Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2020 Feb 11;10(3):110. doi: 10.1007/s13205-020-2086-9

Study of subcellular localization of Glycine max γ-tocopherol methyl transferase isoforms in N. benthamiana

Khushboo Kumari 1,2, Monika Prakash Rai 2, Navita Bansal 1,2, G Rama Prashat 3, Sweta Kumari 1, Rohini Srivathsa 4, Anil Dahuja 1, Archana Sachdev 1, Shelly Praveen 1,✉, T Vinutha 1,✉
PMCID: PMC7013018  PMID: 32099748

Abstract

Gamma-tocopherol methyltransferase (γ-TMT) converts γ-toc to α-toc—the rate limiting step in toc biosynthesis. Sequencing results revealed that the coding regions of γ-TMT1 and γ-TMT3 were strongly similar to each other (93% at amino acid level). Based on the differences in the N-terminal amino acids, Glycine max-γ-TMT proteins are categorized into three isoforms: γ-TMT1, 2 and 3. In silico structural analysis revealed the presence of chloroplast transit peptide (cTP) in γ-TMT1 and γ-TMT3 protein. However, other properties of transit peptide like presence of hydrophobic amino acids at the first three positions of N-terminal end and lower level of acidic amino acids were revealed only in γ-TMT3 protein. Subcellular localization of GFP fused γ-TMT1 and γ-TMT3 under 35S promoter was studied in Nicotiana benthamiana using confocal microscopy. Results showed that γ-TMT1 was found in the cytosol and γ-TMT3 was found to be localized both in cytosol and chloroplast. Further the presence γ-TMT3 in chloroplast was validated by quantifying α-tocopherol through UPLC. Thus the present study of cytosolic localization of the both γ-TMT1 and γ-TMT3 proteins and chloroplastic localization of γ-TMT3 will help to reveal the importance of γ-TMT encoded α-toc in protecting both chloroplastic and cell membrane from plant oxidative stress.

Electronic supplementary material

The online version of this article (10.1007/s13205-020-2086-9) contains supplementary material, which is available to authorized users.

Keywords: α-Tocopherol, Glycine max, γ-TMT3, γ-TMT1, Sub-cellular localization, Confocal microscopy

Introduction

The γ-tocopherol methyl transferase (γ-TMT) is a crucial enzyme which catalyses the synthesis of the α-tocopherol (α-toc) by using γ-tocopherol (γ-toc) as a substrate and is the rate limiting step in tocopherol (toc) biosynthesis in plants (Shintani and DellaPenna 1998). In soybean, γ-TMT proteins are categorize into three types of isoforms viz, γ-TMT1, 2 and 3 based on amino acid sequence variations at N-terminal region (Dwiyanti et al. 2011). In sunflower (Helianthus annuus L.) seeds, two isoforms of γ-TMT (γ-TMT1, γ-TMT2) were also isolated and characterized (Hass et al. 2006). Overexpression of γ-TMT was shown in many of the plant species including soybean, lettuce and Perilla and reported up to 90–95% higher amount of α-toc in the plants (Chen et al. 2012; Arun et al. 2014; Tavva et al. 2007). Hence, γ-TMT is proposed to be a pivotal gene for genetic modification to obtain enhanced α-toc levels in the plants. The components of tocopherols (α, β, γ and δ) together with group of tocotrienols (α, γ, β and δ) are collectively called as Vitamin E (Vit E) or tocochromanols (DellaPenna and Pogson 2006; DellaPenna 2005). They are lipid soluble compound, synthesized by photosynthetic organisms which includes plants, some algae and cyanobacteria (Mène-Saffrané et al. 2010; Horvath et al. 2006). α-toc has highest Vit E activity in human body (Drevon 1991; Traber and Sies 1996; Hosomi et al. 1997) and intake of Vit E more than the recommended dose (RDA-15 mg day−1) helps in immune function, reduces the risk of cardiovascular disease, various type of cancer, and caducity-aids (Azzi and Stocker 2000; Schneider 2005). In soybean, γ-toc is present in highest amount but Vit-E activity of γ-toc is nearly one-tenth of α-toc. The γ-TMT mediated α-toc synthesis has several roles in plant development and growth. The importance of α-toc was also showed in plant growth, development and other physiological phenomenon (Horvath et al. 2006). The positive correlation between toc content with tolerance to water deficiency, low temperature or salt stress in various species has reported (Yamaguchi-Shinozaki and Shinozaki 1994; Munné-Bosch et al. 1999; Guo 2006). Reduction in the fresh weight of mature plants containing higher amount of γ-toc and absence of α-toc was shown in leaves of Arabidopsis (Bergmüller et al. 2003). Current studies depicted that α-toc have an important role in cellular signaling by changing the levels of plant hormone (Munné-Bosch 2005; Munné-Bosch et al. 2007). It also plays a crucial part in regulating the carbon translocation (Botha and Black, 2000; Hofius et al. 2004; Russin et al. 1996). In plants, α-toc has major impact on regulation of plant growth through stabilizing the thylakoid structure, lipid peroxidation, reduction of heavy metal and salt stress (Sattler et al. 2004; Munné-Bosch and Alegre 2002a; b; Jin and Daniell 2014). In leaves, toc is mainly present as α-toc (Szymanska and Kruk 2008a, b) and localized in chloroplast (Soll et al. 1985; Lichtenthaler et al. 1981). Chloroplast are ubiquitous and an important organelle of the plants and algae, carry out various necessary functions like photosynthesis, biosynthesis of fatty acids, carotenoids, vitamins, and nucleotides (López-Juez 2006; Leister 2003). The proteins destined to plastids or any other organelles are intended to possess certain sequence information as characteristic features which help in targeting of proteins. This information mostly lies in N-terminal cTPs usually referred to as transit sequence or signal sequence (Bruce 2000; Von Heijne et al. 1989). In general cTPs are found to be composed of high amount of hydroxylated amino acids like Thr, Ser and Pro and most prominently possess lower amount of acidic amino acids (Lee et al. 2006). Unlike mitochondrial signal sequences, chloroplast lack definite and conserved featuresat N-terminal region across the plant species. Various types of programs are available at present which can predict localization of protein based on these cTPs, however, many of the known plastid proteins lack these cTPs sequences (Sun et al. 2004; Van Wijk 2004; Millar et al. 2006), for example chloroplast envelope quinine oxidoreductase (ceQORH) protein was found in the inner membrane, though it lacks a transit peptide (Miras et al. 2007). However, transit peptides do not show obvious conserved sequences and they are rather similar with mitochondrial targeting signals, in such cases in silico techniques are not fully predictable (Richly and Leister 2004). It was recently observed that many proteins which are destined to chloroplast first becomes N-glycosylated and takes an alternative route through the secretary pathway and probably many chloroplast proteins follow this way (Villarejo et al. 2005). Therefore proper characterization of cTPs is required to predict localization of proteins. To study the sub-cellular localization of Glycine max γ-TMT isoforms i.e. γ-TMT1 and γ-TMT3, the cDNA of γ-TMT genes were cloned and fused with GFP gene under the control of 35S promoter and 35s::GFP:γ-TMT1, 35s::GFP:γ-TMT3 constructs were transiently transformed via Agrobacterium-mediated approach into leaves of Nicotiana benthamiana. At fifth day, agro-infiltrated leaves were analysed for the localization of γ-TMT1 and γ-TMT3 proteins using confocal scanning microscope.

Materials and methods

Plant materials

Soybean seeds (Bragg genotype) and Nicotiana benthamiana seeds were collected from Genetics division, IARI and ICAR-National Institute for Plant Biotechnology (NIPB), respectively. Soybean seeds have sown in a National Phytotron facility at 24–28 °C and 72–76% relative humidity (RH). The growing conditions for Nicotiana benthamiana was maintained as follow: temperature cycles of 25 °C (light) and 18 °C (darkness) and RH upto 60–65% (light) and darkness upto 95–100% and photoperiod of 16 h under visible light with an irradiance of 65–85 μmol m−2 s−1 and darkness of 8 h.

Cloning of γ-TMT gene isoforms

Total RNA was isolated using 100 mg of soybean seeds with TRIZOL reagent. Complementary DNA (cDNA) was synthesized using cDNA synthesis kit (Thermo-scientific) from 1 µg of RNA. A pair of specific primers was designed for amplification of the CDS (complete coding sequence) region of γ-TMT1 and γ-TMT3 using Primer3 plus software (Table 1). Full-length CDS sequences of γ-TMT1 and γ-TMT3 were amplified using 50 ng of soybean cDNA as a template in reaction mixture of 50 μl, 10 × PCR Buffer 5 μl, rTaq (TAKARA) 0.5 μl, each 30 ng of specific primers and dNTP (0.25 mmol l−1). The PCR program was set as follows: denaturation for 45 s at 94 °C, annealing for 40 s at 58 °C, extension for 50 s at 72 °C, total of 35 cycles. The amplified product after PCR was separated and recovered on 1.2% agarose gel (Supplementary Fig. 1). The CDS region of γ-TMT1 (891 bp) and γ-TMT3 (909 bp) gene were cloned in pGEM-T Easy vector (Promega Corporation, USA). The positives clones were sequenced after confirming the clones by PCR and restriction enzyme digestion (Sequencher Tech Labs Ltd, India). The positive clones and pCambia:35S::GFP were restricted with SpeI and BglII restriction enzymes and ligated to yield 35S::GFP:γ-TMT1 and 35S::GFP:γ-TMT3 constructs. These GFP fused γ-TMT constructs were transformed into EHA105 competent cells (Agrobacterium strain) and then expressed transiently in Nicotiana benthamiana plants.

Table 1.

List of primers for γ-TMT gene and reference gene

Name of primer Type Sequence
γ-TMT1 Forward GAAGATCTTCATGGCAGGGAAGG
γ-TMT1 Reverse GGACTAGTCCTTCAGGCTTTCGACA
γ-TMT2 Forward GAAGATCTTCATGGCCACCGT
γ-TMT2 Reverse GGACTAGTCCTTCAGGTTTTCGACAT
γ-TMT3 Forward GAAGATCTTCATGTCGGTGGAGC
γ-TMT3 Reverse GGACTAGTCCTTCAGGCTTCCGA
EF1α-mRNA Forward ACAGAGGCTCTTC
EF1α-mRNA Reverse CAGGTGAATCGCCTGTCAATCTTGGTC
Open in a new tab

Transient expression in N. benthamiana

1-month-old N. benthamiana plants were selected. Overnight grown Agrobacterium cultures harboring 35S::GFP:γ-TMT1 and 35S::GFP:γ-TMT3 constructs in LB medium containing pROK2-mRFP (monomeric red fluorescent protein) and kanamycin (50 μg ml−1) were diluted in infiltration media (10 mM MES, 10 mM MgCl2 and 200 µM acetosyringone from Sigma) and cultures having OD (optical density) 0.2 were further taken for infiltration. Cultures were infiltrated into fully expanded young leaves of tobacco plants using syringe. Fluorescence was observed at fifth day of infiltration at 488 nm and 560 nm and images were taken with confocal microscope (Carl Zeiss, Germany).

Chloroplast isolation

Agro-infiltrated leaves were homogenized in extraction buffer (5 ml) (50 mM HEPES–KOH, 300 mM sorbitol, 1 mM MgCl2, 2 mM EDTA, 0.04% β-mercapto ethanol and 0.1% polyvinyl pyrrolidone, pH 7.8) at 4 °C. Then filtration was done through rayon-polyester Miracloth (Millipore), centrifuged at 1500g, 4 °C for 10 min. The resulting pellet was suspended in 2 ml of the isolation buffer (300 mM sorbitol, 50 mM HEPES–KOH, 1 mM MgCl2 and 2 mM EDTA pH 7.8). Suspended extract (1 ml) was loaded in a discontinuous Percoll® (Sigma) gradient (5 ml 10%–2.5 ml 80%), and was centrifuged at 8000g, 4 °C for 20 min. Intact chloroplasts were in a green band between 10 and 80% Percoll® layers. Chloroplasts were removed from the gradient with a Pasteur pipette and washed with one volume of isolation buffer, afterwards centrifuged at 1000g for 5 min. Further supernatant was decanted and the resulting pellet, which contains chloroplasts, was stored at − 20 °C.

Tocopherol extraction and estimation from chloroplast

Using chilled (50 mM, pH 7.0) potassium phosphate buffer containing 1 mM EDTA and 1% PVP (polyvinyl pyrrolidone), chloroplast pellet was grounded and homogenised. For toc estimation, this crude homogenate was used. Components of toc were estimated by the method described by Taylor et al. (1976). Sample was sonicated with KOH and toc was extracted to n-hexane in presence of ascorbic acid. For the identification for α, β, γ and δ toc peaks, C18 reverse phase column (length 280 mm and particle size 4.4 mm) was saturated with acetonitrile:methanol (50:50, v/v) and extract was resolved at a flow rate of 1 ml min−1 on acetonitrile:methanol isocratic gradient (50:50, v/v) for 20 min on a Agilent HPLC system. Different toc peaks from isolated chloroplast were resolved at 295 nm using corresponding standards peaks (Sigma-Aldrich Chemicals). Each toc component was identified by specific retention time.

Quantitative real-time PCR (qRT-PCR)

Total RNA from soybean seeds and leaves was extracted and followed by cDNA synthesis (cDNA synthesis kit-Promega). cDNA (250 ng) were used in a total reaction volume of 10 μl using SYBR Green Master Mix (Takara, Japan) and specific primers in Real Time PCR machine (Bio-Rad, USA). Three biological replicates and three technical replicates of soybean seeds and leaves were taken to study gene expression using qPCR and normalization of gene expression was carried out using reference EF1α- gene. The relative level of gene expression was calculated by ΔCt method.

Result and discussion

Analysis of spatial gene expression in γ-TMT isoforms from soybean

Previously we have reported that the expression of γ-TMT1, γ-TMT2 and γ-TMT3 in soybean seeds, in which γ-TMT3 showed significantly higher expression in soybean seeds followed by γ-TMT2 and γ-TMT1 and higher expression of γ-TMT3 is correlated with high α-toc (Vinutha et al. 2015, 2017), whereas the transcript level of γ-TMT1 was higher in soybean leaves followed by γ-TMT2 and γ-TMT3 (Fig. 1). Based on these data, γ-TMT1 and γ-TMT3 proteins were chosen for subcellular localization study in N. benthamiana.

Fig. 1.

Fig. 1

Open in a new tab

Gene expression analysis of γ-TMT isoforms in seeds and leaves of soybean. Expression level of γ-TMT isoforms were normalized with values obtained for the internal control EF1α-mRNA.Values represents the mean of three replicates ± SD. P values < 0.005 were considered to represent significant differences

Characterization of γ-TMT isoforms genes

Complete coding sequences (CDS) of γ-TMT1 and γ-TMT3 were PCR amplified (Supplementary Fig. 1a) using specific primers (Table 1) and cloned into pGEMT-Easy vector and sequenced. After confirming > 90% similarity of γ-TMT1 and γ-TMT3 with the sequences available on NCBI, these sequences were submitted to NCBI Gene Bank (MK416203 and MK416205, respectively) and subsequently sub-cloned into pCambia:35S::GFP vector (Supplementary Fig. 1b, c). The blast analysis of the both the proteins viz., γ-TMT3 and γ-TMT1 were done using NCBI BLAST tool. The results showed 100% homology of γ-TMT3 with Glycine max-γ-TMT3 to 76% for Solanum tuberosum. Whereas γ-TMT1 showed 93% similarity with Glycine max-γ-TMT and least similarity (76%) with Herraniaum bratica (Table 2), suggesting that these proteins are conserved across the species. Sequencing results revealed that the coding regions of γ-TMT1 and γ-TMT3 were strongly similar to each other, with 97% and 93% identity at the nucleotide and amino acid level, respectively. The dissimilarity (7%) in amino acid content was observed only at N-terminal region (Fig. 2), thus we speculate that the sub-cellular localization of γ-TMT1 and γ-TMT3 may be different.

Table 2.

Highest and lowest similarity of γ-TMT1 and γ-TMT3 with other plant species

Name Identity (%) Gene Crop Accession no.
TMT1 PEPTIDE 93 Gamma-tocopherolmethyltransferase Glycine max NP_001240883.1
TMT1 PEPTIDE 76 Tocopherol O-methyltransferase Herraniaum bratica XP_021282130.1
TMT3 PEPTIDE 100 Gamma-tocopherolmethyltransferase Glycine max NP_001240883.1
TMT3 PEPTIDE 76 Gamma-tocopherolmethyltransferase Solanumtuberosum ABE41795.1
Open in a new tab

Fig. 2.

Fig. 2

Open in a new tab

Domain analysis of γ-TMT isoforms and in silico signal peptide prediction: a γ-TMT1 protein showing signal peptide from 1 to 23 amino acid (blue colour) and methyl transferase type II domain from 79–177 amino acid (red colour); b γ-TMT3 showing signal peptide from 1 to 39 amino acid (blue colour) and methyl transferase type II domain from 85 to 183 amino acid (red colour) using InterPro and ProtComp tool; c sequence of γ -TMT1 and γ-TMT3 showing difference in amino acid content at N-terminal region are indicated by red box

In silico characterization of N-terminal region of γ-TMT1 and γ-TMT3

From previous results it was shown that γ-TMT isoforms differ by NH-2 domain which represents localization signals (Vinutha et al. 2015). Sub-cellular localization for γ-TMT1 and γ-TMT3 were identified by ProtComp Version 9.0 tool (https://linux1.softberry.com) and the results showed the presence of cTPs in γ-TMT1 (1–23) and γ-TMT3 (1–39) (Fig. 2a and b). In general cTPs have the strong prevalence of small hydrophobic residue at position 1 (A, V, M, T), Position 2 (A, S, V, L) and at position 3 (S, T, A, V, T) of chloroplast-encoded proteins (Zybailov et al. ; 2008). Although in silico analysis by ProtComp Version 9.0 predicted both the proteins having cTPs, the prevalence of small hydrophobic amino acid residue at N-terminal region namely Met at 1st position, Ser at second position and Val at third position was found to be present only in γ-TMT3 protein (Fig. 2c), however, the prevalence of hydrophobic amino acids at the similar positions of γ-TMT1 protein were not found, thus strongly indicating that γ-TMT3 protein is chloroplastic. Further, the properties of transit peptide (NH2-domain consisting 1–30 amino acids) were analyzed using peptide 2.0 and it was found that γ-TMT3 were less acidic as compared to γ-TMT1 (Table 3). Similar kind of studies have shown that transit peptides either have decreased content or lack of acidic residue (Patron and Waller 2007; Sakamoto et al. 2008). Few studies also have shown that, Asn-glycosylation at asn-x-ser/thr signature sequence of NH2-domain of transit peptide led to chloroplastic localization (Frigerio et al. 1998; Lehtimäki et al. 2014). In this current study, analysis of NH2-domain by Protter tool revealed the presence of N glyco-motif (asn-glu-ser) in γ-TMT3, but not in γ-TMT1 (Fig. 3). This result thus suggests that, γ-TMT3 protein is predominately localized in chloroplast. However, transit peptides do not show obvious conserved sequences and they are rather similar with mitochondrial targeting signals and in such cases in silico approaches cannot fully predictable (Richly and Leister 2004). Therefore in vivo validation of γ-TMT1 and γ-TMT3 localization was carried out.

Table 3.

Properties of signal peptides of γ-TMT1 and γ-TMT3 (1–30 amino acids)

Property γ-TMT1 (%) γ-TMT3 (%)
Hydrophobicity 30 30
Acidic 25 20
Basic 20 20
Open in a new tab

Fig. 3.

Fig. 3

Open in a new tab

Graphical representation of the presence of N glyco-motif only in γ-TMT3 (b) not inγ-TMT1 (a), this motif was predicted using Protter custom sequence analysis tool

Sub-cellular localization of γ-TMT1 and γ-TMT3 proteins

In vivo sub-cellular localization of γ-TMT1 and γ-TMT3 proteins was carried out using confocal microscopy. To prepare the constructs, the full length coding region (excluding stop codon) of γ-TMT1 and γ-TMT3 was cloned downstream to mGFP coding region driven by 35S promoter. The resulting fusion construct of 35S::GFP:γ-TMT1 and 35S::GFP:γ-TMT3 were co-transformed into Agrobacterium cells (EHA105) along with the vector containing mRFP gene and expressed transiently in N. benthamiana leaves. At 5th day of post agro-infiltration, GFP fused γ-TMT1 and γ-TMT3 proteins were visualized using confocal laser scanning by tracing GFP signals. Three independent infiltrated leaf spots were used for visualizing fused 35S::GFP:γ-TMT1 and 35S::GFP:γ-TMT3 signals and all the three independent leaf spots showed identical subcellular localization. The green fluorescence in Fig. 4a, d, g and 4b, e, h represented the fluorescence from only GFP and mRFP vectors, respectively. To determine the localization of 35S::GFP:γ-TMT1 and 35S::GFP:γ-TMT3 in the infiltrated leaves, fluorescence of GFP fused γ-TMT1 and γ-TMT3 protein was overlaid with red fluorescence of mRFP. The infiltrated leaves with 35S::GFP:γ-TMT3 construct showed GFP signal both in chloroplasts and cytosol. Whereas the leaves infiltrated with 35S::GFP:γ-TMT1 construct showed GFP signal in cytosol and found that fluorescence did not merge with red auto-fluorescence of chloroplasts (Fig. 4 g, h and i). Thus these results showed that γ-TMT3 was localized both in chloroplast and cytosol, whereas γ-TMT1 was in cytoplasm only, explaining direct involvement of γ-TMT3 in toc biosynthesis pathway for the synthesis of α-toc in the chloroplasts. The role of tocopherol in protection of chloroplast membrane from reactive oxygen species (ROS) is well known. However, in our study cytosolic presence of both the proteins indicates their role in physiological processes for example studies have revealed that, some of the ROS species like singlet oxygen (1O2) can able to diffuse into cytosol from the chloroplast (Skovsen et al. 2005; Sies and Menck 1992). These studies supports our data of cytosolic localization of the both γ-TMT1 and γ-TMT3 proteins, which explains the importance of tocopherol to inhibit the damaging effects caused by ROS in the cytosol and protects the cell membrane from plant oxidative stresses.

Fig. 4.

Fig. 4

Open in a new tab

Subcellular distribution of GFP fused γ-TMT isoforms in epidermal cells of Nicotiana benthamiana leaves. a–c Transient expression of pCambia::GFP fluorescent protein; d–f transient expression of 35S::GFP:γ-TMT1 fluorescent protein; g–i transient expression of 35S::GFP:γ-TMT3 fluorescent protein; images labeled a, d, g representing GFP fluorescence; b, e, h are chlorophyll auto fluorescence; c, f, i are overlapping of GFP fluorescence and chlorophyll auto fluorescence. Scale bars are 50 μm. Transient expression of above mentioned proteins were visualized in Nicotiana benthamiana leaves at 5th day of agro-infiltration

Estimation of tocopherol in agro-infiltrated leaves

To validate localization of γ-TMT3 in chloroplasts, the chloroplasts from the leaves of agro-infiltrated N. benthamiana were isolated and compositions of tocs were analyzed through HPLC. The results revealed the higher levels of α-toc in the chloroplast of agro-infiltrated leaves with 35S::GFP:γ-TMT3 than that of mock and 35S::GFP:γ-TMT1 agro-infiltrated leaves (Fig. 5). The toc pool contained more amount of α-toc i.e. up to 98% (39.1 µg g−1) of total toc (40 µg g−1) in chloroplasts from leaves of N. benthamiana infiltrated with 35S:GFP::γ-TMT3 whereas, the chloroplasts isolated from the leaves agro-infiltrated with 35S::GFP and 35S:GFP::γ-TMT1 constructs showed 90% (36 µg g−1) and 92% (36.8 µg g−1) of α-toc, respectively (Fig. 5 a and b). Thus our results showed direct positive correlation between γ-TMT3 protein and α-toc accumulation in chloroplast cell. Ghimire et al. (2011) observed 81-fold increases in the α-toc in the leaves of Perilla frutescens transgenic overexpressed with γ-TMT. Similar kinds of results were reported in γ-TMT overexpressed Arabidopsis thaliana transgenic plants were found to be containing 80-fold increase in seed α-toc levels (Shintani and DellaPenna 1998). Many other studies showed over-expression of γ-TMT cause an increase of sixfold in α-toc level in Brassica juncea (Brown mustard) (Yusuf and Sarin 2007), twofold in Lactuca sativa (lettuce) (Cho et al. 2005) and Glycine max (10.4- and 3.3-fold) (Tavva et al. 2007).

Fig. 5.

Fig. 5

Open in a new tab

HPLC chromatogram showing composition of tocopherol content in extracted chloroplast cells from leaves of Nicotiana benthamiana; a control (mock), b transiently expressed 35S::GFP:γ-TMT1; c transiently expressed 35S::GFP:γ-TMT3

Conclusion

Herein we reported is the sub-cellular localization of GFP fused γ-TMT protein isoforms viz, γ-TMT1 and γ-TMT3 from model plant Nicotiana benthamiana using confocal microscopy. Our results clearly showed that, γ-TMT1 is localized in cytosol and γ-TMT3 is localized both in cytosol and chloroplast. Further, we also had shown the highest amount of α-toc accumulation in the isolated chloroplasts in infiltrated leaves with 35S::GFP:γ-TMT3 construct in comparison with infiltrated leaves with 35S::GFP:γ-TMT1 construct and control leaves. Thus the present study of cytosolic localization of the both γ-TMT1 and γ-TMT3 proteins and chloroplastic localization of γ-TMT3 will helps to reveal the importance of γ-TMT encoded α-toc in protecting both chloroplastic and cell membrane from plant oxidative stress.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary file1 (DOCX 1778 kb) (1.7MB, docx)

Acknowledgements

The authors are thankful for financial support mainly from DST-SERB, Receipt Number-No. SB/389 YS/LS-100/2013 and also thankful for great support from ICAR- IARI Fund.

Compliance with ethical standards

Conflict of interest

All the authors whose names are listed just belowthe manuscript title clearly certify that they have NO involvement in or affiliations with organization or entity with any type of financial or non-financial interest in the subject matter or materials described or discussed in this current manuscript.

Contributor Information

Shelly Praveen, Email: shellypraveen@hotmail.com.

T. Vinutha, Email: vinuthabiochem@gmail.com

References

  1. Arun M, Subramanyam K, Theboral J, Sivanandhan G, Rajesh M, Dev GK, Ganapathi A. Transfer and targeted overexpression of γ-tocopherol methyltransferase (γ-TMT) gene using seed-specific promoter improves tocopherol composition in Indian soybean cultivars. Appl Biochem Biotechnol. 2014;172(4):1763–1776. doi: 10.1007/s12010-013-0645-9. [DOI] [PubMed] [Google Scholar]
  2. Azzi A, Stocker A. Vitamin E: non-antioxidant roles. Prog Lipid Res. 2000;39(3):231–255. doi: 10.1016/s0163-7827(00)00006-0. [DOI] [PubMed] [Google Scholar]
  3. Bergmüller E, Porfirova S, Dörmann P. Characterization of an Arabidopsis mutant deficient in γ-tocopherol methyltransferase. Plant Mol Biol. 2003;52(6):1181–1190. doi: 10.1023/b:plan.0000004307.62398.91. [DOI] [PubMed] [Google Scholar]
  4. Botha FC, Black KG. Sucrose phosphate synthase and sucrose synthase activity during maturation of internodal tissue in sugarcane. Funct Plant Biol. 2000;27(1):81–85. [Google Scholar]
  5. Bruce BD. Chloroplast transit peptides: structure, function and evolution. Trends Cell Biol. 2000;10(14):40–447. doi: 10.1016/s0962-8924(00)01833-x. [DOI] [PubMed] [Google Scholar]
  6. Chen DF, Zhang M, Wang YQ, Chen XW. Expression of γ-tocopherol methyltransferase gene from Brassica napus increased α-tocopherol content in soybean seed. Biol Plant. 2012;56(1):131–134. [Google Scholar]
  7. Cho EA, Lee CA, Kim YS, Baek SH, Reyes BG, Yun SJ. Expression of γ-tocopherol methyltransferase transgene improves tocopherol composition in lettuce (Latuca sativa L.) Mol Cells. 2005;19(1):16–22. [PubMed] [Google Scholar]
  8. DellaPenna D, Pogson BJ. Vitamin synthesis in plants: tocopherols and carotenoids. Annu Rev Plant Biol. 2006;57:711–738. doi: 10.1146/annurev.arplant.56.032604.144301. [DOI] [PubMed] [Google Scholar]
  9. DellaPenna D. A decade of progress in understanding vitamin E synthesis in plants. J Plant Physiol. 2005;162:729–737. doi: 10.1016/j.jplph.2005.04.004. [DOI] [PubMed] [Google Scholar]
  10. Drevon CA. Absorption, transport and metabolism of vitamin E. Free Radic Res Commun. 1991;14(4):229–246. doi: 10.3109/10715769109088952. [DOI] [PubMed] [Google Scholar]
  11. Dwiyanti MS, Yamada T, Sato M, Abe J, Kitamura K. Genetic variation of γ-tocopherol methyltransferase gene contributes to elevated α-tocopherol content in soybean seeds. BMC Plant Biol. 2011;11(1):152. doi: 10.1186/1471-2229-11-152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Frigerio L, de Virgilio M, Prada A, Faoro F, Vitale A. Sorting of phaseolin to the vacuole is saturable and requires a short C-terminal peptide. Plant Cell. 1998;10(6):1031–1042. doi: 10.1105/tpc.10.6.1031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fryer MJ. The antioxidant effects of thylakoid vitamin E (α-tocopherol) Plant Cell Environ. 1992;15(4):381–392. [Google Scholar]
  14. Ghimire BK, Seong ES, Lee CO, Lim JD, Lee JG, Yoo JH, Chung IM, Kim NY, Yu CY. Enhancement of alpha-tocopherol content in transgenic Perilla frutescens containing the gamma-TMT gene. Afr J Biotechnol. 2011;10:2430–2439. [Google Scholar]
  15. Guo J. Overexpression of VTE1 from Arabidopsis resulting in high vitamin E accumulation and salt stress tolerance increase in tobacco plant. Chin J Appl Environ Biol. 2006;12(4):468. [Google Scholar]
  16. Hass CG, Tang S, Leonard S, Traber MG, Miller JF, Knapp SJ. Three non-allelic epistatically interacting methyltransferase mutations produce novel tocopherol (vitamin E) profiles in sunflower. Theor Appl Genet. 2006;113(5):767–782. doi: 10.1007/s00122-006-0320-4. [DOI] [PubMed] [Google Scholar]
  17. Horvath G, Wessjohann L, Bigirimana J, Jansen M, Guisez Y, Caubergs R, Horemans N. Differential distribution of tocopherols and tocotrienols in photosynthetic and non-photosynthetic tissues. Phytochemistry. 2006;67(12):1185–1195. doi: 10.1016/j.phytochem.2006.04.004. [DOI] [PubMed] [Google Scholar]
  18. Hosomi A, Arita M, Sato Y, Kiyose C, Ueda T, Igarashi O, Inoue K. Affinity for α-tocopherol transfer protein as a determinant of the biological activities of vitamin E analogs. FEBS Lett. 1997;409(1):105–108. doi: 10.1016/s0014-5793(97)00499-7. [DOI] [PubMed] [Google Scholar]
  19. Hofius D, Hajirezaei MR, Geiger M, Tschiersch H, Melzer M, Sonnewald U. RNAi-mediated tocopherol deficiency impairs photoassimilate export in transgenic potato plants. Plant Physiol. 2004;135:1256–1268. doi: 10.1104/pp.104.043927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jin S, Daniell H. Expression of γ-tocopherol methyltransferase in chloroplasts results in massive proliferation of the inner envelope membrane and decreases susceptibility to salt and metal-induced oxidative stresses by reducing reactive oxygen species. Plant Biotechnol J. 2014;12(9):1274–1285. doi: 10.1111/pbi.12224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lee DW, Lee S, Lee GJ, Lee KH, Kim S, Cheong GW, Hwang I. Functional characterization of sequence motifs in the transit peptide of Arabidopsis small subunit of rubisco. Plant Physiol. 2006;140(2):466–483. doi: 10.1104/pp.105.074575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lehtimäki N, Koskela MM, Dahlström KM, Pakula E, LintalaM SM, Hippler M, Hanke GT, RokkaA BN, Salminen TA. Posttranslational modifications of FERREDOXIN-NADP+ OXIDOREDUCTASE in Arabidopsis chloroplasts. Plant Physiol. 2014;166(4):1764–1776. doi: 10.1104/pp.114.249094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Leister D. Chloroplast research in the genomic age. Trends Genet. 2003;19(1):47–56. doi: 10.1016/s0168-9525(02)00003-3. [DOI] [PubMed] [Google Scholar]
  24. Lichtenthaler HK, Buschmann C, Döll M, Fietz HJ, Bach T, Kozel U, Rahmsdorf U. Photosynthetic activity, chloroplast ultrastructure, and leaf characteristics of high-light and low-light plants and of sun and shade leaves. Photosynth Res. 1981;2(2):115–141. doi: 10.1007/BF00028752. [DOI] [PubMed] [Google Scholar]
  25. López-Juez E. Plastid biogenesis, between light and shadows. J Exp Bot. 2006;58(1):11–26. doi: 10.1093/jxb/erl196. [DOI] [PubMed] [Google Scholar]
  26. Mène-Saffrané L, Jones AD, DellaPenna D. Plastochromanol-8 and tocopherols are essential lipid-soluble antioxidants during seed desiccation and quiescence in Arabidopsis. Proc Natl Acad Sci. 2010;107(41):17815–17820. doi: 10.1073/pnas.1006971107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Millar AH, Whelan J, Small I. Recent surprises in protein targeting to mitochondria and plastids. Curr Opin Plant Biol. 2006;9(6):610–615. doi: 10.1016/j.pbi.2006.09.002. [DOI] [PubMed] [Google Scholar]
  28. Miras S, Salvi D, Piette L, Seigneurin BD, Grunwald D, Reinbothe C, Joyard J, Reinbothe S, Rolland N. Toc159-and Toc75-independent import of a transit sequence-less precursor into the inner envelope of chloroplasts. J Biol Chem. 2007;282(40):29482–29492. doi: 10.1074/jbc.M611112200. [DOI] [PubMed] [Google Scholar]
  29. Munné-Bosch S. The role of α-tocopherol in plant stress tolerance. J Plant Physiol. 2005;162(7):743–748. doi: 10.1016/j.jplph.2005.04.022. [DOI] [PubMed] [Google Scholar]
  30. Munné-Bosch S, Alegre L. The function of tocopherols and tocotrienols in plants. Crit Rev Plant Sci. 2002;21(1):31–57. [Google Scholar]
  31. Munné-Bosch S, Alegre L. Plant aging increases oxidative stress in chloroplasts. Planta. 2002;214(4):608–615. doi: 10.1007/s004250100646. [DOI] [PubMed] [Google Scholar]
  32. Munné-Bosch S, Schwarz K, Alegre L. Enhanced formation of α-tocopherol and highly oxidized abietane diterpenes in water-stressed rosemary plants. Plant Physiol. 1999;121(3):1047–1052. doi: 10.1104/pp.121.3.1047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Munné-Bosch S, Weiler EW, Alegre L, Müller M, Düchting P, Falk J. α-Tocopherol may influence cellular signaling by modulating jasmonic acid levels in plants. Planta. 2007;225(3):681–691. doi: 10.1007/s00425-006-0375-0. [DOI] [PubMed] [Google Scholar]
  34. Patron NJ, Waller RF. Transit peptide diversity and divergence: a global analysis of plastid targeting signals. BioEssays. 2007;29(10):1048–1058. doi: 10.1002/bies.20638. [DOI] [PubMed] [Google Scholar]
  35. Richly E, Leister D. An improved prediction of chloroplast proteins reveals diversities and commonalities in the chloroplast proteomes of Arabidopsis and rice. Gene. 2004;329:11–16. doi: 10.1016/j.gene.2004.01.008. [DOI] [PubMed] [Google Scholar]
  36. Russin WA, Evert RF, Vanderveer PJ, Sharkey TD, Briggs SP. Modification of a specific class of plasmodesmata and loss of sucrose export ability in the sucrose export defective1 maize mutant. Plant Cell. 1996;8(4):645–658. doi: 10.1105/tpc.8.4.645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sakamoto W, Miyagishima SY, Jarvis P (2008) Chloroplast biogenesis: control of plastid development, protein import, division and inheritance. Arabidopsis book 6, e0110 [DOI] [PMC free article] [PubMed]
  38. Sattler SE, Gilliland LU, Magallanes LM, Pollard M, DellaPenna D. Vitamin E is essential for seed longevity and for preventing lipid peroxidation during germination. Plant Cell. 2004;16(6):1419–1432. doi: 10.1105/tpc.021360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Schneider C. Chemistry and biology of vitamin E. Mol Nutr Food Res. 2005;49(1):7–30. doi: 10.1002/mnfr.200400049. [DOI] [PubMed] [Google Scholar]
  40. Shintani D, DellaPenna D. Elevating the vitamin E content of plants through metabolic engineering. Science. 1998;282(5396):2098–2100. doi: 10.1126/science.282.5396.2098. [DOI] [PubMed] [Google Scholar]
  41. Sies H, Menck CF. Singlet oxygen induced DNA damage. Mutat Res DNAging. 1992;275(3–6):367–375. doi: 10.1016/0921-8734(92)90039-r. [DOI] [PubMed] [Google Scholar]
  42. Skovsen E, Snyder JW, Lambert JD, Ogilby PR. Lifetime and diffusion of singlet oxygen in a cell. J Phys Chem B. 2005;109(18):8570–8573. doi: 10.1021/jp051163i. [DOI] [PubMed] [Google Scholar]
  43. Soll J, Schultz G, Joyard J, Douce R, Block MA. Localization and synthesis of prenylquinones in isolated outer and inner envelope membranes from spinach chloroplasts. Arch Biochem Biophys. 1985;238(1):290–299. doi: 10.1016/0003-9861(85)90167-5. [DOI] [PubMed] [Google Scholar]
  44. Stocker A, Azzi A. Tocopherol-binding proteins: their function and physiological significance. Antioxid Redox Signal. 2000;2(3):397–404. doi: 10.1089/15230860050192170. [DOI] [PubMed] [Google Scholar]
  45. Sun S, Zeng H, Robinson DB, Raoux S, Rice PM, Wang SX, Li G. Monodisperse mfe2o4 (m = fe, co, mn) nanoparticles. J Am Chem Soc. 2004;126(1):273–279. doi: 10.1021/ja0380852. [DOI] [PubMed] [Google Scholar]
  46. Szymańska R, Kruk J. γ-Tocopherol dominates in young leaves of runner bean (Phaseolus coccineus) under a variety of growing conditions: the possible functions of γ-tocopherol. Phytochemistry. 2008;69:2142–2148. doi: 10.1016/j.phytochem.2008.05.008. [DOI] [PubMed] [Google Scholar]
  47. Szymańska R, Kruk J. Tocopherol content and isomers' composition in selected plant species. Plant Physiol Biochem. 2008;46(1):29–33. doi: 10.1016/j.plaphy.2007.10.009. [DOI] [PubMed] [Google Scholar]
  48. Tavva VS, Kim YH, Kagan IA, Dinkins RD, Kim KH, Collins GB. Increased α-tocopherol content in soybean seed overexpressing the Perilla frutescens γ-tocopherol methyltransferase gene. Plant Cell Rep. 2007;26(1):61–70. doi: 10.1007/s00299-006-0218-2. [DOI] [PubMed] [Google Scholar]
  49. Taylor SL, Lamden MP, Tappel AL. Sensitive fluorometric method for tissue tocopherol analysis. Lipids. 1976;11(7):530–538. doi: 10.1007/BF02532898. [DOI] [PubMed] [Google Scholar]
  50. Traber MG, Sies H. Vitamin E in humans: demand and delivery. Annu Rev Nutr. 1996;16(1):321–347. doi: 10.1146/annurev.nu.16.070196.001541. [DOI] [PubMed] [Google Scholar]
  51. Van Wijk KJ. Plastid proteomics. Plant Physiol Biochem. 2004;42(12):963–977. doi: 10.1016/j.plaphy.2004.10.015. [DOI] [PubMed] [Google Scholar]
  52. Villarejo A, Burén S, Larsson S, Déjardin A, Monné M, Rudhe C, Von Heijne G. Evidence for a protein transported through the secretory pathway en route to the higher plant chloroplast. Nat Cell Biol. 2005;7(12):1224. doi: 10.1038/ncb1330. [DOI] [PubMed] [Google Scholar]
  53. Vinutha T, Bansal N, Prashat GR, Krishnan V, Kumari S, Dahuja A, Sachdev A, Rai RD. Three dimensional structure prediction and in silico functional analysis of gamma tocopherol methyl transferase from Glycine max. Int J Bioinform Res. 2015;6:289–299. [Google Scholar]
  54. Vinutha T, Bansal N, Kumari K, Rama Prashat G, Sreevathsa R, Krishnan V, Kumari S, Dahuja A, Lal S, Sachdev A, Praveen S. Comparative analysis of tocopherol biosynthesis genes and its transcriptional regulation in soybean seeds. J Agric Food Chem. 2017;65(50):11054–11064. doi: 10.1021/acs.jafc.7b03448. [DOI] [PubMed] [Google Scholar]
  55. Von Heijne G, Steppuhn J, Hermann SG. Domain structure of mitochondrial and chloroplast targeting peptides. Eur J Biochem. 1989;80:535–545. doi: 10.1111/j.1432-1033.1989.tb14679.x. [DOI] [PubMed] [Google Scholar]
  56. Yamaguchi-Shinozaki K, Shinozaki K. A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low temperature, or high-salt stress. Plant Cell. 1994;6:251–264. doi: 10.1105/tpc.6.2.251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yusuf MA, Sarin NB. Antioxidant value addition in human diets: genetic transformation of Brassica juncea with γ-TMT gene for increased α-tocopherol content. Transgenic Res. 2007;16(1):109–113. doi: 10.1007/s11248-006-9028-0. [DOI] [PubMed] [Google Scholar]
  58. Zybailov B, Rutschow H, Friso G, Rudella A, Emanuelsson O, Sun Q, van Wijk KJ. Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. PLoS One. 2008;3(4):1994. doi: 10.1371/journal.pone.0001994. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (DOCX 1778 kb) (1.7MB, docx)

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES