlled, open-label, multicenter study. Am J Gastroenterol 100:2503–2509. [DOI] [PubMed] [Google Scholar]
  53. Sowell KD, Uriu-Adams JY, Van de Water J, Chambers CD, Coles CD, Kable JA, Yevtushok L, Zymak-Zakutnya N, Wertelecki W, Keen CL (2018) Implications of altered maternal cytokine concentrations on infant outcomes in children with prenatal alcohol exposure. Alcohol 68:49–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Streissguth AP, Barr HM, Labbe RF, Smith JR, Darby BL, Smith NJ, Martin DC, Doan RN (1983) Alcohol Use and Iron Status in Pregnant Women. Alcohol Clin Exp Res 7:227–230. [DOI] [PubMed] [Google Scholar]
  55. Terasaki LS, Schwarz JM (2016) Effects of Moderate Prenatal Alcohol Exposure during Early Gestation in Rats on Inflammation across the Maternal-Fetal-Immune Interface and Later-Life Immune Function in the Offspring. J Neuroimmune Pharmacol 11:680–692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Toblli JE, Cao G, Oliveri L, Angerosa M (2011) Effects of iron deficiency anemia and its treatment with iron polymaltose complex in pregnant rats, their fetuses and placentas: Oxidative stress markers and pregnancy outcome. Placenta 33:81–87. [DOI] [PubMed] [Google Scholar]
  57. Tolkien Z, Stecher L, Mander AP, Pereira DIA, Powell JJ (2015) Ferrous sulfate supplementation causes significant gastrointestinal side-effects in adults: A systematic review and meta-analysis. PLoS One 10:1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Wang H, Lafdil F, Kong X, Gao B (2011) Signal Transducer and Activator of Transcription 3 in Liver Diseases: A Novel Therapeutic Target. Int J Biol Sci 7:536–550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wolf J, Rose-John S, Garbers C (2014) Interleukin-6 and its receptors: A highly regulated and dynamic system. Cytokine 70:11–20. [DOI] [PubMed] [Google Scholar]
  60. World Health Organization (2015) The Global Prevalence of Anaemia in 2011, WHO Report. [Google Scholar]
  61. Xiao X, Saha P, Yeoh S, Hipp JA, Singh V, Vijay-Kumar M (2018) Myeloperoxidase deficiency attenuates systemic and dietary iron-induced adverse effects. J Nutr Biochem 62:28–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zelner I, Koren G (2013) Pharmacokinetics of ethanol in the maternal-fetal unit. J Popul Ther Clin Pharmacol 20:259–265. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Info1
NIHMS1050658-supplement-Supp_Info1.pdf (571.8KB, pdf)
Supp Info2
NIHMS1050658-supplement-Supp_Info2.pdf (492.7KB, pdf)
Supp Info3
NIHMS1050658-supplement-Supp_Info3.pdf (428.1KB, pdf)

RESOURCES