Skip to main content
International Journal of Microbiology logoLink to International Journal of Microbiology
. 2020 Feb 5;2020:6915483. doi: 10.1155/2020/6915483

Transcriptomic Response in Pseudomonas aeruginosa towards Treatment with a Kaempferol Isolated from Melastoma malabathricum Linn Leaves

Mourouge Saadi Alwash 1,, Wan Syaidatul Aqma 2, Wan Yaacob Ahmad 3, Nazlina Ibrahim 2,
PMCID: PMC7023722  PMID: 32089696

Abstract

Pseudomonas aeruginosa is one of the main causes of nosocomial infections and is frequently associated with opportunistic infections among hospitalized patients. Kaempferol-3-O-(2′,6′-di-O-trans-p-coumaroyl)-β-D glucopyranoside (KF) is an antipseudomonal compound isolated from the leaves of the native medicinal plant Melastoma malabathricum. Herein, an RNA-seq transcriptomic approach was employed to study the effect of KF treatment on P. aeruginosa and to elucidate the molecular mechanisms underlying the response to KF at two time points (6 h and 24 h incubation). Quantitative real-time PCR (qRT-PCR) was performed for four genes (uvrD, sodM, fumC1, and rpsL) to assess the reliability of the RNA-seq results. The RNA-seq transcriptomic analysis revealed that KF increases the expression of genes involved in the electron transport chain (NADH-I), resulting in the induction of ATP synthesis. Furthermore, KF also increased the expression of genes associated with ATP-binding cassette transporters, flagella, type III secretion system proteins, and DNA replication and repair, which may further influence nutrient uptake, motility, and growth. The results also revealed that KF decreased the expression of a broad range of virulence factors associated with LPS biosynthesis, iron homeostasis, cytotoxic pigment pyocyanin production, and motility and adhesion that are representative of an acute P. aeruginosa infection profile. In addition, P. aeruginosa pathways for amino acid synthesis and membrane lipid composition were modified to adapt to KF treatment. Overall, the present research provides a detailed view of P. aeruginosa adaptation and behaviour in response to KF and highlights the possible therapeutic approach of using plants to combat P. aeruginosa infections.

1. Introduction

Pseudomonas aeruginosa sp. is deemed one of the major etiological agents of both acute and chronic human infections ranging from minor skin infections to persistent and often life-threatening diseases in hospitalized or immunocompromised patients [1, 2]. Infections caused by this organism are difficult to treat due to the ability of this bacterium to resist multiple classes of antibiotics [3]. Strains of P. aeruginosa are well known to employ their high levels of intrinsic and acquired resistance mechanisms to combat most antibiotics [4]. In addition, pathogenesis of P. aeruginosa is multifactorial, and many virulence factors are produced that include secreted factors such as cytotoxic pigment pyocyanin, siderophores, alkaline protease, elastase, exotoxin A, rhamnolipid structural component lipopolysaccharide, pili, flagella, and biofilm formation [5]. Therefore, alternative drugs and new therapeutic strategies that present novel avenues against P. aeruginosa infections are increasingly required and gaining more and more attention [4]. Previous studies by our research group demonstrated that KF can induce P. aeruginosa cell wall damage [6, 7]. Thus, we decided to investigate the gene expression profile of P. aeruginosa growing in kaempferol-3-O-(2′,6′-di-O-trans-p-coumaroyl)-β-D glucopyranoside isolated from Melastoma malabathricum known to locals in Malaysia as “senduduk.” Next-generation sequencing (NGS) technology may provide a detailed view of P. aeruginosa adaptation and behaviour in response to KF and could help researchers further understand the transcriptomic response of P. aeruginosa to KF exposure [8]. We compared the transcriptional responses of P. aeruginosa upon exposure to KF at an early time point (6 h incubation) and at a late time point (24 h incubation) to provide information about the KF mechanism of action. Transcriptomic data highlighted a marked modulation of gene expression characterized by the induction of the expression of several genes involved in pathogenesis, iron acquisition, DNA replication and repair, and metabolic adaptation to KF growth conditions. The results presented in this study provide a detailed view of gene expression changes in P. aeruginosa in response to KF exposure, facilitating the understanding of the cellular strategies that are utilized under KF exposure conditions and identifying a potential mechanism for the inhibition of P. aeruginosa after KF exposure.

2. Materials and Methods

2.1. Bacteria and Growth Conditions

P seudomonas aeruginosa strain ATCC 10145 was cultivated in Nutrient Broth (Oxoid, UK) with a shaking incubator at 151 rpm for 3 to 6 h at 37°C to achieve log phase growth. At the log phase (∼6 h incubation), KF was added to the P. aeruginosa culture in Mueller Hinton Broth (Oxoid, UK) at a density of 4 × 105 CFU/mL to achieve a final concentration of 0.5 mg/mL dissolved in 5% dimethyl sulfoxide (DMSO). DMSO (5%) was used as a negative control for untreated cells. The cultures were incubated at 37°C with a shaking incubator at 200 rpm.

2.2. RNA Extraction, cDNA Library Construction, and Illumina Sequencing

Total RNA was extracted from P. aeruginosa (treated or untreated) and harvested after 6 h and 24 h of incubation. RNA was extracted using an innuPREP RNA Mini Kit (Analytik Jena Biometra, Germany). The quantity and integrity were first determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) and Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). The total RNA was depleted of rRNA using a ScriptSeq™ Complete Kit (Bacteria; Epicenter, San Diego, CA, USA). Total RNA samples were used for cDNA synthesis. Magnetic beads with attached poly T oligos were used to purify mRNA from the total RNA. The mRNA was then cleaved into small fragments by the addition of RNA fragmentation solution. First strand cDNA was synthesized using random hexamer adaptors and StarScript Reverse Transcriptase, followed by the synthesis of second strand cDNA using ScriptSeq v2 Terminal Tagging Premix and DNA polymerase. Exonuclease and polymerase were used to blunt and adenylate the 3′ ends of the DNA fragments, and Illumina PE adapter oligonucleotides were ligated to prepare for hybridization. The cDNA fragments (280 bp) were purified using the Pure AMXP system (Beckman Coulter, Beverly, CA, USA). The cDNA fragments with ligated adaptor molecules were enriched using Illumina PCR Primer Cocktail in a 15-cycle PCR. Finally, the cDNA library was sequenced on the Illumina MiSeq platform (San Diego, CA, USA) using single-end technology in a single run at the Institute of Biosciences, Universiti Putra Malaysia. The Illumina MiSeq software was used to perform the original image processing for sequencing, base calling, and quality value calculations, where 50 bp single-end reads were obtained.

2.3. Analysis of the Differentially Expressed Genes (DEGs)

The raw reads were filtered to obtain the high-quality clean data by removing adaptor sequences and low-quality reads with the Phred quality score ≤30. The clean reads were then mapped to the P. aeruginosa PA01 genome (NCBI reference sequence, NC_002516.2; GenBank accession number AE004091.2). FASTQ read values were calculated and normalized to transform into expression values by using CLC Genomics Workbench version 6.5. Differential expression analysis (fold changes) for RNAseq data was performed to compare two different samples (untreated versus treated samples) using Kal's Z-test. Genes with average fold changes >2 and adjusted p values less than 0.05 (i.e., false discovery rate less than 5%) were identified as significant DEGs. To better understand the biological functions and the metabolic pathways of the identified genes, the DEGs were functionally classified due to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. The significant DEGs at both 6 h and 24 h were compiled and used to generate a Venn diagram through an online interactive tool [9]. The gene lists of unique and shared genes in each group identified in the Venn diagram were analysed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) (http://david.abcc.ncifcrf.gov/home.jsp). The DAVID database provides a comprehensive set of functional annotation tools to understand the biological meaning behind the DEGs, including visualizing genes on KEGG pathway maps. In addition, the obtained data were then compiled with public datasets downloaded from the Pseudomonas Genome Database (http://www.pseudomonas.com) for further analysis. The raw RNA-seq data have been submitted to the NCBI Sequence Read Archive (NCBI SRA) under GenBank accession no. SRP060687 (NCBI SRA, http://www.ncbi.nlm.nih.gov/sra?term=SRP060687).

2.4. Validation of DEGs by Quantitative Real-Time PCR (qRT-PCR)

In order to validate the RNA-seq data and to have a concise view of P. aeruginosa gene expression profiles over time, qRT-PCR was employed and gene expression levels were analysed on a subset of genes whose functions were documented to contribute to P. aeruginosa virulence. Four genes with different expression patterns at two time points were chosen for the validation of the RNA-seq results. The template cDNAs were synthesized from 1 μg of total RNA using oligo (dT)18, random hexamer primers, and reverse transcriptase enzyme mix (Maxima First Strand cDNA Synthesis Kit; Thermo Scientific, USA). A Luminaris Color HiGreen Fluorescein qPCR Master Mix (Thermo Scientific, USA) was used as a labelling agent, and L-aspartate oxidase (nadB) served as an internal reference gene. The reaction mixture (20 μL) contained 2 × Master Mix (10 μL), 10 μM forward and reverse primers (1.2 μL and 0.6 μL of each), template cDNA (2 μL), and RNase-free water (6.8 μL). The PCR program was as follows: 2 minutes (min) at 50°C, 10 min at 95°C, followed by 40 cycles for 15 seconds (sec) at 95°C, 40 cycles of 30 sec at 53°C and 40 cycles of 30 sec at 72°C. The reaction was performed on an iCycler iQ5 instrument (Bio-Rad Laboratories, Inc., Hercules, Canada). Two independent biological replicates were included for each sample. The relative expression of a target gene in comparison to a reference gene expression level was calculated using Relative Expression Software Tool Multiple Condition Solver REST-MCS©-version 2 (http://rest.gene-quantification.info).

3. Results

3.1. Transcriptomic Analysis

Genome-wide transcriptomic analysis was conducted to elucidate the mechanism through which KF exerts its killing effect on P. aeruginosa using NGS technology. After statistical analysis (Kal's Z-test), 2405 of the 5681 genes that comprise the P. aeruginosa genome were found to be significantly differentially regulated (p ≤ 0.05). A total of 2405 differentially expressed genes were classified based on the Pseudomonas Genome Database, KEGG pathways, individual operons, and genes potentially encoding targets associated with virulence factors.

Further analysis revealed that 1031 genes showed statistically significant upregulation (>2.0-fold) or downregulation (>2.0-fold) of expression at 6 h and 24 h of exposure to KF. Figure 1 illustrates that more downregulated genes in the functional classes were generally observed at 24 h compared to 6 h of incubation. The most noticeable number of downregulated genes among all functional classes was hypothetical, unclassified, and unknown (HUU) with unknown function.

Figure 1.

Figure 1

Histograms representing the number of genes based on their functional classes for P. aeruginosa and for the upregulated expression (blue bars) and downregulated expression (red bars) genes among the 1031 significantly expressed genes at both 6 h and 24 h exposure to KF (0.5 mg/mL). The numbers in parentheses indicate the total number of genes for each functional class in both groups.

Note that 803 of 1031 genes were excluded as hypothetical proteins (HUUs). The Venn diagram for the remaining 228 genes at the two time points shows more uniquely over-represented genes at 24 h (115) than at 6 h (53), suggesting a difference between the early and late responses of P. aeruginosa to KF (Figure 2). A total of 228 genes were placed in six groups based on their expression change direction (Figure 3).

Figure 2.

Figure 2

Venn diagram showing the overlap of significantly upregulated expression of genes at 6 h and 24 h exposure to KF (0.5 mg/mL). (a) Venn diagram for early time point (6 h). (b) Venn diagram for late time point (24 h).

Figure 3.

Figure 3

Classification of differentially upregulated and downregulated (total of 228) genes into six groups based on their functional classes at 6 h and 24 h exposure to KF (0.5 mg/mL). Group I consisted of genes with upregulated expression at 6 h and 24 h. Group II consisted of genes with upregulated expression at 6 h without significant changes at 24 h. Group III consisted of genes with downregulated expression at 6 h without significant changes at 24 h. Group IV consisted of genes with upregulated expression at 24 h without significant changes at 6 h. Group V consisted of genes with downregulated expression at 24 h without significant changes at 6 h. Group VI consisted of genes with downregulated expression at 6 h and 24 h.

3.1.1. Group I: Genes with Upregulated Expression at 6 h and 24 h

Group I consisted of genes with upregulated expression at both 6 h and 24 h of exposure to KF (Table 1). Growth under KF exposure conditions induced changes in the expression of genes associated with ATP-binding cassette (ABC) transporters (agtABCD operon, PA4500), carbohydrate transporters (PA3190), and inorganic ion transporters (PA3514).

Table 1.

List of the group I genes with upregulated expression at 6 h and 24 h.

Genes 6 h fold change p value 24 h fold change p value Description Functional class
agtA 20.45 0 9.21 0 ABC-type spermidine/putrescine transport systems, ATPase components TSMs
agtB 32.34 0 8.09 0 ABC-spermidine/putrescine-binding periplasmic protein TSMs
agtC 25.25 0 4.57 0 ABC-type spermidine/putrescine transport system, permease component I TSMs; MPs
agtD 15.20 1.68E − 03 3.00 2.68E − 07 ABC-type spermidine/putrescine transport system, permease component II TSMs; MPs
PA4500 8.02 0 3.11 0 ABC-type dipeptide transport system, periplasmic component TSMs
PA3190 7.60 2.64E − 04 2.09 0 ABC-type sugar transport system, periplasmic component TSMs
PA3514 6.95 6.67E − 04 5.08 0 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component TSMs
spcS 35.38 0 3.94 0 Specific Pseudomonas chaperone for ExoS, SpcS SFs; PSEA
pcrV 14.54 0 5.89 0 Type III protein secretion system complex PSEA
pcrH 7.52 0 4.94 0 Regulatory protein PcrH SFs; PSEA
popB 11.31 0 4.79 0 Translocator protein PopB PSEA
popD 9.67 0 3.48 0 Translocator outer membrane protein PopD precursor PSEA
exsC 10.98 0 4.09 0 ExsC, exoenzyme S synthesis protein C precursor PSEA
exsE 8.61 2.32E − 06 4.62 0 ExsE PSEA
exsD 11.895 0 4.572 0 ExsD PSEA
pscG 7.60 4.15E − 03 2.31 6.10E − 03 Type III export protein PscG PSEA; CHSPs
exoS 13.43 0 6.71 0 Exoenzyme S SFs
exoT 9.36 0 4.50 0 Exoenzyme T SFs
exoY 31.08 0 5.82 0 Adenylate cyclase ExoY SFs

Group I also contained genes coding for the type III secretion system (T3SS). These genes with upregulated expression include those involved in the secretion and translocation machinery into the host cell plasma (popBD and pcrV); transcription and initiation (exsCED); chaperones that bind secreted proteins to facilitate the secretion process (spcS, pcrH, pscG, and exsC); and effector proteins that are injected into host cells (exoSTY; Table 1).

3.1.2. Group II: Genes with Upregulated Expression at 6 h

Group II is composed of genes with expression levels that increased only at 6 h of exposure to KF (Table 2). The expression of genes involved in the biosynthesis of several amino acids, including histidine (hisC1 and hisE), arginine (argF and argJ), isoleucine (ilvA1), leucine (leuA and leuC), and phenylalanine (pheA), was increased after KF exposure. In addition, we observed the overexpression of genes related to translation class, including genes encoding 30S and 50S ribosomal proteins (the two most upregulated genes, 30S and 50S, are listed in Table 2); aminoacyl-tRNA synthetases associated with tryptophan (trpS), tyrosine (tyrZ), glycine (glyQ), glutamine (glnE), valine (valS), proline (pros), cysteine (cysS), and isoleucine (ileS); translation initiation factor (infC); elongation factor G (fusA2); and peptide chain release factor (prfC) in response to KF treatment.

Table 2.

List of the group II genes with upregulated expression at 6 h.

Genes 6 h (fold change) p value Description Functional class
hisC1 4.814 0.013 Histidinol-phosphate aminotransferase AABM
HisE 3.111 4.06E − 08 Phosphoribosyl-ATP pyrophosphohydrolase AABM
ArgF 2.723 2.16E − 03 Ornithine carbamoyltransferase, anabolic AABM
ArgJ 2.601 9.75E − 03 Glutamate N-acetyltransferase AABM
ilvA1 2.117 0.021 Threonine dehydratase, biosynthetic AABM
LeuA 5.244 0 2-Isopropylmalate synthase AABM
LeuC 2.387 7.87E − 12 3-Isopropylmalate dehydratase large subunit AABM
PheA 2.1 0.018 Chorismate mutase AABM
RpsL 2.56 0 30S ribosomal protein S12 TPTMD
RplA 3.679 0 50S ribosomal protein L1 TPTMD
TrpS 3.501 1.62E − 05 Tryptophanyl-tRNA synthetase TPTMD; AABM
TyrZ 3.239 0 Tyrosyl-tRNA synthetase 2 TPTMD; AABM
GlyQ 2.431 0 Glycyl-tRNA synthetase alpha chain TPTMD; AABM
GlnE 2.912 3.52E − 07 Glutamine synthetase adenylyltransferase TPTMD
ValS 2.356 3.57E − 10 Valyl-tRNA synthetase TPTMD; AABM
ProS 2.274 2.36E − 09 Prolyl-tRNA synthetase TPTMD; AABM
CysS 2.152 2.30E − 05 Cysteinyl-tRNA synthetase TPTMD; AABM
IleS 2.02 1.72E − 08 Isoleucyl-tRNA synthetase TPTMD; AABM
InfC 7.182 0 Translation initiation factor IF-3 TPTMD
fusA2 2.313 5.73E − 07 Elongation factor G TPTMD
PrfC 3.564 0.013 Peptide chain release factor 3 TPTMD
PA5195 3.589 0.028 Probable heat shock protein CHSPs
HscB 3.187 2.35E − 05 Heat shock protein HscB CHSPs
AccB 6.303 0 Biotin carboxyl carrier protein (BCCP) FAPM
AccD 3.579 6.23E − 12 Acetyl-CoA carboxylase beta subunit FAPM
FabA 2.258 2.67E − 06 Beta-hydroxydecanoyl-ACP dehydrase FAPM
FabB 2.96 0 Beta-ketoacyl-ACP synthase I FAPM
NorB 8.614 1.58E − 03 Nitric oxide reductase subunit B EM
Anr 3.84 0 Transcriptional regulator Anr EM
NuoB 4.162 0 NADH dehydrogenase I chain B EM
NuoD 2.982 0 NADH dehydrogenase I chain C,D EM
NuoF 2.657 5.14E − 09 NADH dehydrogenase I chain F EM
NuoG 2.761 0 NADH dehydrogenase I chain G EM
NuoH 3.026 9.62E − 06 NADH dehydrogenase I chain H EM
NuoI 7.185 3.21E − 14 NADH dehydrogenase I chain I EM
NuoJ 4.172 3.27E − 03 NADH dehydrogenase I chain J EM
NuoL 3.459 0 NADH dehydrogenase I chain L EM
NuoM 2.884 5.40E − 04 NADH dehydrogenase I chain M EM
NuoN 5.008 2.12E − 07 NADH dehydrogenase I chain N EM
FlgB 5.197 0 Flagellar basal body rod protein FlgB CWLC; MA
FlgC 2.907 8.96E − 10 Flagellar basal body rod protein FlgC CWLC; MA
FlgD 4.125 4.38E − 14 Flagellar basal body rod modification protein FlgD CWLC; MA
FlgE 4.984 0 Flagellar hook protein FlgE CWLC; MA
FlgF 4.623 2.03E − 14 Flagellar basal body rod protein FlgF CWLC; MA
FlgG 3.297 0 Flagellar basal body rod protein FlgG CWLC; MA
FlgI 2.4 0.01 Flagellar P-ring protein precursor FlgI CWLC; MA
FlgJ 4.057 3.23E − 13 Flagellar protein FlgJ CWLC; MA
FlgK 3.85 2.24E − 10 Flagellar hook-associated protein 1 FlgK CWLC; MA
FliE 4.534 1.18E − 11 Flagellar hook-basal body complex protein FliE CWLC; MA
FliF 3.433 0 Flagella M-ring outer membrane protein precursor CWLC; MA
FliG 2.635 6.34E − 10 Flagellar motor switch protein FliG CWLC; MA

As shown in Table 2, the upregulation of the expression of genes involved in the first step of long-chain fatty acid biosynthesis was also observed. The genes with upregulated expression include those encoding biotin carboxyl carrier protein (accB) and acetyl CoA carboxylase beta subunit (accD). In prokaryotes, this step involves the ATP-dependent carboxylation of acetyl coenzyme A (CoA) to form malonyl CoA by the enzyme acetyl CoA carboxylase. In addition, the expression of fabA and fabB genes, which are involved in the biosynthesis of unsaturated fatty acids (UFAs), was increased in KF samples. Under anaerobic conditions, P. aeruginosa can utilize nitrate, nitrite, or nitrous oxide instead of oxygen as a terminal electron acceptor in the denitrification process. The expression of the nitric oxide reductase gene (norB) required for denitrification was upregulated. Furthermore, the most obvious upregulation of gene expression was found in the oxidative phosphorylation pathway. NADH created by the Krebs cycle can be fed into the oxidative phosphorylation pathway. The expression of NADH dehydrogenase I chain (nuoBDFGHIJLMN) in the oxidative phosphorylation pathway was increased. The anr gene encodes the transcriptional regulator Anr, which is involved in controlling P. aeruginosa gene expression under anaerobic conditions was significantly increased in KF-treated samples, with log2-fold changes of 3.84. Table 2 also shows that the expression of genes related to the flagella assembly pathway (flgBCDEGIJK and fliEFG) was also increased after KF exposure.

3.1.3. Group III: Genes with Downregulated Expression at 6 h

The expression of genes associated with adaptation, protection, and secreted factor functional class was downregulated (Table 3). The genes with downregulated expression include those associated with pyocin S2 (pys2) and pyocin S2 immunity protein (imm2). The expression of cobODUJ genes, which are involved in the aerobic cobalamin biosynthesis process (a cofactor for numerous enzymes mediating methylation, reduction, and intramolecular rearrangements), was reduced.

Table 3.

List of the group III genes with downregulated expression at 6 h.

Genes 6 h (fold change) 24 h (fold change) Description Functional class
Pys2 −4.084 0 Pyocin S2 AP; SFs
imm2 −2.56 0 Pyocin S2 immunity protein AP
cobO −2.684 8.27E − 04 Cob (I) alamin adenosyltransferase BCPGCs
cobD −4.229 0.012 Cobalamin biosynthetic protein CobD BCPGCs
cobU −4.306 7.36E − 04 Nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase BCPGCs
cobJ −4.9 0 Precorrin-3 methylase CobJ BCPGCs

3.1.4. Group IV: Genes with Upregulated Expression at 24 h

Exposure to KF increased changes in the expression of genes associated with tripartite ATP-independent periplasmic transporters, including dctP (a C4 dicarboxylate-binding protein) and dctQ and dctM (C4 dicarboxylate transporters) (Table 4). Pseudomonas. aeruginosa preferentially uses C4 dicarboxylates, such as malate, fumarate, and succinate, as carbon and energy sources under anaerobic conditions.

Table 4.

List of the group IV genes with upregulated expression at 24 h.

Genes 24 h (fold change) p value Description Functional class
dctP 2.879 0 DctP MPs; TSMs
dctQ 2.419 1.04E − 06 DctQ MPs; TSMs
dctM 2.206 4.35E − 05 DctM MPs; TSMs

3.1.5. Group V: Genes with Downregulated Expression at 24 h

Group V is composed of genes with downregulated expression at 24 h of exposure to KF (Table 5). The expression of the pchR gene, which encodes elements involved in iron Fe3+ acquisition, was reduced. In addition, growth under KF exposure conditions reduced the changes in the expression of genes including members of the extracytoplasmic factor (ECF) subfamily (PA0471-PA0472, PA1300-1301, PA3899-PA3900, PA4895-PA4896, PA0149, PA1912, and PA2896). The expression of the tonB gene (TonB-dependent siderophore receptor) required for chelating Fe3+ was reduced. Furthermore, the expression of genes encoding fumarate hydratase (fumC1), superoxide dismutase (sodM), haemeoxygenase (hemO), and oxidoreductase (PA0853 and PA3768) was downregulated.

Table 5.

List of the group V genes with downregulated expression at 24 h.

Genes 24 h (fold change) p value Description Functional class
pchR −3.116 2.23E − 15 Transcriptional regulator PchR TRs
PA0471 −2.863 1.61E − 05 Fe2+-dicitrate sensor, membrane component TCRSs; MPs; TRs
fiuI −2.171 1.62E − 03 Fe2+-dicitrate sensor, membrane component TRs
PA1300 −2.201 5.72E − 09 Sigma-70 factor, ECF subfamily TRs
PA1301 2.386 0.014 Probable transmembrane sensor MPs; TRs
PA3899 −3.481 0 Probable sigma-70 factor, ECF subfamily TRs
PA3900 −2.505 0.019 Fe2+-dicitrate sensor, membrane component MPs; TRs
PA4895 −5.965 1.26E − 09 Fe2+-dicitrate sensor, membrane component MPs; TRs
PA4896 −3.644 8.33E − 11 Sigma-70 factor, ECF subfamily TRs
PA0149 −3.859 1.15E − 08 Probable sigma-70 factor, ECF subfamily TRs
femI −3.628 0 ECF sigma factor, FemI TRs
PA2896 −2.495 0 Probable sigma-70 factor, ECF subfamily TRs
tonB1 −2.067 0 Periplasmic protein TonB, links inner and outer membranes TSMs
PA4156 −11.36 0 Probable TonB-dependent receptor TSMs
fumC1 −4.599 0 Fumarate hydratase EM
sodM −3.955 0 Superoxide dismutase AP
hemO −3.581 0 Heme oxygenase BCPGCs
PA0853 −3.242 2.66E − 13 Oxidoreductase PEs
PA3768 −2.622 0 Probable metallo-oxidoreductase PEs
phzA1 −4.295 1.53E − 07 Probable phenazine biosynthesis protein SFs
phzB1 −4.708 −4.708 Probable phenazine biosynthesis protein SFs
phzC1 −2.577 −2.577 Phenazine biosynthesis protein PhzC SFs
phzA2 −2.625 −2.625 Probable phenazine biosynthesis protein SFs
phzB2 −3.848 −3.848 Probable phenazine biosynthesis protein SFs
phzM −2.125 1.14E − 10 Probable phenazine-specific methyltransferase PEs
phzS −2.241 0 Flavin-containing monooxygenase PEs
secA −2.166 0 Secretion protein SecA PSEA
secB −2.579 0 Secretion protein SecB PSEA
secD −3.234 0 Secretion protein SecD PSEA; MPs
mexG −2.119 7.29E − 03 Membrane protein MPs
mexH −9.088 0 Probable resistance-nodulation-cell division (RND) efflux membrane fusion protein precursor TSMs
mexI −5.758 0 Probable resistance-nodulation-cell division (RND) efflux transporter TSMs; MPs
opmD −3.241 0 Outer membrane protein precursor TSMs; MPs
lpxB −2.148 7.24E − 03 Lipid A-disaccharide synthase CWLC
lpxA −2.274 0 UDP-N-acetylglucosamine acyltransferase CWLC
waaP −3.174 2.75E − 14 Lipopolysaccharide kinase WaaP CWLC
waaG −2.437 0 UDP-glucose:(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG CWLC
waaF −2.283 1.48E − 08 Heptosyltransferase II CWLC
PA4998 −2.482 6.80E − 12 Aminoglycoside 3′-phosphotransferase (APH) and choline kinase family CWLC
PA5007 −3.124 4.80E − 08 Mn2+−dependent serine/threonine protein kinase PEs
PA5008 −3.187 7.22E − 15 RIO-like serine/threonine protein kinase fused to N-terminal HTH domain PEs
rmlA −2.554 0 Glucose-1-phosphate thymidylyltransferase CWLC
pilD −2.377 0 Type 4 prepilin peptidase PilD SFs; PSEA; MA
pilF −2.053 0 Type 4 fimbrial biogenesis protein PilF PSEA; MA
pilM −3.074 0 Type 4 fimbrial biogenesis protein PilM MA
pilN −3.871 0 Type 4 fimbrial biogenesis protein PilN MA
pilO −4.476 0 Type 4 fimbrial biogenesis protein PilO MA
pilP −3.956 0 Type 4 fimbrial biogenesis protein PilP MA
pilQ −3.219 0 Type 4 fimbrial biogenesis outer membrane protein PilQ precursor MA
pilU −2.226 0 Twitching motility protein PilU MA
pilV −2.382 0 Type 4 fimbrial biogenesis protein PilV MA
pilW −2.516 0 Type 4 fimbrial biogenesis protein PilW MA
pilX −2.366 0 Type 4 fimbrial biogenesis protein PilX MA
pilY1 −2.025 0 Type 4 fimbrial biogenesis protein PilY1 MA
pilG −2.713 0 Twitching motility protein PilG TCRSs; MA; CT
pilH −3.112 0 Twitching motility protein PilH TCRSs; MA; CT
pilI −2.731 2.20E − 09 Twitching motility protein PilI MA; CT
pilJ −5.282 0 Twitching motility protein PilJ MA; CT
Vfr −2.047 0 Transcriptional regulator vfr TRs
chpA −2.124 0 Component of chemotactic signal transduction system TCRSs; MA; CT
chpB −2.315 1.15E − 05 Probable methylesterase CT
fliC −2.145 0 Flagellin type B MA
rpsK −2.592 0 30S ribosomal protein S11 TPTMD
rplA −2.375 0 50S ribosomal protein L1 TPTMD
glnS −2.102 0 Glutaminyl-tRNA synthetase TPTMD; AABM
glyS −2.162 2.11E − 13 Glycyl-tRNA synthetase beta chain TPTMD; AABM
leuS −2.131 0 Leucyl-tRNA synthetase TPTMD; AABM
lysS −2.38 0 Lysyl-tRNA synthetase TPTMD; AABM
proS −2.764 0 Prolyl-tRNA synthetase TPTMD; AABM
valS −2.13 0 Valyl-tRNA synthetase TPTMD; AABM
aspS −2.129 0 Aspartyl-tRNA synthetase T-RNA-PD; TPTMD
hisF1 −3.599 1.02E − 11 Imidazole glycerol-phosphate synthase, cyclase subunit AABM
hisG −2.863 2.04E − 10 ATP-phosphoribosyltransferase AABM
argB −2.436 0 Acetylglutamate kinase AABM
argG −2.428 0 Argininosuccinate synthase AABM
argH −2.127 0 Argininosuccinate lyase AABM
cysM −3.436 0 Cysteine synthase B AABM
trpA −4.405 0 Tryptophan synthase alpha chain AABM
trpB −6.527 0 Tryptophan synthase beta chain AABM
hslU −4.255 0 Heat shock protein HslU CHSPs
hslV −3.742 0 Heat shock protein HslV CHSPs
htpG −2.835 0 Heat shock protein HtpG CHSPs
htpX −2.557 0 Heat shock protein HtpX AP
dnaA −2.631 0 Chromosomal replication initiation protein DNA-RRMR
dnaJ −2.528 0 DnaJ protein DNA-RRMR; CHSPs; AP
dnaK −3.087 0 DnaK protein DNA-RRMR; CHSPs; AP
holC −2.701 5.25E − 09 DNA polymerase III, chi subunit DNA-RRMR
mutL −2.563 0 DNA mismatch repair protein MutL DNA-RRMR
Phr −3.012 2.14E − 12 Deoxyribodipyrimidine photolyase DNA-RRMR
sbcD −2.056 2.40E − 13 Exonuclease SbcD DNA-RRMR
recG −2.105 7.52E − 16 ATP-dependent DNA helicase RecG DNA-RRMR; TRs
uvrC −2.622 0 Excinuclease ABC subunit C DNA-RRMR
uvrD −3.412 0 DNA helicase II DNA-RRMR
ccmE −2.297 7.41E − 10 Cytochrome C-type biogenesis protein CcmE EM
ccmG −2.001 3.24E − 06 Cytochrome C biogenesis protein CcmG TPTMD; CHSPs; EM
PA1600 −2.819 2.31E − 06 Probable cytochrome c EM
PA4571 −2.708 0 Probable cytochrome c EM
PA4133 −5.344 0 Cytochrome c oxidase subunit (cbb3-type) EM
ccoO1 −2.475 0 Cytochrome c oxidase, cbb3-type, CcoO subunit EM
ccoQ1 −2.235 1.16E − 04 Cytochrome c oxidase, cbb3-type, CcoQ subunit EM
nuoD −2.216 0 NADH dehydrogenase I chain C,D EM
nuoE −2.162 9.15E − 13 NADH dehydrogenase I chain E EM
narK1 −2.541 2.23E − 15 Nitrite extrusion protein 1 MPs; TSMs
narK2 −5.637 0 Nitrite extrusion protein 2 MPs; TSMs
narG −4.157 0 Respiratory nitrate reductase alpha chain EM
narJ −2.386 0.014 Respiratory nitrate reductase delta chain EM
narL −2.09 0 Two-component response regulator NarL EM; TCRSs
Dnr −2.065 8.03E − 14 Transcriptional regulator Dnr TRs

Table 5 also shows that the expression of virulence-associated genes that are involved in phenazine-1-carboxylic acid (PCA) biosynthesis (phzA1B1C1A2B2) and the conversion of PCA to pyocyanin (phzMS) were decreased. The expression of several genes associated with Sec system proteins was significantly altered. Exposure to KF reduced the changes in the expression of genes such as the inner membrane translocase subunit proteins (secD), a cytoplasmic membrane-associated ATPase (secA), and a chaperone (secB) that binds to presecretory target proteins. The results also showed a downregulation of the expression of the mexGHI-opmD efflux pump system in the KF-treated samples (Table 5). In addition, the expression of several genes involved in the LPS biosynthesis process, including lpxA, lpxB, waaF, waaG, waaP, PA4998, PA5007, PA5008, and rmlA, was decreased. Transcription data of P. aeruginosa showed a downregulation in the expression of type VI pili composed of pilDFMNOPQUVWXY1. The expression levels of vfr (virulence factor regulator) and pilGHIJ-chpAB (Chp chemosensory system) genes were significantly decreased according to the Log2-fold changes. The virulence-associated fliC gene, which encodes flagellin type B, was downregulated under KF exposure conditions.

Growth under KF conditions reduced the expression of genes associated with translation class, including genes encoding the 30S and 50S ribosomal proteins (the two most downregulated 30S and 50S genes are listed in Table 5) and aminoacyl-tRNA synthetase associated with glutamine (glnS), glycine (glyS), leucine (leuS), lysine (lysS), proline (proS), valine (valS), and aspartate (aspS). In addition, the expression of genes involved in the biosynthesis of several amino acids, including histidine (hisF1 and hisG), arginine (argB, argG, and argH), cysteine (cysM), and tryptophan (trpA and trpB), was also decreased after exposure to KF.

RNA-seq data showed a downregulation in the expression of genes associated with DNA replication (dnaJ, dnaK, dnaA, and holC) and repair mechanism (mutL, phr, sbcD, uvrC, uvrD, and recG) (Table 5).

This group also contained several genes related to cytochrome c, which is highly expressed under microaerobic conditions. These genes with downregulated expression include those encoding elements in cytochrome c (ccmEG, PA1600, and PA4571) and cbb3-1 cytochrome c terminal oxidases (ccoO1Q1 and PA4133).

The expression of NADH dehydrogenase I chain subunits (nuoD and nuoE) in the oxidative phosphorylation pathway was significantly decreased in KF-treated samples, with log2-fold changes of −2.216 and −2.162, respectively. Table 5 also shows that the expression of genes involved in energy production in the absence of oxygen through denitrification was decreased after KF treatment. These genes with downregulated expression include those encoding nitrate/nitrite transporters (narK1 and narK2), the dissimilatory nitrate reductase (narG and narJ), the two-component regulator NarL, and the transcriptional regulator Dnr.

3.1.6. Group VI: Genes with Downregulated Expression at 6 h and 24 h

This group consisted of genes with downregulated expression at both 6 h and 24 h (Table 6). Growth under KF exposure conditions induced the downregulation of the expression of genes encoding heat shock proteins (hslVU, htpG, and grpE). The expression of the clpB gene, which encodes the ATP-binding subunit protease, was also downregulated under KF exposure conditions.

Table 6.

List of the group VI genes with downregulated expression at 6 h and 24 h.

Genes 6 h (fold change) p value 24 h (fold change) p value Description Functional class
htpG −  4.483 0 − 2.835 0 Heat shock protein HtpG CHSPs
HslV − 5.567 0 − 3.742 0 Heat shock protein HslV CHSPs
HslU − 3.379 0 − 4.255 0 Heat shock protein HslU CHSPs
grpE − 2.265 0 − 3.718 0 Heat shock protein GrpE DNA-RRMR; CHSPs
ClpB − 5.018 0 − 2.312 0 ATP-binding subunits of clp protease and DnaK/DnaJ chaperones TPTMD
BfiR − 2.707 0.033 − 2.584 0 Response regulator TRs; TCRSs
BfiS − 4.934 6.31E −  15 − 2.714 0 Signal transduction histidine kinase regulating C4-dicarboxylate transport system TCRSs

In this group, we observed the downregulation of the expression of genes involved in the initiation stage of biofilm formation (bfiR and bfiS) in KF-treated P. aeruginosa samples. Biofilm formation in P. aeruginosa is regulated by three novel two-component regulatory systems that are involved in (i) the initiation of biofilm formation (BfiRS), (ii) biofilm maturation (BfmRS), and (iii) microcolony formation (MifRS).

3.2. Validation of NGS Results Using Quantitative Real-Time PCR (qRT-PCR)

Four genes identified from RNA-seq data (uvrD, sodM, fumC1, and rpsL) were selected for qRT-PCR analysis. nadB (PA0761) was chosen as the reference control gene that exhibited no change in our transcriptomic data at two treatment times. qRT-PCR data showed the same trend of either upregulation or downregulation of the genes as that in NGS, thereby validating our NGS results (Table 7). The variations were due to the difference in the sensitivity of the two assays.

Table 7.

Transcript level comparison of P. aeruginosa genes between qRT-PCR and NGS. qRT-PCR is the mean of two biological replicates with three technical replicates for each gene. Reference gene (nadB): L-aspartate oxidase, uvrD, and sodM were downregulated at 24 h with no change at 6 h; fumC1 was upregulated at 6 h and downregulated at 24 h; rpsL was upregulated at 6 h with NC at 24 h exposure.

Genes ID Gene symbol NGS qRT-PCR Primers Length (bp) Description
Fold change Fold change
6 h 24 h 6 h 24 h 5′-sequence-3′
PA5443 uvrD NC −3.412 ± 0 NC −2.54 ± 0.01 GTGCGCCTGTCCAATAC 17 DNA helicase II
GCCTTCGAAGTTGAGGATAG 20
PA4468 sodM NC −3.955 ± 0 NC −2.44 ± 0.01 GAGCAGCCGGTGGAAAGTCT 20 Superoxide dismutase
GCGACATCACGGTCCAGAAC 20
PA4470 fumC1 3.618 ± 0 −4.599 ± 0 3.48 ± 0.69 −5.39 ± 0 TCGGGCAACTTCGAACTGAA 20 Fumarate hydratase
GAGCTTGCCCTGGTTGACCT 20
PA4268 rpsL 2.56 ± 0 NC 3.53 ± 0.53 NC CGGCACTGCGTAAGGTATGC 20 30S ribosomal protein S12
CCCGGAAGGTCCTTTACACG 20
PA0761 nadB Reference gene CTACCTTTATACCAGCAATCCC 22 L-aspartate oxidase
CGGTGATGAGGAAACTCTTG 20

4. Discussion

Previous studies have elucidated that KF can inhibit P. aeruginosa growth [6, 7]. In regard to this inhibitory effect, the approach of transcriptomic analysis is useful to identify the differentially expressed genes in this bacterium. The transcriptome profiles of P. aeruginosa treated with KF were examined to demonstrate the changes in gene expression at two time points (6 h and 24 h incubation). Functional analyses were performed to clarify the possible mechanisms underlying the changes in gene expression from a global perspective. In addition, qRT-PCR was used to confirm the RNA-seq results of select genes.

The type III secretion system (T3SS) regulates the virulence of many pathogenic bacteria [10]. The T3SS system is essential for the export of effector proteins through a needle-like structure directly inside target host cells [10]. Transcriptome data showed the continuous upregulation of all T3SS apparatus, regulators, and effector proteins in P. aeruginosa at 6 h and 24 h of KF treatment (Table 1). Interestingly, the expression of P. aeruginosa genes involved in the flagella assembly pathway, which mediates swimming motility and functions in biofilm development, was increased [11]. These findings indicate that the T3SS system and flagella assembly pathway are tuned by different environmental stresses, which might be an essential survival strategy for this bacterium [12].

As shown in Table 2, gene expression analysis of P. aeruginosa grown in KF for 6 h displayed an upregulation of the operon fabAB (Table 2), which is involved in the biosynthesis of unsaturated fatty acids (UFAs). UFAs are required to maintain the fluidity of bacterial membranes [13]. Thus, we assume that the membrane lipid composition might be altered to allow growth under KF exposure conditions.

Pseudomonas aeruginosa has a highly complex respiratory chain with multiple terminal oxidases and can respire both oxygen and nitrogen oxides [14, 15]. Under anaerobic conditions, P. aeruginosa can respire through denitrification [16]. In this process, four reductases (nitrate-, nitrite-, NO-, and nitrous oxide reductases) allow bacterial growth [17]. Thus, during this process, molecular oxygen is replaced by nitrate as the terminal electron acceptor [18]. The P. aeruginosa genome encodes three NADH dehydrogenase chains (NADH-I, NADH-II, and Nqr). When oxygen is not available, the NADH-I chain encoded by the nuoA-N operon is required to translocate protons and oxidize NADH to NAD+ [19, 20]. Chain I links the NADH ubiquinone electron transfer to the transmembrane transport of protons, leading to the production of a proton motive force that is fundamental for ATP synthesis [21]. In prokaryotic microorganisms, ATP synthesis generally occurs by glycolysis using substrate-level phosphorylation and by the oxidative phosphorylation pathway [11]. In the present study, genes associated with the NADH dehydrogenase I chain, which is involved in the oxidative phosphorylation pathway, displayed a very strong induction at 6 h (Table 2), followed by a reduction at 24 h (Table 5). The expression of chain I subunits (nuo-operon) in the oxidative phosphorylation pathway was increased in KF-treated samples at 6 h. The NADH-I chain is coupled to the denitrification pathway [22, 23]. The upregulation of genes encoding NADH-I chain was paralleled by the increased expression of anr gene involved in controlling P. aeruginosa gene expression under anaerobic conditions, suggesting that KF-treated cells underwent a switch to anaerobic respiration in response to oxidative stress. Zimmermann et al. [24] noted that the anr deletion mutant of P. aeruginosa does not grow anaerobically. In addition, the expression of genes encoding several elements of the ATP-binding cassette transporters (ABCs), which exist in all bacterial species and provide a pathway for substrates to cross the cell membrane [25], was upregulated (Table 1). Interestingly, the growth of P. aeruginosa under KF exposure conditions at two time points led to the increased expression of genes encoding ABC transporters of amino acids, carbohydrates, and inorganic ions (Table 1). As amino acids are key intermediates in bacterial metabolism, the increase in the ABC transporter proteins led to increased amino acid or peptide uptake. In conclusion, to maintain energy consumption, the cell increases the oxidative phosphorylation pathway and the expression of ATP synthase to produce ATP.

During host infection, P. aeruginosa utilizes several systems to acquire iron from the surrounding environment [26]. The iron acquisition mechanisms include the production of siderophores (pyoverdine and pyochelin) and heme uptake [27]. Transcriptomic analysis showed a downregulation of the expression of genes involved in iron acquisition in KF-treated samples at 24 h of P. aeruginosa growth. As shown in Table 5, TonB-dependent siderophore receptor (tonB) and haemeoxygenase (hemO) showed a reduction in the expression level at 24 h. The downregulation of the expression of pchR-encoding elements involved in iron Fe3+ acquisition was also observed. In addition, the expression of genes highly regulated by iron starvation was repressed by KF treatment. These genes encode members of the ECF subfamily, which is mainly associated with extracellular functions that include the regulation of periplasmic stress, iron transport, metal ion efflux systems, alginate secretion, and synthesis of membrane-localized carotenoids [28]. Consequently, the results suggested that KF-treated cells underwent conditions of excess intracellular iron, which led to the downregulation of the expression of genes regulated by the ferric uptake regulator (Fur) required for iron acquisition. Ochsner et al. [29] reported that the Fur protein uses Fe2+ as a cofactor and binds to Fur-Fe2+, resulting in the repression of the genes encoding pyochelin and pyoverdin proteins in iron-replete environments. Furthermore, transcriptomic analysis also showed the downregulation of the expression of genes coding for the components of the DNA replication and repair machinery in P. aeruginosa at 24 h of KF treatment. A superoxide (O2) byproduct is formed by the autoxidation of a variety of reduced electron carriers and redox enzymes [30]. O2 is implicated in the production of oxidative DNA damage by the steady release of iron from storage proteins into the cytosol, and thus, the free iron binds DNA and catalyses electron transfer from the reductant to H2O2 [31, 32]. The resultant ferryl or hydroxyl radical attacks the adjacent DNA [33]. The repression of genes encoding DNA repair proteins was coupled with the repression of genes involved in iron regulation at 24 h, suggesting that KF-treated cells were exposed to an excess concentration of intracellular free iron, leading to either hydroxyl or ferryl radical production, which promotes oxidative DNA damage by increasing the amount of DNA-bound iron. Oxidative DNA damage was also evident by the downregulation of the expression of genes involved in defence (sodM) against reactive oxygen species.

P. aeruginosa pathogenicity depends on the production and secretion of a large variety of virulence factors, including pyocin S2, in response to host environments. pyocin S2 is a protease-sensitive bacteriocin produced by P. aeruginosa that kills sensitive cells by damaging chromosomal DNA through its DNase activity and the inhibition of lipid synthesis [34]. RNA-seq analysis showed reduced expression levels of pyocin S2 protease at 6 h of exposure to KF (Table 3). As shown in Table 5, the growth of P. aeruginosa under K treatment conditions at 24 h led to the decreased expression of genes involved in the LPS biosynthesis process (lpxA, lpxB, waaF, waaG, waaP, PA4998, PA5007, PA5008, and rmlA). LPS is the major component defining the outer membrane of Gram-negative bacteria. The outer membrane is essential for viability and mediates virulence and resistance to toxic and antibacterial agents [35]. Interestingly, a previous study revealed that the waaP gene in P. aeruginosa is required to produce full-length LPS, which is recognized by the outer membrane transport assembly machinery in this bacterium [36]. Therefore, waaP may constitute a good target for the development of novel antipseudomonal agents. Our previous observation is consistent with this finding. Transmission electron microscopy studies have revealed that cells treated with KF exhibit severe membrane damage concurrent with the disruption of membrane integrity, leading to the loss of intracellular material at 24 h of incubation [7]. These results suggest that LPS biosynthesis may be inhibited at 24 h KF exposure. In addition, the MexGHI-OpmD efflux pump system has been implicated in the efflux of xenobiotics, including the antibiotic norfloxacin and the heterocyclic dye acriflavine [37], and the transport of phenazine molecules [38]. Interestingly, the downregulation of the MexGHI-OpmD system observed in the RNA-seq data was coupled with a reduction in the phenazine biosynthesis process KF at 24 h of P. aeruginosa treated with KF (Table 5). The opportunistic pathogen P. aeruginosa is well known for its production of bright blue phenazine pyocyanin, which contributes to the colouration of sputum and pus associated with infections and interferes with multiple host cellular functions [39]. In response to KF treatment, P. aeruginosa repressed the expression of the secretory machinery (Sec system), responsible for the secretion of virulence factors, extracellular degradative enzymes, and other toxins, enabling adaptation to a wide range of ecological niches [40]. Therefore, taken together, these data reveal the marked remodelling of gene transcription characterized by an early and late reduction in the expression of several genes associated with virulence factors of P. aeruginosa in response to KF treatment.

Bacteria can form biofilms on living or nonliving surfaces and can be prevalent in natural, industrial, and hospital settings. Bacterial motility and adhesion are critical for biofilm development [41]. The type IV pili in P. aeruginosa play an important role in the adherence to epithelial cells and microbial intra and interspecies competition, while flagella filament-mediated motility enables bacteria to reach a surface and then divide and spread along the surface [42]. In response to KF treatment at 24 h, the downregulation of type IV and flagellin type B (fliC) genes observed in RNA-seq (Table 5) was paralleled by the decreased expression of genes involved in biofilm formation in P. aeruginosa (Table 6). These findings may indicate that KF treatment affects genes involved in biofilm formation and motility. As a consequence of these combined factors, we thus hypothesise that the swimming and biofilm formation ability of P. aeruginosa would be inhibited under KF treatment conditions.

The treatment of P. aeruginosa with KF for 24 h led to the decreased expression of genes encoding the aminoacyl-tRNA synthetases glutamine, glycine, leucine, lysine, proline, valine, and aspartate. Furthermore, genes associated with the biosynthesis of several amino acids, including histidine, arginine, cysteine, and tryptophan, were also expressed at reduced levels in KF-treated samples at 24 h (Table 5). RNA-seq data showed that the downregulation of the expression of genes hslVU, htpG, and grpE involved in the degradation of unfolded or misfolded proteins that accumulate in the periplasm [43], following heat shock or other stress conditions was coupled with the decreased expression of the clpB gene encoding an ATP-dependent protease, which functions as part of the chaperone network essential for the recovery of stress-induced protein aggregates [44] (Table 6). The altered expression of these genes at two KF exposure time points may be indicative of their essential function in cellular responses to environmental stress. As a consequence of these combined factors, we thus assume that protein synthesis in P. aeruginosa might be affected by KF treatment.

5. Conclusion

The crisis of the antibiotic resistance demands to be met with concerted efforts across many disciplines and areas of expertise. Natural products are mainstays of drugs and still play an essential role in providing chemical diversity, despite a reduced interest shown by pharmaceutical companies. Herein, we could prove efficacy of KF against one of the most notorious pathogen P. aeruginosa. The KF compound is more likely to have multitargets inside the test P. aeruginosa. To the best of our knowledge, the current study is the first report describing the antibacterial effect of KF on P. aeruginosa at the gene expression level through transcriptomic analysis, revealing the regulation of various genes involved in cellular processes that lead to the destabilization of this bacterium. The transcriptomic analysis showed that KF increases the expression of genes involved in the electron transport chain (NADH-I), resulting in the induction of ATP synthesis. KF also increased the expression of genes associated with ATP-binding cassette transporters, flagella, type III secretion system proteins, and DNA replication and repair, which may further affect nutrient uptake, motility, and growth. The major mechanisms through which KF seems to exert its antibacterial effect on P. aeruginosa are by the repression of a broad range of virulence factors associated with LPS biosynthesis, iron homeostasis, cytotoxic pigment pyocyanin production, and motility and adhesion that are representative of an acute P. aeruginosa infection profile. Taken together, the present study is a good demonstration of the therapeutic usefulness of the natural product from plant in validating the traditional medicine, i.e., M. malabathricum, very common in Malaysia. Specifically, attenuations of bacterial virulence factors are likely to be effective solutions in this therapeutic area. Although the current study offers a possible regulatory network of P. aeruginosa induced by KF treatment, further studies will focus on the protein level expression of the target genes. In general, this study has generated scientific evidence that natural product research is perfectly positioned to address and solve the present bacterial resistance crisis and the closely linked antibiotic discovery gap.

Abbreviations

AP:

Adaptation, protection

SFs:

Secreted factors (toxins, enzymes, and alginate)

AABM:

Amino acid biosynthesis and metabolism

T-RNA-PD:

Transcription, RNA processing, and degradation

BCPGCs:

Biosynthesis of cofactors, prosthetic groups, and carriers

TRs:

Transcriptional regulators

CWLC:

Cell wall/LPS/capsule

TPTMD:

Translation, post-translational modification, degradation

CHSPs:

Chaperones and heat shock proteins

TSMs:

Transport of small molecules

CT:

Chemotaxis

TCRSs:

Two-component regulatory systems

DNA-RRMR:

DNA replication, recombination, modification, and repair

HUU:

Hypothetical, unclassified, and unknown

EM:

Energy metabolism

PSEA:

Protein secretion/export apparatus

FAPM:

Fatty acid and phospholipid metabolism

PEs:

Putative enzymes

MA:

Motility and attachment

MPs:

Membrane proteins.

Contributor Information

Mourouge Saadi Alwash, Email: murooj_saadi2000@yahoo.com.

Nazlina Ibrahim, Email: nazlina@ukm.edu.my.

Data Availability

The data used to support the findings of this study are included within the supplementary information files.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  • 1.Rao J., Damron F. H., Basler M., et al. Comparisons of two proteomic analyses of non-mucoid and mucoid Pseudomonas aeruginosa clinical isolates from a cystic fibrosis patient. Frontiers in Microbiology. 2011;2:p. 162. doi: 10.3389/fmicb.2011.00162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Xavier D. E., Picão R. C., Girardello R., Fehlberg L. C. C., Gales A. C. Efflux pumps expression and its association with porin down-regulation and β-lactamase production among Pseudomonas aeruginosa causing bloodstream infections in Brazil. BMC Microbiology. 2010;10(1):p. 217. doi: 10.1186/1471-2180-10-217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lister P. D., Wolter D. J., Hanson N. D. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clinical Microbiology Reviews. 2009;22(4):582–610. doi: 10.1128/CMR.00040-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Pang Z., Raudonis R., Glick B. R., Lin T.-J., Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnology Advances. 2019;37(1):177–192. doi: 10.1016/j.biotechadv.2018.11.013. [DOI] [PubMed] [Google Scholar]
  • 5.El-Mahdy R., El-Kannishy G. Virulence factors of carbapenem-resistant Pseudomonas aeruginosa in hospital-acquired infections in Mansoura, Egypt. Infection and Drug Resistance. 2019;Volume 12:3455–3461. doi: 10.2147/IDR.S222329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Alwash M. S., Ibrahim N., Yaacob A. Bio-guided study on Melastoma malabathricum Linn leaves and elucidation of its biological activities. American Journal of Applied Sciences. 2013;10(8):767–778. doi: 10.3844/ajassp.2013.767.778. [DOI] [Google Scholar]
  • 7.Alwash M. S., Ibrahim F., Ahmad W. Y. Identification and mode of action of antibacterial components from Melastoma malabathricum Linn leaves. American Journal of Infectious Diseases. 2013;9(2):46–58. doi: 10.3844/ajidsp.2013.46.58. [DOI] [Google Scholar]
  • 8.Wilhelm B. T., Landry J.-R. RNA-seq—quantitative measurement of expression through massively parallel RNA-sequencing. Methods. 2009;48(3):249–257. doi: 10.1016/j.ymeth.2009.03.016. [DOI] [PubMed] [Google Scholar]
  • 9.Oliveros J. C. VENNY. An interactive tool for comparing lists with Venn diagrams. 2007. http://bioinfogp.cnb.csic.es/tools/venny/index.html.
  • 10.Hauser A. R. The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nature Reviews Microbiology. 2009;7(9):654–665. doi: 10.1038/nrmicro2199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wang G., Ma F., Chen X., et al. Transcriptome analysis of the global response of Pseudomonas fragi NMC25 to modified atmosphere packaging stress. Frontiers in Microbiology. 2018;9:p. 1277. doi: 10.3389/fmicb.2018.01277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhu M., Zhao J., Kang H., Kong W., Liang H. Modulation of type III secretion system in Pseudomonas aeruginosa: involvement of the PA4857 gene product. Frontier in Microbiology. 2016;7:p. 7. doi: 10.3389/fmicb.2016.00007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Yoon Y., Lee H., Lee S., Kim S., Choi K.-H. Membrane fluidity-related adaptive response mechanisms of foodborne bacterial pathogens under environmental stresses. Food Research International. 2015;72:25–36. doi: 10.1016/j.foodres.2015.03.016. [DOI] [Google Scholar]
  • 14.Arai H. Regulation and function of versatile aerobic and anaerobic respiratory metabolism in Pseudomonas aeruginosa. Frontiers in Microbiology. 2011;2:p. 103. doi: 10.3389/fmicb.2011.00103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Arai H., Kawakami T., Osamura T., Hirai T., Sakai Y., Ishii M. Enzymatic characterization and in vivo function of five terminal oxidases in Pseudomonas aeruginosa. Journal of Bacteriology. 2014;196(24):4206–4215. doi: 10.1128/JB.02176-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Schobert M., Jahn D. Anaerobic physiology of Pseudomonas aeruginosa in the cystic fibrosis lung. International Journal of Medical Microbiology. 2010;300(8):549–556. doi: 10.1016/j.ijmm.2010.08.007. [DOI] [PubMed] [Google Scholar]
  • 17.Zumft W. G. Cell biology and molecular basis of denitrification. Microbiology and Molecular Biology Reviews: MMBR. 1997;61(4):533–616. doi: 10.1128/.61.4.533-616.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yoon S. S., Hennigan R. F., Hilliard G. M., et al. Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Developmental Cell. 2002;3(4):593–603. doi: 10.1016/s1534-5807(02)00295-2. [DOI] [PubMed] [Google Scholar]
  • 19.Torres A., Kasturiarachi N., DuPont M., Cooper V. S., Bomberger J., Zemke A. NADH dehydrogenases in Pseudomonas aeruginosa growth and virulence. Frontiers in Microbiology. 2019;10:p. 75. doi: 10.3389/fmicb.2019.00075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Williams H. D., Zlosnik C., Ryall B. Oxygen, cyanide and energy generation in the cystic fibrosis pathogen Pseudomonas aeruginosa. Advances in Microbial Physiology. 2007;52:1–71. doi: 10.1016/S0065-2911(06)52001-6. [DOI] [PubMed] [Google Scholar]
  • 21.Gurrath M., Friedrich T. Adjacent cysteines are capable of ligating the same tetranuclear iron-sulfur cluster. Proteins. 2004;56(3):556–563. doi: 10.1002/prot.20155. [DOI] [PubMed] [Google Scholar]
  • 22.Richardson D. J. Bacterial respiration: a flexible process for a changing environment. Microbiology. 2000;146(3):551–571. doi: 10.1099/00221287-146-3-551. [DOI] [PubMed] [Google Scholar]
  • 23.Arai H., Kodama I. J., Igarashi Y. Cascade regulation of the two CRP/FNR-related transcriptional regulators (ANR and DNR) and the denitrification enzymes in Pseudomonas aeruginosa. Molecular Microbiology. 1997;25(6):1141–1148. doi: 10.1046/j.1365-2958.1997.5431906.x. [DOI] [PubMed] [Google Scholar]
  • 24.Zimmermann A., Reimmann C., Galimand M., Haas D. Anaerobic growth and cyanide synthesis of Pseudomonas aeruginosa depend on anr, a regulatory gene homologous with fnr of Escherichia coli. Molecular Microbiology. 1991;5(6):1483–1490. doi: 10.1111/j.1365-2958.1991.tb00794.x. [DOI] [PubMed] [Google Scholar]
  • 25.Davidson A. L., Dassa E., Orelle C., Chen J. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiology and Molecular Biology Reviews. 2008;72(2):317–364. doi: 10.1128/MMBR.00031-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Cornelis P. Iron uptake and metabolism in pseudomonads. Applied Microbiology and Biotechnology. 2010;86(6):1637–1645. doi: 10.1007/s00253-010-2550-2. [DOI] [PubMed] [Google Scholar]
  • 27.Mislin G. L. A., Schalk I. J. Siderophore-dependent iron uptake systems as gates for antibiotic Trojan horse strategies against Pseudomonas aeruginosa. Metallomics. 2014;6(3):408–420. doi: 10.1039/c3mt00359k. [DOI] [PubMed] [Google Scholar]
  • 28.Potvin E., Sanschagrin F., Levesque R. C. Sigma factors in Pseudomonas aeruginosa. FEMS Microbiology Reviews. 2008;32(1):38–55. doi: 10.1111/j.1574-6976.2007.00092.x. [DOI] [PubMed] [Google Scholar]
  • 29.Ochsner U. A., Vasil A. I., Vasil M. L. Role of the ferric uptake regulator of Pseudomonas aeruginosa in the regulation of siderophores and exotoxin A expression: purification and activity on iron-regulated promoters. Journal of Bacteriology. 1995;177(24):7194–7201. doi: 10.1128/jb.177.24.7194-7201.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Imlay J. A., Fridovich I. Assay of metabolic superoxide production in Escherichia coli. The Journal of Biological Chemistry. 1991;266(11):6957–6965. [PubMed] [Google Scholar]
  • 31.Imlay J. A. Pathways of oxidative damage. Annual Review of Microbiology. 2003;57(1):395–418. doi: 10.1146/annurev.micro.57.030502.090938. [DOI] [PubMed] [Google Scholar]
  • 32.Zheng M., Doan B., Schneider T. D., Storz G. OxyR and SoxRS regulation of fur. Journal of Bacteriology. 1999;181(15):4639–4643. doi: 10.1128/jb.181.15.4639-4643.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Keyer K., Imlay J. A. Superoxide accelerates DNA damage by elevating free-iron levels. Proceedings of the National Academy of Sciences. 1996;93(24):13635–13640. doi: 10.1073/pnas.93.24.13635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sano Y., Matsui H., Kobayashi M., Kageyama M. Molecular structures and functions of pyocins S1 and S2 in Pseudomonas aeruginosa. Journal of Bacteriology. 1993;175(10):2907–2916. doi: 10.1128/jb.175.10.2907-2916.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Balasubramanian D., Mathee K. Comparative transcriptome analyses of Pseudomonas aeruginosa. Human Genomics. 2009;3(4):349–361. doi: 10.1186/1479-7364-3-4-361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Delucia A. M., Six D. A., Caughlan R. E., et al. Lipopolysaccharide (LPS) inner-core phosphates are required for complete LPS synthesis and transport to the outer membrane in Pseudomonas aeruginosa PAO1. mBio. 2011;2(4) doi: 10.1128/mBio.00142-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sekiya H., Mima T., Morita Y., Kuroda T., Mizushima T., Tsuchiya T. Functional cloning and characterization of a multidrug efflux pump, mexHI-opmD, from a Pseudomonas aeruginosa mutant. Antimicrobial Agents and Chemotherapy. 2003;47(9):2990–2992. doi: 10.1128/aac.47.9.2990-2992.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sakhtah H., Koyama L., Zhang Y., et al. The Pseudomonas aeruginosa efflux pump MexGHI-OpmD transports a natural phenazine that controls gene expression and biofilm development. Proceedings of the National Academy of Sciences. 2016;113(25):E3538–E3547. doi: 10.1073/pnas.1600424113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Caldwell C. C., Chen Y., Goetzmann H. S., et al. Pseudomonas aeruginosa exotoxin pyocyanin causes cystic fibrosis airway pathogenesis. The American Journal of Pathology. 2009;175(6):2473–2488. doi: 10.2353/ajpath.2009.090166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ma Q., Zhai Y., Schneider J. C., Ramseier T. M., Saier M. H. Protein secretion systems of Pseudomonas aeruginosa and P. fluorescens. Biochimica et Biophysica Acta (BBA)—Biomembranes. 2003;1611(1-2):223–233. doi: 10.1016/s0005-2736(03)00059-2. [DOI] [PubMed] [Google Scholar]
  • 41.O’Toole G., Kaplan H. B., Kolter R. Biofilm formation as microbial development. Annual Review of Microbiology. 2000;54(1):49–79. doi: 10.1146/annurev.micro.54.1.49. [DOI] [PubMed] [Google Scholar]
  • 42.Pratt L. A., Kolter R. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Molecular Microbiology. 1998;30(2):285–293. doi: 10.1046/j.1365-2958.1998.01061.x. [DOI] [PubMed] [Google Scholar]
  • 43.Isaac D. D., Pinkner J. S., Hultgren S. J., Silhavy T. J. The extracytoplasmic adaptor protein CpxP is degraded with substrate by DegP. Proceedings of the National Academy of Sciences. 2005;102(49):17775–17779. doi: 10.1073/pnas.0508936102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Nde C. W., Jang H.-J., Toghrol F., Bentley W. E. Toxicogenomic response of Pseudomonas aeruginosa to ortho-phenylphenol. BMC Genomics. 2008;9(1):p. 473. doi: 10.1186/1471-2164-9-473. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used to support the findings of this study are included within the supplementary information files.


Articles from International Journal of Microbiology are provided here courtesy of Wiley

RESOURCES