Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2020 Feb 14;94(5):e01831-19. doi: 10.1128/JVI.01831-19

Chronic Lymphocytic Choriomeningitis Infection Causes Susceptibility to Mousepox and Impairs Natural Killer Cell Maturation and Function

Pedro Alves-Peixoto a,b,c, Maria Férez a, Cory J Knudson a, Colby Stotesbury a, Carolina R Melo-Silva a, Eric B Wong a, Margarida Correia-Neves b,c, Luis J Sigal a,
Editor: Joanna L Shislerd
PMCID: PMC7022367  PMID: 31776282

Infection of adult mice with the clone 13 (CL13) strain of lymphocytic choriomeningitis virus (LCMV) is extensively used as a model of chronic infection. In this paper, we show that mice chronically infected with CL13 succumb to challenge with ectromelia virus (ECTV; the agent of mousepox) and that natural killer (NK) cells in CL13-infected mice are reduced in numbers and have an immature and partially activated phenotype but do respond to ECTV. These data may provide additional clues why humans chronically infected with certain pathogens are less resistant to viral diseases.

KEYWORDS: chronic infection, ectromelia virus, lymphocytic choriomeningitis virus, natural killer cells, poxvirus, viral pathogenesis

ABSTRACT

Chronic viral infections. like those of humans with cytomegalovirus, human immunodeficiency virus (even when under antiretroviral therapy), and hepatitis C virus or those of mice with lymphocytic choriomeningitis virus (LCMV) clone 13 (CL13), result in immune dysfunction that predisposes the host to severe infections with unrelated pathogens. It is known that C57BL/6 (B6) mice are resistant to mousepox, a lethal disease caused by the orthopoxvirus ectromelia virus (ECTV), and that this resistance requires natural killer (NK) cells and other immune cells. We show that most B6 mice chronically infected with CL13 succumb to mousepox but that most of those that recovered from acute infection with the LCMV Armstrong (Arm) strain survive. We also show that B6 mice chronically infected with CL13 and those that recovered from Arm infection have a reduced frequency and a reduced number of NK cells. However, at steady state, NK cells in mice that have recovered from Arm infection mature normally and, in response to ECTV, get activated, become more mature, proliferate, and increase their cytotoxicity in vivo. Conversely, in mice chronically infected with CL13, NK cells are immature and residually activated, and following ECTV infection, they do not mature, proliferate, or increase their cytotoxicity. Given the well-established importance of NK cells in resistance to mousepox, these data suggest that the NK cell dysfunction caused by CL13 persistence may contribute to the susceptibility of CL13-infected mice to mousepox. Whether chronic infections similarly affect NK cells in humans should be explored.

IMPORTANCE Infection of adult mice with the clone 13 (CL13) strain of lymphocytic choriomeningitis virus (LCMV) is extensively used as a model of chronic infection. In this paper, we show that mice chronically infected with CL13 succumb to challenge with ectromelia virus (ECTV; the agent of mousepox) and that natural killer (NK) cells in CL13-infected mice are reduced in numbers and have an immature and partially activated phenotype but do respond to ECTV. These data may provide additional clues why humans chronically infected with certain pathogens are less resistant to viral diseases.

INTRODUCTION

Chronic viral infections in humans, such as cytomegalovirus, human immunodeficiency virus (HIV), even under antiretroviral therapy (ART), or hepatitis C virus (HCV), are major problems to public health. Despite the widespread use of prevention strategies, the numbers of people infected with HIV or HCV continue to increase (1, 2), and even with effective new treatments that reduce viremia, people infected with HIV and HCV remain more susceptible to opportunistic infections and cancer (35). This indicates that the persistence of the virus, even at low levels, results in an immune dysfunction that prevents the proper control of other pathogens and cancer, yet the details of this immune dysfunction remain poorly understood.

Lymphocytic choriomeningitis virus (LCMV) is commonly used as a model to study acute and chronic viral infections. In adult mice, the LCMV Armstrong (Arm) strain replicates to moderate levels and is cleared in about a week by effective T-cell responses. In contrast, the LCMV clone 13 (CL13) strain, a mutant variant of Arm, causes chronic infection (6). It has been shown that CL13 replicates to high levels in dendritic cells (DCs), causing the functional exhaustion and/or deletion of virus-specific T cells. The consequence of a lack of virus control by the T cells is viral persistence (7). Virus is found in serum and other tissues at variable levels as late as 80 days postinfection (dpi) or more and is found indefinitely in the kidneys and the central nervous system (815). Of note, virus-specific T-cell exhaustion (7, 16, 17) also occurs during HIV and HCV infection and cancer progression in humans (18, 19), demonstrating the translation usefulness of the CL13 model.

The orthopoxvirus ectromelia virus (ECTV) is a natural pathogen of the laboratory mouse whose biological route of entry is through microabrasions of the skin, mostly in the footpad, from which it disseminates systemically and infects the liver and the spleen (20). After natural infection or experimental inoculation in the footpad, the outcome of ECTV infection is genetically controlled. Susceptible strains of mice, such as BALB/c and DBA/2 mice, succumb to mousepox (the mouse homolog of human smallpox) due to uncontrolled viral replication in the liver, while resistant strains, such as C57BL/6 (B6) mice, survive with almost no signs of disease because they delay virus spread and better control virus replication in the liver and spleen (20, 21). Many immune mechanisms contribute to this resistance, including natural killer (NK) cells and T cells (21), yet the effect of chronic viral infection on the resistance of B6 mice to ECTV has not been studied.

NK cells are lymphocytes of the innate immune system that serve as a first line of defense against certain viral infections and tumors (2227). For example, NK cell-deficient humans become sick or succumb to normally non-life-threatening infections with human cytomegalovirus (HCMV) or varicella-zoster virus (28, 29). In addition, B6 mice, which are normally resistant to mouse cytomegalovirus (MCMV) and ECTV, become susceptible when NK cells are depleted (3032).

After maturing in the bone marrow (BM), NK cells enter the circulation and migrate to lymphoid and nonlymphoid tissues, where they may be present at relatively low numbers, acting as early sentinels of infection. During infection, additional NK cells are recruited to tissues from the circulation and become activated by cytokines and/or by virus-induced changes in infected cells, such as the downregulation of major histocompatibility complex (MHC) class I (MHC-I) molecules and/or the upregulation of NK cell-activating ligands (33). Activation triggers NK cell effector functions, such as the production of interferon gamma (IFN-γ) and the ability to kill virus-infected cells, by releasing granules that contain perforin and granzymes, such as granzyme B (GzmB) (25, 3437), which help control viruses. In addition to their role in virus control, NK cells are also important for the control of many tumors (22, 3740).

NK cells develop in the BM from a common lymphoid progenitor (CLP). As CLPs develop into NK cell-committed progenitors (NKPs), they express the receptor β chain for interleukin-15 (IL-15), a cytokine that is essential for NK cell maturation, and the tumor necrosis family receptor CD27, a marker of NK cell intermediate maturation (4143). NKPs continue to mature into NK cells by first expressing the activating receptor NK1.1 (NK1.1+), followed by NKp46 and then the integrin CD49b and the Ly49 family of inhibitory and activating receptors (43, 44). These NK cells, which are CD27+ CD11b and which are referred to as R1 NK cells (41), do not have effector functions and express high levels of the chemokine receptor CXCR3. R1 NK cells further mature to express the integrin CD11b and intermediate levels of CXCR3 to become R2 NK cells (CD27+ CD11b+) which already have a functional capacity, mainly the ability to produce IFN-γ (41). Finally, R2 NK cells lose the surface expression of CD27 and CXCR3 to become fully mature R3 NK cells (CD27 CD11b+), which have the strongest cytolytic capacity and which acquire the inhibitory receptor KLRG1 when mature; hence, they have a slower turnover (45). Of note, R3 NK cells are important for the control of ECTV infection and the survival of B6 mice after ECTV infection (26).

It has been shown that during the acute phase of Arm and CL13 infection, NK cells are more mature in infected mice than in uninfected controls, as determined by an increase in the frequencies of CD11b+ KLRG1+ cells. At this stage, NK cells are also more cytolytic in vitro, with a corresponding increase in the production of GzmB (46, 47). It has also been shown that soon after Arm is cleared and when infection with CL13 becomes chronic, the frequencies of NK cells and their expression of GzmB decrease (47), yet the long-term impact of cleared acute Arm infection and chronic CL13 infection in the development of NK cells and their ability to respond to other infections has not been fully investigated.

In this report, we show that ECTV is mostly lethal to mice chronically infected with CL13 but not to mice that have recovered from Arm infection. We also show that mice recovered from Arm infection and those chronically infected with CL13 have reduced frequencies of NK cells in several organs. Notably, mice that have recovered from Arm infection have NK cells that mature normally, proliferate, become activated, and increase their cytotoxicity in vivo in response to ECTV infection. On the contrary, NK cells in mice chronically infected with CL13 are immature, have a phenotype consistent with intermediate activation, and do not proliferate, become more activated, or increase their cytotoxicity in vivo following ECTV infection. Thus, in addition to T-cell exhaustion, long-term exposure to the chronically infected environment promotes an NK cell dysfunction that, together with CD8 T-cell dysfunction (78), can potentially contribute to the high susceptibility of CL13-infected mice to lethal mousepox.

RESULTS

Chronic CL13 infection causes susceptibility to mousepox.

It is well established that young B6 mice are resistant to mousepox, and the L. J. Sigal laboratory has been working with ECTV for many years. With an interest in determining whether chronic infection or convalescence from infection with an unrelated virus affects resistance to mousepox, we established the models of chronic infection with LCMV CL13 and acute infection with LCMV Arm in the L. J. Sigal laboratory. To determine whether these models perform as expected in our hands, we first infected mice with CL13 and Arm and determined the presence of infectious virus in their kidneys using a plaque assay. We found that most mice infected with CL13 (CL13 mice) but none of those infected with Arm (Arm mice) had infectious virus in their kidneys at 8, 15, and also 35 days postinfection (dpi). On the other hand, infectious virus was not detected at any of these time points in Arm mice (Fig. 1A). Thus, in our hands, at 35 dpi, CL13 mice were chronically infected with LCMV, while Arm mice were convalescent. As expected, when previously naive (∅) B6 mice were infected with ECTV in the footpad (∅+ECTV mice), they survived, and most mice convalescent from Arm infection and infected with ECTV (Arm+ECTV mice) also survived. On the other hand, most CL13 mice infected with ECTV at 30 dpi with LCMV (CL13+ECTV mice) succumbed to mousepox at 9 to 11 dpi with ECTV (Fig. 1B), with comparatively high ECTV titers being found in the spleen (Fig. 1C). Thus, chronic CL13 infection renders B6 mice susceptible to mousepox, while convalescence from Arm infection results in an intermediate phenotype.

FIG 1.

FIG 1

Chronic CL13 infection causes susceptibility to mousepox. (A) LCMV titers in the kidneys of B6 mice at 8, 15, and 35 dpi with CL13 or Arm, as determined by plaque assay. (B) Survival of the indicated mice following ECTV infection with 5 to 10 mice per group. The results are representative of those from at least 3 independent experiments. (C) ECTV titers, determined by plaque assays, in the spleen following 7 dpi with ECTV. Each graph displays data pooled from at least 2 similar and independent experiments with 5 to 10 mice per group, with the data being shown as the mean ± SEM. *, P < 0.05; **, P < 0.01; ****, P < 0.0001.

Chronic CL13 infection causes altered anti-ECTV NK cell responses and reduced ECTV loads in the dLN.

We and others have shown that B6 mice deficient in NK cells succumb to mousepox at 9 to 11 dpi (31, 32). We have also shown that at 2 to 3 dpi with ECTV, NK cells are recruited to the draining lymph node (dLN) of B6 mice and become activated to control systemic ECTV spread (31, 32). Thus, we determined whether the susceptibility of CL13+ECTV mice to mousepox correlated with deficient NK cell responses and/or virus control in the dLN. At 30 dpi, ∅, CL13, and Arm mice were infected in the footpad with ECTV, and NK cells in the dLN and in the nondraining LN (ndLN; the popliteal LN of the uninfected limb) were analyzed 2.5 days later (32.5 dpi with LCMV, 2.5 dpi with ECTV). In the ndLN, the frequency and total numbers of NK cells and the frequency of NK cells expressing the effector molecules interferon gamma (IFN-γ) and granzyme B (GzmB) were not different between ∅+ECTV, CL13+ECTV, and Arm+ECTV mice (Fig. 2A to D). Compared to the findings for the ndLNs, the dLNs of ∅+ECTV and Arm+ECTV mice had increased frequencies and numbers of NK cells (Fig. 2B), indicating NK cell recruitment. Arm+ECTV mice recruited significantly fewer NK cells to the dLNs than ∅+ECTV mice, suggesting some impairment. On the other hand, there was no increase in the frequency or total numbers of NK cells in CL13+ECTV mice (Fig. 2B). The frequencies of IFN-γ-expressing (IFN-γ+) (Fig. 2C) and GzmB-expressing (GzmB+) (Fig. 2D) NK cells were increased in the dLNs of ∅+ECTV, CL13+ECTV, and Arm+ECTV mice compared to those in their ndLNs; however, CL13+ECTV mice had a significantly higher frequency of IFN-γ+ NK cells and a significantly lower frequency of GzmB+ NK cells than ∅+ECTV and Arm+ECTV mice, yet when ECTV titers were determined at 2.5 dpi with ECTV, CL13+ECTV mice had significantly lower ECTV titers in the popliteal draining lymph nodes (dLNs) than ∅+ECTV and Arm+ECTV mice, suggesting that the inflammation induced by chronic infection or the IFN-γ produced by the NK cells contributed to the initial control of ECTV in the footpad or the dLNs (Fig. 2E). Thus, these experiments were inconclusive because it was not possible to distinguish if NK cells in CL13+ECTV mice were intrinsically different or whether their anti-ECTV response was different because the ECTV titers in their dLNs were lower.

FIG 2.

FIG 2

Chronic CL13 infection causes altered anti-ECTV NK cell responses and reduced ECTV loads in the dLNs. (A) Flow cytometry dot plots representing the gating strategy utilized for the definition of NK cells. SSC-W, side scatter width; SSC-H, side scatter height; SSC-A, side scatter area; FSC-H, forward scatter height; FSC-A, forward scatter area. Numbers inside flow cytometry plots indicate the frequency of the gated population. (B) NK cell (TCR-β negative [TCR-β], NK1.1+) frequency and calculated total numbers in the popliteal lymph nodes (ndLNs and dLNs) of the indicated groups of mice. (C and D) Frequency of IFN-γ+ (C) and GzmB+ (D) NK cells (TCR-β, NK1.1+) in the popliteal lymph nodes (ndLNs and dLNs) of the indicated groups of mice. (E) ECTV titers, determined by plaque assays, in the dLNs. All data were collected at 2.5 dpi with ECTV. Each graph displays data pooled from at least 2 similar and independent experiments with 5 to 10 mice per group, with the data showing the mean ± SEM. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

LCMV infection decreases NK cell frequency and numbers for an extended time.

In addition to the dLN response, we and others have previously shown that at 5 dpi with ECTV, NK cells proliferate and become activated in the spleens and livers of B6 mice, helping control ECTV until the T-cell response becomes sufficiently strong (31, 32). Thus, we hypothesized that LCMV could be affecting NK cells and their response to ECTV in the spleen. ECTV titers in the spleen at 5 dpi with ECTV were similar in ∅+ECTV and CL13+ECTV mice and somewhat elevated in Arm+ECTV mice (Fig. 3A), indicating similar early systemic spread in ∅+ECTV and CL13+ECTV mice, despite early reduced loads in the dLNs of CL13+ECTV mice. Thus, we next focused on the frequency and the total number of NK cells in the spleens of mice infected only with LCMV or with LCMV and ECTV. The frequencies and total numbers of NK cells in the spleen were reduced at 8, 15, and 35 dpi in CL13 mice and at 15 and 35 dpi in Arm mice compared to those in the spleens of ∅ mice. This indicates that LCMV infection, whether it is cleared or not, results in a long-term loss of NK cells and could explain why CL13+ECTV and Arm+ECTV mice recruited fewer NK cells to the dLN. Of note, the frequency of NK cells was also reduced in the livers and BM of CL13 and Arm mice at 35 dpi (but was significantly higher in Arm mice), indicating that the reduction in the NK cell frequencies after LCMV infection is widespread (data not shown). At 5 dpi with ECTV, ∅+ECTV mice had a significant reduction in the frequency but not in the absolute numbers of NK cells. Thus, acute ECTV infection results in a relative but not absolute reduction of NK cells in the spleen due to an increase in other cell types. On the other hand, similar to the findings for CL13 and Arm mice, CL13+ECTV and Arm+ECTV mice had a significant reduction in the frequency and/or absolute number of NK cells in the spleen (Fig. 3B). Hence, the loss of NK cells caused by LCMV was maintained upon unrelated ECTV infection.

FIG 3.

FIG 3

LCMV infection decreases NK cell frequency and numbers for an extended time. (A) ECTV titers in the spleens were determined by plaque assays at 5 dpi with ECTV. (B) Frequency and total numbers of NK cells (TCR-β, NK1.1+) in the spleens of the indicated mice following 8, 15, and 35 days of LCMV infection and 5 dpi with ECTV. Each graph displays data pooled from at least 2 similar and independent experiments with 6 to 10 mice per group, with the data being shown as the mean ± SEM. *, P < 0.05; **, P < 0.01; ****, P < 0.0001.

Chronic CL13 infection impairs NK cell maturation.

Given the findings that NK cells are reduced in numbers in the spleens of CL13, Arm, CL13+ECTV, and Arm+ECTV mice but that most CL13+ECTV mice succumb while most Arm+ECTV mice survive, we looked at NK cells in the spleen in more detail. First, we determined the maturation of NK cells in different groups of mice using CD27 and CD11b as markers (Fig. 4A). Compared to the frequency in ∅ mice, CL13 and Arm mice at 8 dpi had an increased frequency of mature R3 NK cells (P ≤ 0.0001) and a decreased frequency of intermediate R2 NK cells (P ≤ 0.01 and P ≤ 0.0001, respectively), with no changes in the frequency of immature R1 NK cells being found between ∅ mice and CL13 and Arm mice. This suggests that acute LCMV infection induces R2 NK cell maturation. However, at 15 and 35 dpi with LCMV, CL13 mice had an increased frequency of R1 NK cells (P ≤ 0.01) and a decreased frequency of R2 NK cells compared to those in ∅ mice (P ≤ 0.001 and P ≤ 0.0001, respectively). The frequency of mature R3 NK cells was also reduced at 35 dpi (P ≤ 0.01). In contrast, in Arm mice the frequency of R2 and R3 NK cells at 15 dpi with LCMV remained decreased (P ≤ 0.0001) and increased (P ≤ 0.01), respectively, and the frequencies of both returned to normal at 35 dpi with LCMV. These data indicate that after the increase in maturation induced by the acute phase of LCMV infection, NK cells gradually return to their basal maturation status in mice that eliminate the virus (Arm mice) but do not mature properly in mice that become chronically infected (CL13 mice). Supporting this observation, we also found a significant increase in the frequency of immature R1 NK cells and a decrease in the frequency of intermediate R2 NK cells in the liver and BM of CL13-infected mice (data not shown).

FIG 4.

FIG 4

Chronic CL13 infection impairs NK cell maturation. (A) NK cells (TCR-β, NK1.1+) in the spleen at the indicated time points according to their expression of CD11b and CD27, with the frequencies of the R1 (CD11b CD27+), R2 (CD11b+ CD27+), and R3 (CD11b+ CD27) NK cell subpopulations being shown. (B) NK cells in the spleen according to their expression of CXCR3. (C) As described in the legend to panel B but for Ly49H expression. (D) As described in the legend to panel B but for Ly49C/I expression. (E) As described in the legend to panel B but for NKG2A expression. (F) MFI of NKG2D in NK cells in the spleens of the indicated mice. All data were collected at 5 dpi with ECTV or at the indicated time points for LCMV infection. The graphs display the results of at least 2 similar and independent experiments, each with 6 to 10 mice per group. Data are shown as the mean ± SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

We also analyzed the effects of CL13 and Arm infection on NK cell maturation in mice that were infected with ECTV at 35 dpi with LCMV and with ECTV at 5 dpi (35 dpi with LCMV). ∅+ECTV mice had a significant decrease in the frequency of R1 NK cells (P ≤ 0.01) and an increase in the frequency of R2 NK cells (P ≤ 0.0001) compared to their frequencies in ∅ mice. Similarly, at 35 dpi, Arm+ECTV mice had a significant decrease in the frequency of R1 NK cells (P ≤ 0.01) and an increase in the frequency R2 NK cells (P ≤ 0.0001) compared to the frequencies in Arm mice. Thus, ECTV infection promotes the expansion of R2 NK cells in previously naive mice and in mice that cleared LCMV. In contrast, the frequencies of the different NK cell subsets were similar in CL13 mice (at 35 dpi) and CL13+ECTV mice (Fig. 4A). This suggests that chronic infection with LCMV inhibits the expansion of R2 NK cells induced by ECTV.

CXCR3 is the receptor for the chemokines CXCL9 and CXCL10 and is important for the recruitment of NK cells to the dLNs in ECTV-infected mice (48). Also, CXCR3 is expressed at higher levels at the surface of immature R1 NK cells than at the surface of the more mature R2 and R3 NK cells (45, 49). We found that, coinciding with the higher frequencies of immature R1 NK cells, CL13 mice but not Arm mice at 35 dpi had higher frequencies of CXCR3+ NK cells than ∅ mice. Moreover, when ∅, CL13, and Arm mice were infected with ECTV at 35 dpi and analyzed at 5 dpi with ECTV, CL13+ECTV mice did not show a decrease in the frequency of CXCR3+ cells, while ∅+ECTV and Arm+ECTV mice did (Fig. 4B). This is consistent with the observation that the NK cells in ∅+ECTV and Arm+ECTV mice but not those in CL13+ECTV mice mature in response to ECTV infection.

Members of the Ly49 family of activating and inhibitory receptors bind MHC class I and are stochastically expressed at the surface of NK cells, beginning their expression before NK cells become fully mature (33). We found that starting at 15 dpi with LCMV, NK cells in the spleens of CL13 mice and also, to a lesser extent, those of Arm mice had a significant decrease in the frequency of NK cells expressing activating Ly49H. This decrease was maintained after ECTV infection in CL13+ECTV mice but not in Arm+ECTV mice. ∅+ECTV mice did not show alterations in Ly49H expression (Fig. 4C). The frequency of NK cells expressing inhibitory Ly49C/I was reduced in CL13 and Arm mice starting at 8 dpi. This reduction was maintained in CL13+ECTV and Arm+ECTV mice, but in this case, ∅+ECTV mice also had a reduced frequency if Ly49C/I-expressing (Ly49C/I+) NK cells, yet CL13+ECTV mice but not Arm+ECTV mice had a significantly lower frequency of Ly49C/I than ∅+ECTV mice (Fig. 4D). Thus, CL13 and Arm infection reduces the frequency of NK cells expressing activating Ly49H and inhibitory Ly49C/I receptors for prolonged times. However, after ECTV infection, the effects of LCMV are maintained in mice chronically infected with CL13 but not in those that have recovered from Arm infection. Reduced frequencies of Ly49H-expressing (Ly49H+) and Ly49C/I+ NK cells were also observed in the livers and BM of CL13 mice (data not shown).

CD94 forms inhibitory heterodimers with NKG2A and activating heterodimers with NKG2C and NKG2E, all of which bind to the nonclassical MHC class I molecule Qa-1b (50, 51). In ∅ B6 mice, CD94-NKG2A heterodimers are stochastically expressed by ∼50% of NK cells, as determined by staining with NKG2A- and/or CD94-specific monoclonal antibodies (MAbs), and their expression begins early during NK cell development (50, 51). Expression of NKG2C and NKG2E is difficult to determine because the MAb that stains NKG2C and NKG2E, MAb 20D5, also stains NKG2A. We previously showed that mice deficient in CD94 are susceptible to mousepox due to NK cell deficiencies (52), and others showed that mice deficient in NKG2A are also susceptible to mousepox but that the susceptibility is due to the antigen-induced cell death of virus-specific CD8 T cells (53). Thus, we analyzed the effects of LCMV infection on CD94-NKG2 expression. Using the NKG2A MAb 16A11, we found that at 35 dpi with LCMV there were significantly higher frequencies of NKG2A+ NK cells in CL13 and Arm mice than in ∅ mice. At 5 dpi with ECTV (35 dpi with LCMV), CL13+ECTV mice but not Arm+ECTV mice had a higher frequency of NKG2A+ NK cells than ∅+ECTV mice (Fig. 4E). Identical results were obtained with the anti-CD94 MAb 18d3 and anti-NKG2A/C/E MAb 20D5 (data not shown), suggesting that most of the staining was due to inhibitory NKG2A. Thus, CL13 and Arm infection increase the frequency of NK cells expressing inhibitory CD94-NKG2A for prolonged times. However, after ECTV infection, the effects of LCMV are maintained in mice chronically infected with CL13 but not in those that have recovered from Arm infection.

NKG2D forms an activating homodimer that binds to MHC-I like molecules, such as RAE-1 and MULT1, which are induced in cells by viral infections or stress (54). Despite its name, NKG2D is structurally distinct from NKG2A/C/E (55). Previously, we showed that NK cells increase the expression of NKG2D after ECTV infection and that NKG2D is required for resistance to mousepox (32). Thus, we analyzed the effects of LCMV infection on NKG2D expression. We found that at 35 dpi with LCMV, all NK cells in ∅, CL13, and Arm mice expressed NKG2D at similar levels, as determined from the mean fluorescence intensity (MFI), and that the MFI was similarly increased in ∅+ECTV, CL13+ECTV, and Arm+ECTV mice at 5 dpi with ECTV (35 dpi with LCMV) (Fig. 4F). Thus, LCMV infection does not affect NKG2D expression and does not disturb its upregulation following ECTV infection.

Chronic CL13 infection impairs the activation of NK cells in response to ECTV.

Next, we analyzed the effects of LCMV infection on NK cell activation by analyzing GzmB, IFN-γ, and KLRG1 expression. Compared to the findings for ∅ mice, the frequencies of GzmB+ NK cells in the spleens were highly increased in CL13 and Arm mice at 8 dpi, remained increased in CL13 mice but not in Arm mice at 15 dpi, and were still slightly but significantly increased in CL13 mice at 35 dpi. At 5 dpi with ECTV, the frequency of GzmB+ NK cells significantly increased in ∅+ECTV mice versus ∅ mice and in Arm+ECTV mice versus Arm mice but not in CL13+ECTV mice versus CL13 mice (35 dpi) (Fig. 5A). Also, the frequencies of IFN-γ+ NK cells in spleens were slightly but significantly higher in CL13 mice (P ≤ 0.05) but not in Arm mice at 35 dpi compared to those in ∅ mice. At 5 dpi with ECTV (35 dpi with LCMV), the frequency of IFN-γ+ NK cells increased significantly in all groups but was significantly less in CL13+ECTV mice than in ∅+ECTV mice (P ≤ 0.01) or Arm+ECTV mice (P ≤ 0.0001) (Fig. 5B). When we analyzed KLRG1, which is upregulated by effector NK cells, we found that the frequencies of NK cells expressing KLRG1 in spleens were significantly increased in CL13 and Arm mice at 8 dpi and decreased from the frequencies at 8 dpi compared to the frequencies in ∅ mice but were still significantly elevated compared to those in ∅ mice at 15 dpi and remained slightly but significantly elevated in CL13 mice but not in Arm mice at 35 dpi. At 5 dpi with ECTV (35 dpi with LCMV), the frequency of KLRG1-expressing (KLRG1+) cells increased significantly in ∅+ECTV mice versus ∅ mice and in Arm+ECTV mice versus Arm mice (at 35 dpi) but not in CL13+ECTV mice versus CL13 mice (at 35 dpi) (Fig. 5C). Thus, the frequency of KLRG1+ NK cells increases during the acute phase of Arm or CL13 LCMV infection, gradually decreases to basal levels in mice that eliminate LCMV (Arm), and decreases but remains slightly elevated in chronically infected mice. However, chronic CL13 infection but not previous Arm infection prevents the increase in the frequency of KLRG1+ NK cells in response to ECTV infection.

FIG 5.

FIG 5

Chronic CL13 infection impairs the activation of NK cells in response to ECTV. (A to C) Frequency of NK cells (TCR-β, NK1.1+) expressing GzmB (A), IFN-γ (B), or KLRG1 (C) in the spleens of the indicated mice. For all panels, the numbers in the flow cytometry dot plots indicate the frequency of the gated population in naive mice. All data were collected at 5 dpi with ECTV in the spleen or at the indicated time points following LCMV infection. Each graph displays data from at least 2 similar and independent experiments, each with 6 to 10 mice per group, with the data being shown as the mean ± SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Chronic CL13 infection impairs the proliferation of NK cells in response to ECTV infection.

NK cells proliferate in the spleens of mice following ECTV infection, peaking at 5 dpi (32). Thus, we also analyzed NK cell entry into the cell cycle by Ki67 staining and DNA synthesis by determination of the level of bromodeoxyuridine (BrdU) incorporation (Fig. 6A). We found that ∅ mice had few Ki67-expressing (Ki67+) NK cells. At 35 dpi with LCMV, CL13 mice but not Arm mice had a significant increase in the frequency of Ki67+ NK cells, indicating that chronic CL13 infection induces some NK cells to enter the cell cycle. Following ECTV infection, the frequency of Ki67+ NK cells significantly increased in ∅+ECTV mice versus ∅ mice, CL13+ECTV mice versus CL13 mice, and Arm+ECTV mice versus Arm mice. However, significantly fewer NK cells in CL13+ECTV mice than in ∅+ECTV and Arm+ECTV mice were Ki67+ (Fig. 6B). When BrdU was analyzed, all BrdU-expressing (BrdU+) cells in all groups were Ki67+, but only a fraction of Ki67+ cells were BrdU+, suggesting that many cells that are cycling do not synthesize DNA during the measured time frame. Few, if any, NK cells in ∅ and Arm mice and a very small but significant proportion in CL13 mice (P ≤ 0.001 by one-way analysis of variance [ANOVA] for ∅, CL13, and Arm mice) incorporated BrdU. As with Ki67, significantly more NK cells incorporated BrdU in ∅+ECTV mice than in ∅ mice and in Arm+ECTV mice versus Arm mice but not in CL13+ECTV mice versus CL13 mice. Hence, significantly fewer NK cells were BrdU+ in CL13+ECTV mice than in ∅+ECTV and Arm+ECTV mice (Fig. 6C). Of note, most (67 to 80%) of the BrdU+ NK cells were R2 NK cells (Fig. 6D), the subset that mostly expands following ECTV infection. Together, this finding indicates that the proliferation of NK cells in CL13+ECTV mice is significantly impaired.

FIG 6.

FIG 6

Chronic CL13 infection impairs the proliferation of NK cells in response to ECTV infection. (A) Representative flow cytometry dot plots of NK cells (TCR-β, NK1.1+) from the indicated mice according to their intranuclear expression of Ki67 and incorporation of BrdU, with the frequency numbers of each gated population. (B) Frequency of Ki67+ NK cells in the spleens of the indicated mice. (C) As described in the legend to panel B but for the incorporation of BrdU. (D) Representative flow cytometry dot plots of CD11b and CD27 expression in NK cells incorporating BrdU in the different mice. The CD11b and CD27 gating was obtained from the total population of NK cells in naive mice. (E) Representative flow cytometry dot plots gated on NK cells (TCR-β, NK1.1+) from the indicated mice depicting Ki67 and KLRG1 (top) and graphs showing the frequency of Ki67+ KLRG1 and Ki67+ KLRG1+ NK cells (bottom). (F) As described in the legend to panel E but for BrdU+ KLRG1 and BrdU+ KLRG1 NK cells. All data were collected at 5 dpi with ECTV in the spleen. For panels E and F, differences between different groups were tested using one-way ANOVA, followed by post hoc analysis with Tukey’s multiple-comparison test, and differences between the KLRG1 and KLRG1+ populations within each infection group were tested with multiple t tests, with correction for multiple comparisons being performed using the Holm-Sidak method. All experiments were performed after 5 dpi with ECTV in the spleen. Graphs show data pooled from at least 2 similar and independent experiments, each with 6 to 10 mice per group, with the data being shown as the mean ± SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. For all flow cytometry plots, numbers inside indicate the frequency of the gated cell population.

Next, we determined how cell proliferation relates to KLRG1 expression. We found that in ∅ and Arm mice, but not in CL13 mice, the proportion of Ki67+ KLRG1-nonexpressing (KLRG1) NK cells was higher than the proportion of Ki67+ KLRG1+ cells. In contrast, in CL13 mice, the proportions of both populations were comparable. This indicates that at the baseline, fewer activated KLRG1 cells entered the cell cycle in ∅ and Arm mice but not in CL13 mice (Fig. 6E), yet their proliferation was slow since the incorporation of BrdU within the time frame of analysis was minimal in the KLRG1 and KLRG1+ NK cells (Fig. 6F). Following ECTV infection, in ∅+ECTV and Arm+ECTV mice, NK cells that were Ki67+ or that incorporated BrdU were mostly KLRG1+ (Fig. 6E and F), whereas in CL13+ECTV mice, both populations remained as they were before ECTV infection. Together, these findings indicate that CL13 infection impairs the proliferation of NK cells.

Chronic CL13 infection abrogates the enhanced in vivo NK cell cytotoxicity induced by ECTV.

Given that NK cells in CL13 mice had residual activation and were unable to efficiently increase their activation following ECTV infection, we tested their ability to kill target cells in vivo. TAP1 is one of the components of the transporter associated with antigen presentation (TAP) heterodimer and is necessary for the transport of MHC-I to the cell surface (56). It has been shown that when transferred into wild-type (WT) B6 mice, splenocytes from Tap1-deficient (Tap1−/−) mice get rapidly rejected by NK cells (57). To test for cytotoxicity in vivo, ∅, CL13, and Arm mice at 35 dpi with LCMV and ∅+ECTV, CL13+ECTV, and Arm+ECTV mice at 35 dpi with LCMV and 5 dpi with ECTV were injected intravenously with a 1:1 mixture of splenocytes from WT and Tap1−/− mice (Fig. 7A). At 2 h postinfection, the preferential killing was determined by comparing the ratio of WT/Tap1−/− mouse splenocytes in the spleens of the different groups of mice (Fig. 7B). We found that all the groups preferentially killed NK cells from Tap1−/− mice. Even though CL13 and Arm mice had fewer NK cells, Tap1−/− splenocytes were killed in CL13 and Arm mice at the same rate as in ∅ mice, yet at 5 days after ECTV infection, the killing of Tap1−/− cells increased significantly in ECTV versus ∅ mice and in Arm+ECTV versus Arm mice but not in CL13+ECTV versus CL13 mice. Thus, ECTV infection increases the killing of Tap1−/− cells in vivo, and this effect is abrogated in mice chronically infected with CL13 but not in those that have recovered from Arm infection.

FIG 7.

FIG 7

Chronic CL13 infection abrogates the enhanced in vivo NK cell cytotoxicity induced by ECTV. (A) Experimental setup (top) and flow cytometry dot plots indicating the gating strategy applied to identify Tap1−/− CD45.2 and WT CD45.1 splenocytes transferred to the different groups of mice (bottom). (B) Representative flow cytometry dot plots of the percentage of transferred Tap1−/− CD45.2 and WT CD45.1 splenocytes (top) and percentage of specific in vivo killing of adoptively transferred Tap1−/− splenocytes in the indicated mice (bottom). For all flow cytometry plots, numbers indicate the frequency of the gated populations. Experiments were performed at 5 dpi with ECTV, and mice were euthanized at 2 h after adoptive transfer. The graph displays data from a representative experiment with 3 to 5 mice per group, and the data are representative of those from 2 independent and similar experiments. The data are shown as the mean ± SEM. **, P < 0.01; ***, P < 0.001.

DISCUSSION

In this study, we demonstrated that B6 mice chronically infected with CL13 as adults lost their intrinsic resistance to ECTV, succumbing by 9 to 11 dpi, whereas most, but not all, the mice that had recovered from Arm infection survived. We and others have shown that NK cell deficiencies and also CD8 T-cell deficiencies can be responsible for susceptibility to mousepox at these early stages of infection, while CD4 and B-cell deficiencies result in death at much later time points (5861). Thus, in the study described in this paper, we looked at the effects of chronic CL13 infection and convalescence from Arm infection on NK cells. The effect of LCMV in the anti-ECTV T-cell response is described in a separate report that will be submitted elsewhere.

To analyze the NK cell responses, we first looked in the dLNs because we have previously shown that NK cells in the dLNs contribute to survival by curbing virus spread. Even though the NK cell responses in ∅+ECTV and CL13+ECTV mice differed, the results were difficult to interpret because CL13+ECTV mice also had decreased ECTV loads at 2.5 dpi with ECTV. The reason for the reduced ECTV titers is unclear. Possibilities are reduced virus transport from the footpad to the dLNs by skin-derived dendritic cells (48), the increased amount of IFN-γ produced by the NK cells, or other unknown inflammatory conditions.

Given that the results for the dLNs were inconclusive, we also looked in the spleen, where NK cell responses normally peak at 5 dpi (31, 32) and where we found that at 5 dpi, ECTV titers were similar between ∅+ECTV and CL13+ECTV mice, indicating that any differences in antiviral NK cell responses would be due to NK cell differences and not to variances in virus loads.

When we analyzed the mice before ECTV challenge, we found that the frequencies of NK cells in CL13 and Arm mice were reduced during the acute phase of the infection, as previously reported by others (47). We also found that the frequencies and total numbers of NK cells in CL13 mice remained significantly reduced compared to those in ∅ mice. More surprising was the finding that Arm mice still had reduced frequencies and numbers of NK cells, despite the absence of virus. These data suggest that LCMV reduces NK cells for a long time and that this reduction even persists during convalescence. It is possible that these defects contributed to the few deaths from mousepox that we observed in Arm+ECTV mice.

We also found that the NK cells in CL13 mice had an immature phenotype, as indicated by an increase in the frequency of the R1 NK cell subset, to the detriment of the more mature and functional R2 and R3 subsets. Additional alterations in the NK cells in CL13 mice indicative of altered maturation were the increased frequency of CXCR3+ NK cells, the decreased frequency of NK cells with activating Ly49H and/or inhibitory Ly49C/I, and the increased frequency of inhibitory CD94/NKG2A. These defects were widespread, as similar changes were observed in the bone marrow, spleen, liver, and, to a minor extent, peripheral lymph nodes (data not shown). To mature, NK cells interact with the surrounding stroma (62). While we do not know the reason for the deficient NK cell maturation in CL13 mice, it is known that CL13 induces significant and irreversible structural changes in the spleen (63). Also, CL13 mice have infectious LCMV. Thus, we speculate that alterations in the stroma of various lymphoid tissues and/or continuous exposure to LCMV (6365) could explain the immaturity of NK cells in CL13 mice. Notably, despite their reduced numbers, the NK cells in mice that recovered from acute infection with Arm, which is no longer present at 35 dpi and which does not cause structural changes in the spleen (65), matured normally. Also important was the finding that chronic CL13 infection but not convalescence from Arm infection prevented NK cell maturation in response to secondary challenge with ECTV, suggesting that the inability of NK cells to mature may have some role in the susceptibility of CL13 mice to mousepox.

Despite their immaturity, the NK cells in CL13 mice had a relatively activated phenotype, with increased expression of GzmB, IFN-γ, and KLRG1. A recent report showed similar data regarding persistent activation but did not identify the immature phenotype. Interestingly, that report showed that the preactivated NK cells were more potent at eliminating B16 melanoma tumors than NK cells in ∅ mice, indicating that the preactivation may be beneficial to combat tumors (66). In the case of ECTV infection, this could partly explain the increased amount of IFN-γ and reduced virus titers in the dLNs at 2.5 dpi.

We also determined whether LCMV affects the cell cycle and DNA synthesis in NK cells by measurement of Ki67 expression and BrdU incorporation, respectively. Together, the two assays indicated that the NK cells in CL13 mice but not Arm mice had slightly increased basal proliferation compared with that of the NK cells in ∅ mice but that ECTV induced the strong proliferation of NK cells in ∅+ECTV and Arm+ECTV mice and much less in CL13 mice. These results are fully consistent with the partial activation of NK cells in CL13 mice and their deficient activation in CL13+ECTV mice.

Previous data demonstrated that, following in vitro stimulation with IL-2 for several days, NK cells from CL13 mice have decreased cytotoxicity against YAC-1 cells compared with that of NK cells from ∅ mice (67), which could reflect diminished intrinsic cytotoxicity or a reduced response to IL-2 stimulation. The latter seems to be the case, because it was recently shown that NK cells freshly isolated from CL13-infected mice had increased cytotoxicity against YAC-1 cells (66). Consistently, we showed that, in agreement with their increased activation and despite their reduced numbers. Moreover, despite a reduction in numbers, NK cells in CL13 mice showed levels of killing of Tap1−/− cells in vivo similar to that of NK cells in ∅ or Arm mice. However, after ECTV infection, NK cells in CL13+ECTV mice did not increase their cytotoxicity, while those in ∅+ECTV and Arm+ECTV mice did. This is consistent with the inability of NK cells in CL13+ECTV mice to further increase their activation. Altogether our data indicate that during chronic CL13 infection, NK cells fail to become full-fledged effectors in response to secondary infection.

Given the critical role of NK cells in resistance to mousepox (3032), the data presented here suggest that the NK cell dysfunction caused by persistent CL13 infection may contribute to the susceptibility of CL13-infected mice to ECTV, yet other immune defects have been found in mice chronically infected with CL13, including poor antigen presentation and decreased T cell and antibody responses (7, 63, 6871). Because, in addition to NK cells, CD8 and CD4 T cells are required to resist acute ECTV infection (26, 27, 32, 52, 59, 7275), defects in the T-cell response of mice chronically infected with CL13 could also contribute to the loss of resistance to mousepox.

It is important to note that in this study we used the well-established experimental model of high-dose intravenous inoculation of CL13 into adult mice, which produces a chronic infection that mimics many of the chronic infections that humans acquire as adults, yet in nature, chronic LCMV infection results from vertical transmission from mother to offspring (6) and infection of immunologically immature newborn mice with LCMV results in chronic infection that has selective CD8 T-cell immunosuppression for LCMV but not for other viruses (76). Therefore, future experiments could determine whether NK cell maturation, NK cell anti-ECTV responses, and resistance to mousepox are also affected in mice chronically infected with LCMV at birth.

In summary, our data indicate that, despite increased basal activation levels, chronic infection can result in impaired NK cell maturation and activation in response to secondary infections, which can contribute to increased susceptibility to secondary viral infections in chronically infected individuals.

MATERIALS AND METHODS

Mice.

All experiments were approved by the Thomas Jefferson University Institutional Animal Care and Use Committee (IACUC). The B6 wild-type and B6-CD45.1 mice were purchased from Charles River or bred in-house from breeders from Charles River. B6-CD45.1/2 mice were F1 mice from B6 and B6-CD45.1 mice. Ifnar1−/− mice (a gift from Thomas Moran, Mount Sinai School of Medicine, New York, NY) and Tap1−/− mice (The Jackson Laboratory) were bred in-house. Male and female mice 6 to 10 weeks of age were used. After infection, the animals were observed for signs of disease and distress (lethargy, ruffled hair, weight loss, skin rash, and eye secretions) and euthanized if they were unresponsive to touch or without voluntary movements.

Viruses.

LCMV CL13 and LCMV Arm were a kind gift of E. John Wherry (University of Pennsylvania, Philadelphia, PA), and they were propagated and their titers were determined according to information in the literature (6, 77). ECTV Moscow was propagated and its titers were determined as previously described (26, 27). LCMV CL13 infections were performed intravenously with 2 × 106 PFU. LCMV Arm infections were performed intraperitoneally with 2 × 105 PFU. ECTV infections were performed in the footpad with 3.0 × 103 PFU.

Quantitative reverse transcription-PCR.

evm003 viral RNA expression was measured using iTaq Universal SYBR supermix as described elsewhere (48) and analyzed using a Bio-Rad CFX96 system. The following primers were used: forward primer TCTGTCCTTTAACAGCATAGATGTAGA and reverse primer TGTTAACTCGGAAGTTGATATGGTA (48).

In vivo cytotoxicity assay of Tap1−/− cells.

Whole splenocytes were isolated from CD45.2 Tap1−/− or CD45.1 × CD45.2 B6 mice and mixed in a 1:1 ratio. Total splenocytes (1.0 × 106) were suspended in 200 μl of phosphate-buffered saline (PBS) and injected intravenously. After 2 h, the mice were euthanized and spleens were processed into single-cell suspensions. Preferential killing was calculated by considering the proportions of Tap1−/− cells/WT cells in the mixture obtained prior to the injection. To calculate specific lysis, the following formula was used: percent specific lysis = [1 − (ratio after transfer/ratio before transfer) × 100], where ratio refers to the percentage of CD45.2 to the percentage of CD45.1 cells.

Flow cytometry.

Flow cytometry was performed as previously described (26, 27). We used the following antibodies: anti-CD45.1 (clone A20, phycoerythrin [PE]-Cy7; BioLegend), anti-CD45.2 (clone 104, allophycocyanin [APC]; BioLegend) anti-NK1.1 (clone PK136, APC or Brilliant Violet 605 [BV605], BioLegend), anti-T-cell receptor beta (anti-TCR-β; clone H57-597 [BV605 or BV421; BioLegend] or clone H57-597 [BV786; BD]), anti-CD11b (clone M1/70, Brilliant Ultraviolet 395 [BUV395]; BD), anti-CD27 (clone LG.3A10, peridinin chlorophyll protein-Cy5.5; BioLegend), anti-Ly49H (clone 3D10, PE; BioLegend), anti-Ly49C/I (clone 5E6, fluorescein isothiocyanate [FITC]; BD), anti-NKG2A (clone 16A11, APC; BioLegend), anti-NKG2A/C/E (clone 20d5, BV785, BD), anti-NKG2D (clone CX5, APC; BioLegend), anti-CXCR3 (clone CXCR3-173, PE; BioLegend), anti-KLRG1 (clone 2F1/KLRG1, PE-Cy7 or APC; BioLegend), anti-granzyme B (clone GB11, Pacific Blue; BioLegend), anti-IFN-γ (clone XMG1.2, PE-Cy7; BioLegend), anti-Ki67 (clone 16A8, APC or PE; BioLegend), and anti-BrdU (clone PRB-1, FITC, eBioscience). Briefly, all organs were made into single-cell suspensions. Red blood cells were lysed with 0.84% NH4Cl, washed in Dulbecco modified Eagle medium complemented with 10% fetal bovine serum and brefeldin A (Sigma-Aldrich), and resuspended at 2.0 × 106 cells/100 μl. After 1 h of incubation, antibody 2.4G2 (anti-FcγII/III receptor; American Type Culture Collection) was added together with the stain for the extracellular molecules. After 25 min, the cells were fixed, permeabilized, and stained for 30 min for the cytoplasmic or nuclear molecules (with a BD Cytofix/Cytoperm kit and an Invitrogen fixation/permeabilization kit, respectively) according to the manufacturer’s instructions. Data were acquired with a BD LSRFortessa cytometer and analyzed with FlowJo (version 10) software (TreeStar).

BrdU incorporation assay.

Mice were intraperitoneally injected with 2 mg of BrdU (Life Technologies), and 3 h later, their spleens were collected and made into single-cell suspensions. The cells were then stained for cell surface molecules, fixed, permeabilized for nuclear molecules, incubated with RNase-free DNase (Qiagen) at 37°C for 1 h, and stained with an anti-BrdU MAb.

Statistical analysis.

Data were analyzed using Prism (version 6) software. We used a parametric unpaired t test to study the differences between 2 independent groups or one-way ANOVA test if there were more than 2 independent groups. For the post hoc analysis, we used Tukey’s multiple-comparison test. Survival curves were analyzed for statistical differences with the log-rank (Mantel-Cox) test for the comparison of survival curves. All experiments were repeated a minimum of 2 times, with similar results each time.

ACKNOWLEDGMENTS

This work was supported by grants AI065544 and AI110457 to L.J.S. P.A.-P. received a Ph.D. fellowship (fellowship PD/BD/128078/2016) from the M.D./Ph.D. Program of the University of Minho School of Medicine, funded by the Fundação para a Ciência e Tecnologia (FCT). The research reported in this publication utilized the Flow Cytometry and Laboratory Animal facilities at Sidney Kimmel Cancer Center at Jefferson Health and was supported by the National Cancer Institute of the National Institutes of Health under award number P30CA056036.

We thank Lingjuan Tang and Ni Meng for technical assistance.

P.A.-P. and L.J.S. conceived of and designed the experiments, analyzed the results, and cowrote the paper. P.A.-P. performed most of the experiments. L.J.S. conceived of the initial idea and supervised the work. M.C.-N. supervised the work and contributed intellectually. M.F., C.J.K., C.S., C.R.M.-S., and E.B.W. helped with some of the experiments.

REFERENCES

  • 1.WHO. 2017. Global hepatitis report, 2017. WHO, Geneva, Switzerland. [Google Scholar]
  • 2.UNAIDS. 2016. Global AIDS update 2016. WHO, Geneva, Switzerland. [Google Scholar]
  • 3.Schouten J, Wit FW, Stolte IG, Kootstra NA, Van Der Valk M, Geerlings SE, Prins M, Reiss P. 2014. Cross-sectional comparison of the prevalence of age-associated comorbidities, and their risk factors between HIV-infected and uninfected individuals: the AGEhIV cohort study. Clin Infect Dis 59:1787–1797. doi: 10.1093/cid/ciu701. [DOI] [PubMed] [Google Scholar]
  • 4.Shiels MS, Engels EA. 2017. Evolving epidemiology of HIV-associated malignancies. Curr Opin HIV AIDS 12:6–11. doi: 10.1097/COH.0000000000000327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chang CC, Crane M, Zhou J, Mina M, Post JJ, Cameron BA, Lloyd AR, Jaworowski A, French MA, Lewin SR. 2013. HIV and co-infections. Immunol Rev 254:114–142. doi: 10.1111/imr.12063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ahmed R, Salmi A, Butler LD, Chiller JM, Oldstone M. 1984. Selection of genetic variants of lymphocytic choriomeningitis virus in spleen of persistently infected mice. J Exp Med 60:521–540. doi: 10.1084/jem.160.2.521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wherry EJ, Blattman JN, Murali-Krishna K, van der Most R, Ahmed R. 2003. Viral persistence alters CD8 T cell immunodominance and tissue distribution and results in distinct stages of functional impairment. J Virol 77:4911–4927. doi: 10.1128/jvi.77.8.4911-4927.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Matloubian BM, Somasundaram T, Kolhekar SR, Selvakumar R, Ahmed R. 1990. Genetic basis of viral persistence: single amino acid. J Exp Med 172:2944–2951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Shin H, Blackburn SD, Blattman JN, Wherry EJ. 2007. Viral antigen and extensive division maintain virus-specific CD8 T cells during chronic infection. J Exp Med 204:941–949. doi: 10.1084/jem.20061937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fuller MJ, Khanolkar A, Tebo AE, Zajac AJ. 2004. Maintenance, loss, and resurgence of T cell responses during acute, protracted, and chronic viral infections. J Immunol 172:4204–4214. doi: 10.4049/jimmunol.172.7.4204. [DOI] [PubMed] [Google Scholar]
  • 11.Brooks DG, Trifilo MJ, Edelmann KH, Teyton L, McGavern DB, Oldstone M. 2006. Interleukin-10 determines viral clearance or persistence in vivo. Nat Med 12:1301–1309. doi: 10.1038/nm1492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wilson EB, Yamada DH, Elsaesser H, Herskovitz J, Deng J, Cheng G, Aronow BJ, Karp CL, Brooks DG. 2013. Blockade of chronic type I interferon signaling to control persistent LCMV infection. Science 340:202–207. doi: 10.1126/science.1235208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.McCausland MM, Crotty S. 2008. Quantitative PCR (QPCR) technique for detecting lymphocytic choriomeningitis virus (LCMV) in vivo. J Virol Methods 147:167–176. doi: 10.1016/j.jviromet.2007.08.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lauterbach H, Zuniga EI, Truong P, Oldstone MBA, McGavern DB. 2006. Adoptive immunotherapy induces CNS dendritic cell recruitment and antigen presentation during clearance of a persistent viral infection. J Exp Med 203:1963–1975. doi: 10.1084/jem.20060039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Korns Johnson D, Homann D. 2012. Accelerated and improved quantification of lymphocytic choriomeningitis virus (LCMV) titers by flow cytometry. PLoS One 7:e37337. doi: 10.1371/journal.pone.0037337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Stelekati E, Chen Z, Manne S, Kurachi M, Ali MA, Lewy K, Cai Z, Nzingha K, McLane LM, Hope JL, Fike AJ, Katsikis PD, Wherry EJ. 2018. Long-term persistence of exhausted CD8 T cells in chronic infection is regulated by microRNA-155. Cell Rep 23:2142–2156. doi: 10.1016/j.celrep.2018.04.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Oxenius A, Zinkernagel RM, Hengartner H. 1998. Comparison of activation versus induction of unresponsiveness of virus-specific CD4+ and CD8+ T cells upon acute versus persistent viral infection. Immunity 9:449–457. doi: 10.1016/s1074-7613(00)80628-7. [DOI] [PubMed] [Google Scholar]
  • 18.Kim PS, Ahmed R. 2010. Features of responding T cells in cancer and chronic infection. Curr Opin Immunol 22:223–230. doi: 10.1016/j.coi.2010.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Khaitan A, Unutmaz D. 2011. Revisiting immune exhaustion during HIV infection. Curr HIV/AIDS Rep 8:4–11. doi: 10.1007/s11904-010-0066-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Brownstein D, Bhatt PN, Jacoby RO. 1989. Mousepox in inbred mice innately resistant or susceptible to lethal infection with ectromelia virus. V. Genetics of resistance to the Moscow strain. Arch Virol 107:35–41. doi: 10.1007/bf01313876. [DOI] [PubMed] [Google Scholar]
  • 21.Sigal LJ. 2015. The pathogenesis and immunobiology of mousepox. Adv Immunol 129:251–276. doi: 10.1016/bs.ai.2015.10.001. [DOI] [PubMed] [Google Scholar]
  • 22.Waldhauer I, Steinle A. 2008. NK cells and cancer immunosurveillance. Oncogene 27:5932–5943. doi: 10.1038/onc.2008.267. [DOI] [PubMed] [Google Scholar]
  • 23.Mavilio D, Benjamin J, Daucher M, Lombardo G, Kottilil S, Planta MA, Marcenaro E, Bottino C, Moretta L, Moretta A, Fauci AS. 2003. Natural killer cells in HIV-1 infection: dichotomous effects of viremia on inhibitory and activating receptors and their functional correlates. Proc Natl Acad Sci U S A 100:15011–15016. doi: 10.1073/pnas.2336091100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Crome SQ, Lang PA, Lang KS, Ohashi PS. 2013. Natural killer cells regulate diverse T cell responses. Trends Immunol 34:342–349. doi: 10.1016/j.it.2013.03.002. [DOI] [PubMed] [Google Scholar]
  • 25.Waggoner SN, Cornberg M, Selin LK, Welsh RM. 2011. Natural killer cells act as rheostats modulating antiviral T cells. Nature 481:394–398. doi: 10.1038/nature10624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Fang M, Roscoe F, Sigal LJ. 2010. Age-dependent susceptibility to a viral disease due to decreased natural killer cell numbers and trafficking. J Exp Med 207:2369–2381. doi: 10.1084/jem.20100282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nair S, Fang M, Sigal LJ. 2015. The natural killer cell dysfunction of aged mice is due to the bone marrow stroma and is not restored by IL-15/IL-15Ra treatment. Aging Cell 14:180–190. doi: 10.1111/acel.12291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Biron C, Byron K, Sullivan JL. 1989. Severe herpesvirus infections in an adolescent without natural killer cells. N Engl J Med 320:1731–1735. doi: 10.1056/NEJM198906293202605. [DOI] [PubMed] [Google Scholar]
  • 29.Orange JS. 2002. Human natural killer cell deficiencies and susceptibility to infection. Microbes Infect 4:1545–1558. doi: 10.1016/s1286-4579(02)00038-2. [DOI] [PubMed] [Google Scholar]
  • 30.Bukowski JF, Woda BA, Welsh RM. 1984. Pathogenesis of murine cytomegalovirus infection in natural killer cell-depleted mice. J Virol 52:119–128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Parker AK, Parker S, Yokoyama WM, Corbett JA, Buller R. 2007. Induction of natural killer cell responses by ectromelia virus controls infection. J Virol 81:4070–4079. doi: 10.1128/JVI.02061-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Fang M, Lanier LL, Sigal LJ. 2008. A role for NKG2D in NK cell-mediated resistance to poxvirus disease. PLoS Pathog 4:e30. doi: 10.1371/journal.ppat.0040030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lindberg J, Martín-Fontecha A, Höglund P. 1999. Natural killing of MHC class I-lymphoblasts by NK cells from long-term bone marrow culture requires effector cell expression of Ly49 receptors. Int Immunol 11:1239–1245. doi: 10.1093/intimm/11.8.1239. [DOI] [PubMed] [Google Scholar]
  • 34.Faculty V. 1989. Evidence that NK cells and interferon are required for genetic resistance to lethal infection with ectromelia virus. Arch Virol 108:49–58. [DOI] [PubMed] [Google Scholar]
  • 35.Kiessling R, Klein E, Pross H, Wigzell H. 1975. “Natural” killer cells in the mouse. II. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Characteristics of the killer cell. Eur J Immunol 5:117–121. doi: 10.1002/eji.1830050209. [DOI] [PubMed] [Google Scholar]
  • 36.Welsh RM, Kiessling RW. 1980. Natural killer cell response to lymphocytic choriomeningitis virus in beige mice. Scand J Immunol 11:363–367. doi: 10.1111/j.1365-3083.1980.tb00001.x. [DOI] [PubMed] [Google Scholar]
  • 37.Waggoner SN, Reighard SD, Gyurova IE, Cranert SA, Mahl SE, Karmele EP, McNally JP, Moran MT, Brooks TR, Yaqoob F, Rydyznski CE. 2016. Roles of natural killer cells in antiviral immunity. Curr Opin Virol 16:15–23. doi: 10.1016/j.coviro.2015.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Screpanti V, Wallin RPA, Grandien A, Ljunggren HG. 2005. Impact of FASL-induced apoptosis in the elimination of tumor cells by NK cells. Mol Immunol 42:495–499. doi: 10.1016/j.molimm.2004.07.033. [DOI] [PubMed] [Google Scholar]
  • 39.Wendel M, Galani IE, Suri-Payer E, Cerwenka A. 2008. Natural killer cell accumulation in tumors is dependent on IFN-γ and CXCR3 ligands. Cancer Res 68:8437–8445. doi: 10.1158/0008-5472.CAN-08-1440. [DOI] [PubMed] [Google Scholar]
  • 40.Tu MM, Mahmoud AB, Wight A, Mottashed A, Bélanger S, Rahim MMA, Abou-Samra E, Makrigiannis AP. 2014. Ly49 family receptors are required for cancer immunosurveillance mediated by natural killer cells. Cancer Res 74:3684–3694. doi: 10.1158/0008-5472.CAN-13-3021. [DOI] [PubMed] [Google Scholar]
  • 41.Hayakawa Y, Smyth MJ. 2006. CD27 dissects mature NK cells into two subsets with distinct responsiveness and migratory capacity. J Immunol 176:1517–1524. doi: 10.4049/jimmunol.176.3.1517. [DOI] [PubMed] [Google Scholar]
  • 42.Ikawa T, Kawamoto H, Fujimoto S, Katsura Y. 1999. Commitment of common T/natural killer (NK) progenitors to unipotent T and NK progenitors in the murine fetal thymus revealed by a single progenitor assay. J Exp Med 190:1617–1625. doi: 10.1084/jem.190.11.1617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Rosmaraki EE, Douagi I, Roth C, Colucci F, Cumano A, Di Santo JP. 2001. Identification of committed NK cell progenitors in adult murine bone marrow. Eur J Immunol 31:1900–1909. doi: 10.1002/1521-4141(200106)31:6<1900::aid-immu1900>3.0.co;2-m. [DOI] [PubMed] [Google Scholar]
  • 44.Kim S, Iizuka K, Kang HP, Dokun A, French AR, Greco S, Yokoyama WM. 2002. In vivo developmental stages in murine natural killer cell maturation. Nat Immunol 3:523–528. doi: 10.1038/ni796. [DOI] [PubMed] [Google Scholar]
  • 45.Huntington ND, Tabarias H, Fairfax K, Brady J, Hayakawa Y, Degli-Esposti MA, Smyth MJ, Tarlinton DM, Nutt SL. 2007. NK cell maturation and peripheral homeostasis is associated with KLRG1 up-regulation. J Immunol 178:4764–4770. doi: 10.4049/jimmunol.178.8.4764. [DOI] [PubMed] [Google Scholar]
  • 46.Lang PA, Lang KS, Xu HC, Grusdat M, Parish IA, Recher M, Elford AR, Dhanji S, Shaabani N, Tran CW, Dissanayake D, Rahbar R, Ghazarian M, Brüstle A, Fine J, Chen P, Weaver CT, Klose C, Diefenbach A, Häussinger D, Carlyle JR, Kaech SM, Mak TW, Ohashi PS. 2012. Natural killer cell activation enhances immune pathology and promotes chronic infection by limiting CD8+ T-cell immunity. Proc Natl Acad Sci U S A 109:1210–1215. doi: 10.1073/pnas.1118834109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Cook KD, Whitmire JK. 2013. The depletion of NK cells prevents T cell exhaustion to efficiently control disseminating virus infection. J Immunol 190:641–649. doi: 10.4049/jimmunol.1202448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Wong E, Xu RH, Rubio D, Lev A, Stotesbury C, Fang M, Sigal LJ. 2018. Migratory dendritic cells, group 1 innate lymphoid cells, and inflammatory monocytes collaborate to recruit NK cells to the virus-infected lymph node. Cell Rep 24:142–154. doi: 10.1016/j.celrep.2018.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Marquardt N, Wilk E, Pokoyski C, Schmidt RE, Jacobs R. 2010. Murine CXCR3+CD27bright NK cells resemble the human CD56bright NK-cell population. Eur J Immunol 40:1428–1439. doi: 10.1002/eji.200940056. [DOI] [PubMed] [Google Scholar]
  • 50.Vance RE, Kraft JR, Altman JD, Jensen PE, Raulet D. 1998. Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical MHC class I molecule Qa-1b. J Exp Med 188:1841–1848. doi: 10.1084/jem.188.10.1841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Vance BRE, Jamieson AM, Raulet DH. 1999. Recognition of the class Ib molecule Qa-1b by putative activating receptors CD94/NKG2C and CD94/NKG2E on mouse natural killer cells. J Exp Med 190:1801–1812. doi: 10.1084/jem.190.12.1801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Fang M, Orr MT, Spee P, Egebjerg T, Lanier LL, Sigal LJ. 2011. CD94 is essential for NK cell-mediated resistance to a lethal viral disease. Immunity 34:579–589. doi: 10.1016/j.immuni.2011.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Rapaport AS, Schriewer J, Gilfillan S, Hembrador E, Crump R, Plougastel BF, Wang Y, Friec GL, Gao J, Cella M, Pircher H, Yokoyama WM, Buller RML, Colonna M. 2015. The inhibitory receptor NKG2A sustains virus-specific CD8+ T cells in response to a lethal poxvirus infection. Immunity 43:1112–1124. doi: 10.1016/j.immuni.2015.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Raulet DH, Gasser S, Gowen BG, Deng W, Jung H. 2013. Regulation of ligands for the activating receptor NKG2D. Annu Rev Immunol 121:413–441. doi: 10.1146/annurev-immunol-032712-095951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Lanier LL. 2005. NK cell recognition. Annu Rev Immunol 23:225–274. doi: 10.1146/annurev.immunol.23.021704.115526. [DOI] [PubMed] [Google Scholar]
  • 56.Van Kaer L, Ashton-Rickardt PG, Ploegh HL, Tonegawa S. 1992. TAP1 mutant mice are deficient in antigen presentation, surface class I molecules, and CD4-8+ T cells I. Cell 71:1205–1214. doi: 10.1016/S0092-8674(05)80068-6. [DOI] [PubMed] [Google Scholar]
  • 57.Bennett M, Taylor PA, Austin M, Baker MB, Schook LB, Rutherford M, Kumar V, Podack ER, Mohler KM, Levy RB, Blazar BR. 1998. Cytokine and cytotoxic pathways of NK cell rejection of class I-deficient bone marrow grafts: influence of mouse colony environment. Int Immunol 10:785–790. doi: 10.1093/intimm/10.6.785. [DOI] [PubMed] [Google Scholar]
  • 58.Karupiah G, Buller RML, Duarte CJ, Chen J, Van Rooijen N. 1996. Different roles for CD4+ and CD8+ T lymphocytes and macrophage subsets in the control of a generalized virus infection. J Virol 70:8301–8309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Fang M, Siciliano NA, Hersperger AR, Roscoe F, Hu A, Ma X, Shamsedeen AR, Eisenlohr LC, Sigal LJ. 2012. Perforin-dependent CD4+ T-cell cytotoxicity contributes to control a murine poxvirus infection. Proc Natl Acad Sci U S A 109:9983–9988. doi: 10.1073/pnas.1202143109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Fang M, Sigal LJ. 2005. Antibodies and CD8+ T cells are complementary and essential for natural resistance to a highly lethal cytopathic virus. J Immunol 175:6829–6836. doi: 10.4049/jimmunol.175.10.6829. [DOI] [PubMed] [Google Scholar]
  • 61.Chaudhri G, Panchanathan V, Bluethmann H, Karupiah G. 2006. Obligatory requirement for antibody in recovery from a primary poxvirus infection. J Virol 80:6339–6344. doi: 10.1128/JVI.00116-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Yokoyama WM, Kim S, French AR. 2004. The dynamic life of natural killer cells. Annu Rev Immunol 22:405–429. doi: 10.1146/annurev.immunol.22.012703.104711. [DOI] [PubMed] [Google Scholar]
  • 63.Mbanwi AN, Wang C, Geddes K, Philpott DJ, Watts TH. 2016. Irreversible splenic atrophy following chronic LCMV infection is associated with compromised immunity in mice. Eur J Immunol 47:94–106. doi: 10.1002/eji.201646666. [DOI] [PubMed] [Google Scholar]
  • 64.Odermatt B, Eppler M, Leist TP, Hengartner H, Zinkernagel RM. 1991. Virus-triggered acquired immunodeficiency by cytotoxic T-cell-dependent destruction of antigen-presenting cells and lymph follicle structure. Proc Natl Acad Sci U S A 88:8252–8256. doi: 10.1073/pnas.88.18.8252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Mueller SN, Matloubian M, Clemens DM, Sharpe AH, Freeman GJ, Gangappa S, Larsen CP, Ahmed R. 2007. Viral targeting of fibroblastic reticular cells contributes to immunosuppression and persistence during chronic infection. Proc Natl Acad Sci U S A 104:15430–15435. doi: 10.1073/pnas.0702579104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Oh JH, Kim MJ, Choi SJ, Ban YH, Lee HK, Shin E-C, Lee K-M, Ha S-J. 2019. Sustained type I interferon reinforces NK cell-mediated cancer immunosurveillance during chronic virus infection. Cancer Immunol Res 7:584–589. doi: 10.1158/2326-6066.CIR-18-0403. [DOI] [PubMed] [Google Scholar]
  • 67.Zuniga EI, Liou LY, Mack L, Mendoza M, Oldstone M. 2008. Persistent virus infection inhibits type I interferon production by plasmacytoid dendritic cells to facilitate opportunistic infections. Cell Host Microbe 4:374–386. doi: 10.1016/j.chom.2008.08.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Lee LN, Burke S, Montoya M, Borrow P. 2009. Multiple mechanisms contribute to impairment of type 1 interferon production during chronic lymphocytic choriomeningitis virus infection of mice. J Immunol 182:7178–7189. doi: 10.4049/jimmunol.0802526. [DOI] [PubMed] [Google Scholar]
  • 69.Stelekati E, Shin H, Doering TA, Dolfi DV, Ziegler CG, Beiting DP, Dawson L, Liboon J, Wolski D, Ali MAA, Katsikis PD, Shen H, Roos DS, Haining WN, Lauer GM, Wherry EJ. 2014. Bystander chronic infection negatively impacts development of CD8+ T cell memory. Immunity 40:801–813. doi: 10.1016/j.immuni.2014.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Fallet B, Narr K, Ertuna YI, Remy M, Sommerstein R, Cornille K, Kreutzfeldt M, Page N, Zimmer G, Geier F, Straub T, Pircher H, Larimore K, Greenberg PD, Merkler D, Pinschewer DD. 2016. Interferon-driven deletion of antiviral B cells at the onset of chronic infection. Sci Immunol 1:eaah6817. doi: 10.1126/sciimmunol.aah6817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Daugan M, Murira A, Mindt BC, Germain A, Tarrab E, Lapierre P, Fritz JH, Lamarre A. 2016. Type I interferon impairs specific antibody responses early during establishment of LCMV infection. Front Immunol 7:564. doi: 10.3389/fimmu.2016.00564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Remakus S, Ma X, Tang L, Xu R-H, Knudson C, Melo-Silva CR, Rubio D, Kuo Y-M, Andrews A, Sigal LJ. 2018. Cutting edge: protection by antiviral memory CD8 T cells requires rapidly produced antigen in large amounts. J Immunol 200:3347–3352. doi: 10.4049/jimmunol.1701568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Remakus S, Rubio D, Lev A, Ma X, Fang M, Xu RH, Sigal LJ. 2013. Memory CD8+ T cells can outsource IFN-γ production but not cytolytic killing for antiviral protection. Cell Host Microbe 13:546–557. doi: 10.1016/j.chom.2013.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Remakus S, Rubio D, Ma X, Sette A, Sigal LJ. 2012. Memory CD8+ T cells specific for a single immunodominant or subdominant determinant induced by peptide-dendritic cell immunization protect from an acute lethal viral disease. J Virol 86:9748–9759. doi: 10.1128/JVI.00981-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Xu RH, Remakus S, Ma X, Roscoe F, Sigal LJ. 2010. Direct presentation is sufficient for an efficient anti-viral CD8+ T cell response. PLoS Pathog 6:e1000768. doi: 10.1371/journal.ppat.1000768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Tishon A, Borrow P, Evans C, Oldstone M. 1993. Virus-induced immunosuppression. 1. Age at infection relates to a selective or generalized defect. Virology 195:397–405. [DOI] [PubMed] [Google Scholar]
  • 77.Bocharov G, Argilaguet J, Meyerhans A. 2015. Understanding experimental LCMV infection of mice: the role of mathematical Models. J Immunol Res 2015:739706. doi: 10.1155/2015/739706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Alves-Peixoto P, Férez M, Knudson CJ, Melo-Silva CR, Stotesbury C, Wong EB, Correia-Neves M, Sigal LJ. 2020. Loss of resistance to mousepox during chronic lymphocytic choriomeningitis virus infection is associated with impaired T-cell responses and can be rescued by immunization. J Virol 94:e01832-19. doi: 10.1128/JVI.01832-19. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES