Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Jul 1.
Published in final edited form as: J Allergy Clin Immunol. 2019 Apr 5;144(1):336–339.e6. doi: 10.1016/j.jaci.2019.04.001

Human BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy

Rodrigo Jiménez-Saiz 1,2,†, Yosef Ellenbogen 1,2,†, Kelly Bruton 1,†, Paul Spill 1, Doron D Sommer 3, Hermenio Lima 4, Susan Waserman 4, Sarita U Patil 2, Wayne G Shreffler 2, Manel Jordana 1,*
PMCID: PMC7010227  NIHMSID: NIHMS1546590  PMID: 30959060

CAPSULE SUMMARY

R. Jimenez-Saiz, Y. Ellenbogen and K. Bruton et al. developed a method to identify bona fide IgE+ MBCs in humans, demonstrated their extreme rarity in circulation and cautioned against the clinical utility of their assessment.

Keywords: IgE, Memory B cells, BCR, food allergy, peanut allergy, atopic dermatitis, single-sorting, PBMCs, flow cytometry, class-switching

To The Editor

The biology of IgE+ memory B cells (MBCs) remains enigmatic. The body of data from murine models demonstrates that IgE+ MBCs are extremely rare, at best, therefore suggesting that IgE-mediated recall responses are derived from non-IgE expressing MBCs, particularly IgG11. In stark contrast, several human studies have claimed that a population of IgE+ MBCs can be identified in peripheral blood mononuclear cells (PBMCs) of healthy, atopic and food-allergic donors 2–4, as well as in the sputum of asthmatics5, 6. Moreover, the presence of these cells in circulation has been proposed as a prognostic marker of allergy2.

The divergent findings on the existence of IgE-expressing MBCs between mice and humans could be partly due to the precision of techniques used in their quantification. While the identification of IgE-expressing MBCs cells in mice have been comprehensive, the identification of these cells in humans has relied on flow cytometry1. In light of this, we sought to establish a method to validate the flow cytometric identification of IgE+ MBCs via genetic analysis of the BCR isotypes from single-sorted cells (see detailed methods provided in this article′s Online Repository at www.jacionline.org).

We modified a single-cell B cell nested PCR amplification method7 to amplify the variable region of IgE transcripts with primers shown specific to the 5’ end of IgE heavy chain constant region3 (Fig. E1, A). Then the amplicons underwent Sanger sequencing and resulting sequences were aligned to human heavy chain constant regions alleles of all antibody isotypes to assess homology. To evaluate that the PCR technique amplifies IgE transcripts with high specificity and sensitivity, we single-sorted a human IgE-expressing cell line and performed IgE RT-PCR following the same methodology (Fig. E1, B).

Fig. E1. Methodology to validate genetically the IgE identity of single-sorted cells.

Fig. E1.

(A) Schematic of the method. (B) Single-sorted human IgE-expressing myeloma cells were assayed by nested PCR; (C) the IgE transcripts were shown to align with IGHE alleles. (D) Peripheral blood CD20+ B cells that stained negative for IgE were single-sorted and (E) IgE transcripts did not amplify as evidenced by DNA gel electrophoresis.

Our protocol demonstrated high sensitivity, amplifying on average over 90% of cells tested, the sequences of which all aligned to IgE constant region (IGHE) alleles (Fig. E1, C). Additionally, we generated a DNA vector containing a human IgE backbone (IgEV) for use as a positive control. To determine that our technique specifically amplifies IgE transcripts, we single-sorted peripheral blood B cells (CD20+) that did not stain for IgE (Fig. E1, D). Using the same RT-PCR strategy as in Fig. E1, A, none of the IgE− B cells amplified (Fig. E1, E), indicating that the technique is both sensitive and specific. Together, these data demonstrate that this system accurately amplifies rearranged IgE heavy chain variable sequences, specifically in single-sorted IgE-expressing cells.

Reported frequencies of IgE-expressing MBCs in peripheral blood vary depending on the flow cytometric identification strategies2, 3, 6, 8. A basic approach to identifying these cells involves intracellular staining of IgE without preventing staining of cytotropic IgE5, 6. A more stringent detection method involves the step-wise exclusion of each BCR isotype via extracellular staining3. With our single-cell IgE amplification protocol, we sought to validate the frequency of peripheral blood IgE-expressing MBCs in PN-allergic donors using these previously reported flow cytometric approaches.

MBCs were identified as live singlets CD20+CD38lo-medCD27+and IgD−IgM− and IgE+ MBCs were further identified through basic IgE staining or the step-wise exclusion approach (Fig. E2, B). Twelve putative IgE-expressing MBCs were single-cell sorted from each staining technique for subsequent single-cell nested PCR. Basic IgE staining revealed a 3.4% frequency of IgE+ MBCs cells from B cells. However, no cells amplified with IgE-specific RT-PCR (Fig. E2, C). The step-wise exclusion approach reported a frequency of putative IgE-expressing MBCs 20 times lower, 0.17% but, likewise, none of the cells amplified with IgE-specific RT-PCR (Fig. E2, D). To delineate the BCR identity of the spurious cells that fell into the IgE gate we generated a cocktail of primers specific to IgG, IgA, and IgM heavy chain regions (GAM). Using our single-cell nested PCR strategy, over 90% of the sorted cells amplified with GAM primers and the rest did not amplify (<10%). Amplicons were confirmed to align predominantly with IGHG and to a minor extent to IGHA, or IGHM through Sanger sequencing. These data demonstrate that previously reported IgE+ MBC flow cytometry detection protocols result in a high rate of false-positive events.

Fig. E2. BCR analysis of single-sorted putative IgE+ MBCs stained with commonly used methods demonstrates a non-IgE identity.

Fig. E2.

(A) Schematic of the experimental design. (B) Gating strategy employed with a basic IgE staining (upper) or step-wise exclusion (lower) method. (C) BCR amplification with primers specific for IgHE or a mix (IgHGAM). Data are representative of 5 independent experiments (1–2 donors per experiment and 12–24 cells single-sorted per donor).

The demonstration that previously reported flow cytometric methods for IgE+ MBC identification are faulty, prompted us to ascertain the true frequency of these cells. Since the step-wise exclusion method generated a substantially lower number of spurious events than the basic IgE staining method, we sought to modify the former to remove contamination from non-IgE-expressing cells, which largely originated from IgG+ MBCs carrying cytotropic IgE (data not shown). This enhanced protocol consisted of purifying B cells from PBMCs and a step-wise exclusion of IgD+, IgM+, IgA+, IgG+ (Fig 1, A). Furthermore, the use of a polyclonal anti-IgG antibody markedly contributed to resolve the double negative population of MBCs (IgD−IgM−IgG−IgA−IgE−) compared to the previous step-wise exclusion method (3.8% vs. 58.6%). As B cells canonically express at least one BCR isotype, we reasoned that the population arose from B cells with a low BCR surface density, in which the use of a polyclonal (rather than monoclonal) antibody to stain for surface IgG was superior. Notably, the improved staining resulted in a significantly lower frequency of cells in the IgE gate, at 0.006% of total B cells, which was considered background as it was comparable to the frequency observed in the FMO (0.01% of total B cells; Fig. 1, A).

Fig. 1. (A) Enhanced flow cytometric method for detection of IgE+ MBCs.

Fig. 1.

(A) Cytometric detection of IgE+ MBCs. (B) PBMCs cultured with IL-4 and anti-CD40 were analyzed by ELISPOT and ELISA (C) and single-sorted. (D, F) Amplification of IgE transcripts of single-sorted cells from positive control or patients with atopic dermatitis (E, G) and alignment to the constant region of IgHE. Data are representative of 2 independent experiments (1–2 donors per experiment and 12–24 cells single-sorted per donor).

To validate that our enhanced staining technique was capable of detecting IgE+ MBCs, we stimulated PBMCs in culture with IL-4 + anti-CD40. As expected, culturing under these conditions resulted in the robust emergence of IgE-secreting cells and IgE as detected by total IgE ELISPOT and ELISA, respectively (Fig. 1, B). A population of putative IgE+ MBCs was observed through the enhanced step-wise exclusion method (Fig. 1, C) and their IgE-identity was confirmed through single-cell nested RT-PCR and Sanger sequencing (Fig. 1, D–E). Further validation was carried out in PBMCs from 4 patients with atopic dermatitis and serum IgE levels between 2370 and 6350 kIU/L. Bona fide IgE+ MBC, confirmed with Sanger sequencing, were identified in 2 of these 4 patients at a frequency of 0.0015% from total B cells (Fig. 1, F–G).

With our enhanced detection method, we conducted analysis on PBMCs of 20 donors that included PN-allergic (n=9; mean serum total IgE of 196 [11–890] kIU/L) and non-allergic patients (n=10) (Table E1). We detected similar frequencies of putative IgE+ MBCs (% from total B cells = 0.0019 PN-allergic, 0.0046 non-allergic). However, in all instances there was no IgE amplification (Table 1). To ensure that IgE+ MBCs were not being undetected through our exclusion of CD27− cells, we sorted CD27− IgE+ MBCs as it has been speculated that MBCs arising extra-follicularly 3 may not gain CD27, the canonical MBC marker. Similarly, no PCR amplification occurred with IgE primers (data not shown). Furthermore, we investigated the possibility that the polyclonal anti-IgG antibody could bind non-specifically to IgE+ MBCs due to serum IgG or IgA bound to MBCs, thus masking IgE+ MBCs cells in the IgG+ or IgA+ populations. Here, we stained for IgA and IgG on the same fluorophore and flow-sorted class-switched MBCs that were positive for IgE (Fig. E3, A–B). The frequency of this population was 0.074% and the genetic analysis demonstrated that these MBCs were of a non-IgE identity that presumably bound secreted IgE. Additionally, we single-sorted class-switched MBCs from the IgG, IgA and (residual) double negative gate. There was not PCR amplification with IgE primers, but with GAM (Fig. E3, C–D), thus supporting that the methodology employed did not underestimate the frequency of IgE+ MBCs.

Table E1.

Patient’s profiles

Donor ID Sex Age Serum IgE (KIU/L) Atopic Dermatitis Clinical Reactivity to Peanut Peanut-IgE (kU/L) Skin Prick Test (S/H/P)
Non-Allergic P001 M 20 <5 No No <0.1 2/5/2
P003 M 23 96 No No <0.1 1/3/1
P007 M 23 <5 No No <0.1 1/4/1
P009 F 24 <5 No No <0.1 1/4/1
P014 M 22 230 No No 0.34 2/5/2
P021 M 21 45 No No <0.1 1/4/2
P025 F 34 40 No No <0.1 1/5/1
P026 M 19 37 No No 0.11 1/6/1
P030 M 24 9 No No <0.1 1/4/1
P031 M 23 12 No No <0.1 1/5/1
TP09 M 2 NA No No NA NA
TP10 M 30 NA No No NA NA
TP11 M 5 NA No No NA NA

Atopic Dermatitis P006 F 23 5430 Yes Yes 13.48 1/4/5
P034 F 39 3760 Yes No 10.29 NA
P035 M 53 2370 Yes No NA NA
P036 F 20 6350 Yes No NA NA

PN-Allergic P008 M 32 130 No Yes 15.87 1/4/7
P011 M 19 210 No Yes 0.66 1/5/7
P013 M 20 890 No Yes 28.09 1/5/4
P016 M 21 91 No Yes 1.66 1/4/8
P017 M 22 120 No Yes 43.28 1/4/10
P020 M 26 256 No Yes 7.56 1/4/12
P024 M 60 37 No Yes 5.54 1/4/10
P028 M 25 27 No Yes 1.11 1/4/7
P029 F 23 11 No Yes 3.79 1/4/6

Table 1.

Quantification of IgE+ MBCs in healthy and allergic donors

Tissue Donor ID Allergic Status MNCs Purified B Cells Events in CD20+ CD38lo-med Gate Events in IgE Gate Sorted Cells IGHE Amplification
Blood P001 - 250,000,000 9,540,000 600,304 21 6 0
P003 - 123,000,000 8,640,000 169,267 29 12 0
P007 - 125,000,000 2,685,000 645,055 5 3 0
P009 - 98,600,000 4,140,000 325,734 12 12 0
P014 - 109,000,000 2,820,000 605,535 8 8 0
P021 - 173,000,000 26,000,000 440,963 2 1 0
P025 - 86,600,000 1,401,000 246,090 20 20 0
P026 - 94,200,000 1,494,000 250,018 14 10 0
P030 - 78,800,000 1,128,000 132,157 4 4 0
P031 - 85,400,000 945,000 172,260 4 4 0
P008 PN 125,000,000 8,160,000 335,641 20 20 0
P011 PN 250,000,000 7,150,000 520,021 6 3 0
P013 PN 210,000,000 5,450,000 690,015 13 12 0
P016 PN 125,000,000 1,068,000 143,759 5 5 0
P017 PN 125,000,000 1,467,000 213,345 11 10 0
P020 PN 124,000,000 3,900,000 537,856 4 1 0
P024 PN 71,800,000 1,026,000 166,313 3 1 0
P028 PN 94,800,000 1,440,000 157,340 1 1 0
P029 PN 54,000,000 1,467,000 277,359 2 2 0

Tonsils TP-9 - 10,000,000 - 204,125 10 7 0
TP-10 - 10,000,000 - 68,461 15 12 0
TP-11 - 10,000,000 - 56,127 6 6 0

Figure E3. Assessment of cytotropic (IgG and/or IgA) and negative staining of IgE+ MBCs.

Figure E3.

(A, C) Cytometric detection and sorting of class-switched MBCs from different gates. (B, D) BCR amplification with primers specific for IgE (IgHE) or a mix specific of IgG, IgA and IgM (IgHGAM) of single-sorted cells. Data are representative of 2 independent experiments (2 donors per experiment and 12–18 cells single-sorted per donor).

The value of scientific knowledge relies to a large extent on the fidelity of the tools used to generate such knowledge. In this context, we provide a validated method to identify bona fide IgE+ MBCs. Our data demonstrate the extreme rarity of these cells in the circulation of allergic patients -at least orders of magnitude lower than previously reported2, 3- and are in agreement with human genetic studies that reported few IgE transcripts in circulation but without unambiguously defining the B cell phenotype (MBC, plasmablast, etc.)9. This finding strengthens the concept that the reservoir of IgE-secreting cells resides in MBCs of a non-IgE isotype and, as such, informs future research directions. Of note, it is possible that tissues from allergic subjects could harbour IgE+ MBCs; this remains both a challenge and a prime venue for future efforts. Nevertheless, it is evident that the proposal that circulating IgE+ MBCs could be a clinical marker for allergic disease is unproven.

METHODS

Flow cytometry

Antibodies were obtained from BioLegend (San Diego, California), Columbia Biosciences (Frederick, Maryland), BD Biosciences (San Jose, California), Miltenyi Biotec (Bergisch Gladbach, Cologne), eBioscience (Carlsbad, California) or ThermoFisher Scientific (Waltham, Massachusetts): CD38-phycoerythrin (PE)-Cy7 (clone HIT2); IgE-allophycocyanin (APC) (Columbia Biosciences SKU: D3–110-E); IgG-PE (clones G18–145 and HP6017, and ThermoFisher Scientific Catalog #12–4998-82); IgA-PE (clone IS11–8E10); IgA-APC (clone IS11–8E10); IgM-Brilliant Violet (BV) 510 (clone MHM-88); IgD-BV421 (clone IA6–2); IgG-biotin (ThermoFisher Scientific Catalog #A18815); CD20-Alexa Fluor700 (clone 2H7); CD27-FITC (clone O323). In all assays 1 × 106 cells were first incubated with Human TruStain FcX (Fc Receptor Blocking Solution, Biolegend) or anti-human CD32 (FcγRII Blocker, StemCell Technologies) for 15 minutes on ice to block non-specific staining and then incubated with fluorochrome-conjugated antibodies for 30 minutes on ice and protected from light. When IgG-biotin was used to label IgG+ cells, cells were incubated for an additional 30 minutes with streptavidin-PE (BioLegend) on ice and protected from light. Dead cells were excluded using the fixable viability dye eFluor780 (eBioscience) and by gating on singlets. FMO were used for gating. Data were acquired on a Fortessa (BD Biosciences) and analyzed with FlowJo software (TreeStar, Ashland, Ore), and single cells were sorted on a MoFlo XDP Cell Sorter (Beckman Coulter).

PCR amplification

Single cells were sorted into 96-well PCR plates (Thermofisher) containing 20 units RNasin® Ribonuclease Inhibitors (Promega) 2 μL First Strand buffer (Thermofisher), and nuclease-free water to a volume of 10 μL per well. The cells are centrifuged at 4°C at 550 g for 1 minute and immediate placed in −80°C freezer. Next, heat lysis was performed by adding 3 μL Nonidet® P-40 Substitute (G-Biosciences) and 150 ng of random hexamers (Thermofisher). The reaction was performed at 65°C for 10 minutes and then 25°C for 3 minutes. All thermocycler reactions were done using Mastercycler® pro S (Eppendorf). cDNA was synthesized as previously described. Briefly, 2 μL 5X First Strand buffer (Thermofisher), 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP, and 0.5 μL SuperScript III (Thermofisher) was added to the plate containing the heat lysis contents (final volume 19.5 μL). Reverse transcription was performed at 37°C for 1 hour and then 70°C for 10 minutes.

IgH amplification was accomplished using a two-step nested PCR as previously described. Briefly, a mix of 6 forward primers1 and either a reverse primer specific to IGHE2 (first 5′-CATCACCGGCTCCGGGAAGTAG-3′and second 5′-GTTTTTGCAGCAGCGGGTCAAG-3′) or a pool of reverse primers specific to IGHM, IGHA and IGHG were used3 (IGHM: first 5′-CAGGAGACGAGGGGGAAAAG-3′and second 5′-GAAAAGGGTTGGGGCGGATGC-3′; IGHA: first 5′- GCTCAGCGGGAAGACCTT-3′ and second 5′- GACCTTGGGGCTGGTCGGGGA-3′; IGHG: first 5′-GCCAGGGGGAAGACSGATG-3′ and second 5′-GACSGATGGGCCCTTGGTGGA-3′). The first PCR reaction contained 8 μL of cDNA mixture, 1 unit of HotStar Plus Taq (Qiagen), 200 nM of each primer, 400 μM dNTP (Thermofisher), 5 μL 10X PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL. The reaction was performed starting with 3 cycles of pre-amplification of 95°C for 45 seconds, 45°C for 45 seconds, 72°C for 45 seconds, followed by 30 cycles of 94°C for 45 seconds, 50°C for 45 seconds, 72°C for 1 minute and 45 seconds, followed by a final extension of 72°C for 10 minutes. The second PCR reaction contained 4 μL of PCR 1 product, 5 μL of 10X Pfu buffer (Agilent) 1.25 μL of 10 mM dNTP (Thermofisher), 400 nM of each primer, 1.25 units Pfu polymerase (Agilent), and nuclease-free water to a final concentration of 50 μL. The reaction was performed for 30 cycles at 94°C for 45 seconds, 50°C for 45 seconds, 72°C for 1 minute and 45 seconds, followed by a final extension of 72°C for 10 minutes.

The second PCR product was visualized on a 1.5% agarose gel and the expected band size was approximately 400 bp. Amplified IgH sequences were enzymatically purified using ExoSAP-IT™ PCR Product Cleanup Reagent (Thermofisher) and subsequently Sanger sequenced using the forward and reverse primers (GENEWIZ). The sequences were analyzed using IMGT/HighV-QUEST (http://imgt.org/HighV-QUEST) for V, D, and J sequences with the highest identity, as well as nucleotide and amino acid mutations from their germline sequences.

Generation of a DNA vector containing a human IgE backbone (IgEV)

To generate a human IgE, we started with a heavy chain IgG1 vector (gifted by Michel C. Nussenzweig) previously modified to include an Ara h 2 variable chain4. The human ε constant region was amplified from an anti-OVA human IgE vector5 with primers (5’ TTTT GTCGAC GGCGCACCA 3’ and 5’ TTTT AAGCTT CTCAATGGTGGTGATGTTTA 3’) to add flanking SalI and HindIII restriction enzyme sites. The human ε constant region then replaced the γ1 constant region under the CMV provider using the SalI and HindIII restriction enzyme sites. Sanger sequencing confirmed successful insertion of the ε constant region.

Study population

A cohort of 10 PN-allergic and 10 non-allergic blood donors were recruited from McMaster University (Hamilton, ON). Allergy to PN was ascertained by PN-specific IgE ImmunoCap® performed at LRC Hamilton (McMaster Children’s Hospital), and by skin prick test. PN-allergic individuals were considered for inclusion with PN-specific serum IgE levels >0.35 kU/L and skin prick test ≥3 mm greater than saline control. Total serum IgE was quantified by IMMAGE® 800 (Beckman Coulter) performed at LRC Hamilton for a general measure of atopy. We recruited an additional 4 participants with total serum IgE levels > 2300 kIU/L and received 3 tonsil discards from individuals undergoing routine tonsillectomies. Exclusion criteria for all recruited donors included: allergen immunotherapy, previous or current omalizumab (Xolair®) treatment, other systemic immunomodulatory treatments (i.e., rituximab), or autoimmune/immunodeficiency diseases. Patient demographics and allergic indicators are summarized in Table E1. All donors were recruited with written consent and ethical approval from Hamilton Integrated Research Ethics Board (HiREB).

Mononuclear cell isolation and B cell enrichment

Up to 80 mL of peripheral blood was collected into heparinized tubes (BD) and tonsils were crushed into a single-cell suspension. PBMCs were isolated via Ficoll-Paque (GE Healthcare) density gradient centrifugation. Immediately following, B cells were isolated from PBMCs using a negative selection magnetic separation kit (19054, StemCell Technologies) with at least 70% purity.

PBMC culture

PBMCs were cultured in RPMI 1640 (Gibco) supplemented with 10% human AB serum (Corning), 10 mM HEPES, 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, 55 μM 2-mercaptoethanol, 1% L-glutamine, and 1% penicillin-streptomycin. Cells were plated at a density of 1.5 × 106 per mL in 24-well plates. Stimulated cells were treated with 68.7 ng/mL (8000IU) IL-4 (Sigma-Aldrich) and 5 μg/mL anti-CD40 (BioXCell) on day 1. Cells were incubated at 37°C and 5% CO2 for the duration of culture. On days 4 and 8 of culture, 1 mL of cell-free supernatant was withdrawn and replaced with fresh media. Supernatant was also withdrawn on day 11 of culture and stored at −80°C for later analysis of total IgE by ELISA. After 11 days in culture, cells were harvested and IgE-secreting cells were quantified using ELISPOT.

ELISA and ELISPOT

For total IgE ELISA, MaxiSorb plates (ThermoFisher Scientific) were coated with 0.5 μg/ml anti-human IgE (555894, BD Pharmingen) in carbonate-bicarbonate buffer overnight at 4°C. Coated wells were blocked with 5% skim milk in PBS for 2 hours at room temperature, followed by 3 washes (1x PBS and 0.05% Tween 20). Cell-free supernatant samples and a serial dilution of purified human IgE (401152, Calbiochem) were incubated overnight at 4°C. Wells were washed 3 times and incubated with 1 μg/ml biotinylated anti-human IgE (A18803, Invitrogen) in 1% skim milk for 2 hours at room temperature. Subsequently, wells were washed 3 times and incubated with alkaline-phosphatase streptavidin for 1 hour at room temperature. Plates were developed with p-nitrophenyl phosphate and the reaction was stopped with 2N NaOH. Optical density was measured at 405 nM (Multiskan™FC, Thermo Scientific).

A commercially available ELISPOT kit (3810–2H, Mabtech) was used for the detection of IgE-secreting cells. On day 11 of culture, samples were plated in duplicate at 4 × 106 cells/mL. Plates were imaged with ImmunoSpot® S6 Analyzer and spots were counted independently by 2 blinded investigators.

Acknowledgments

This study was supported by grants from Food Allergy Canada, the Delaney family, the Zych family, the Walter and Maria Schroeder Foundation and AllerGen NCE (grant 16CanFAST5 to Drs. Waserman and Jordana, International Visit Award to Dr. Jimenéz-Saiz and Summer studentship to Yosef Ellenbogen), and National Institutes of Health grant (K23AI121491 to Dr. Patil).

Footnotes

Disclosure of potential interest: All the authors have no significant conflicts of interest to declare.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • 1.Jimenez-Saiz R, Bruton K, Koenig JFE, Waserman S, Jordana M. The IgE memory reservoir in food allergy. J Allergy Clin Immunol 2018; 142:1441–3. [DOI] [PubMed] [Google Scholar]
  • 2.Heeringa JJ, Rijvers L, Arends NJ, Driessen GJ, Pasmans SG, van Dongen JJM, et al. IgE-expressing memory B cells and plasmablasts are increased in blood of children with asthma, food allergy, and atopic dermatitis. Allergy 2018; 73:1331–6. [DOI] [PubMed] [Google Scholar]
  • 3.Berkowska MA, Heeringa JJ, Hajdarbegovic E, van der Burg M, Thio HB, van Hagen PM, et al. Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways. J Allergy Clin Immunol 2014; 134:688–97 e6. [DOI] [PubMed] [Google Scholar]
  • 4.Heeringa JJ, Fieten KB, Bruins FM, van Hoffen E, Knol EF, Pasmans S, et al. Treatment for moderate to severe atopic dermatitis in alpine and moderate maritime climates differentially affects helper T cells and memory B cells in children. Clin Exp Allergy 2018; 48:679–90. [DOI] [PubMed] [Google Scholar]
  • 5.Oliveria JP, Salter BM, MacLean J, Kotwal S, Smith A, Harris JM, et al. Increased IgE(+) B Cells in Sputum, but Not Blood, Bone Marrow, or Tonsils, after Inhaled Allergen Challenge in Subjects with Asthma. Am J Respir Crit Care Med 2017; 196:107–9. [DOI] [PubMed] [Google Scholar]
  • 6.Oliveria JP, Salter BM, Phan S, Obminski CD, Munoz CE, Smith SG, et al. Asthmatic subjects with allergy have elevated levels of IgE+ B cells in the airways. J Allergy Clin Immunol 2017; 140:590–3 e9. [DOI] [PubMed] [Google Scholar]
  • 7.Tiller T, Busse CE, Wardemann H. Cloning and expression of murine Ig genes from single B cells. J Immunol Methods 2009; 350:183–93. [DOI] [PubMed] [Google Scholar]
  • 8.Blanco E, Perez-Andres M, Arriba-Mendez S, Contreras-Sanfeliciano T, Criado I, Pelak O, et al. Age-associated distribution of normal B-cell and plasma cell subsets in peripheral blood. J Allergy Clin Immunol 2018; 141:2208–19 e16. [DOI] [PubMed] [Google Scholar]
  • 9.Croote D, Darmanis S, Nadeau KC, Quake SR. High-affinity allergen-specific human antibodies cloned from single IgE B cell transcriptomes. Science 2018; 362:1306–9. [DOI] [PubMed] [Google Scholar]

REFERENCES

  • 1.Tiller T, Meffre E, Yurasov S, Tsuiji M, Nussenzweig MC, Wardemann H. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods 2008; 329:112–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Berkowska MA, Heeringa JJ, Hajdarbegovic E, van der Burg M, Thio HB, van Hagen PM, et al. Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways. J Allergy Clin Immunol 2014; 134:688–97 e6. [DOI] [PubMed] [Google Scholar]
  • 3.Wang X, Stollar BD. Human immunoglobulin variable region gene analysis by single cell RT-PCR. J Immunol Methods 2000; 244:217–25. [DOI] [PubMed] [Google Scholar]
  • 4.Patil SU, Ogunniyi AO, Calatroni A, Tadigotla VR, Ruiter B, Ma A, et al. Peanut oral immunotherapy transiently expands circulating Ara h 2-specific B cells with a homologous repertoire in unrelated subjects. J Allergy Clin Immunol 2015; 136:125–34 e12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shade KT, Platzer B, Washburn N, Mani V, Bartsch YC, Conroy M, et al. A single glycan on IgE is indispensable for initiation of anaphylaxis. J Exp Med 2015; 212:457–67. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES