Modulation of the functions of myeloid‐derived suppressor cells : a new strategy of hydrogen sulfide anti‐cancer effects

Abstract

Background and Purpose

Myeloid‐derived suppressor cells (MDSCs) represent a major obstacle to cancer treatment, as they negatively regulate anti‐tumour immunity through the suppression of tumour‐specific T lymphocytes. Thus, the efficacy of immunotherapies may be improved by targeting MDSCs. In this study, we assessed the ability of hydrogen sulfide (H₂S), a gasotransmitter whose anti‐cancer effects are well known, to inhibit the accumulation and immunosuppressive functions of MDSCs in melanoma.

Experimental Approach

Effects of H₂S on the host immune response to cancer were evaluated using an in vivo syngeneic model of murine melanoma. B16F10‐melanoma‐bearing mice were treated with the H₂S donor, diallyl trisulfide (DATS) and analysed for content of MDSCs, dendritic cells (DCs) and T cells. Effects of H₂S on expression of immunosuppressive genes in MDSCs and on T cell proliferation were evaluated.

Key Results

In melanoma‐bearing mice, DATS inhibited tumour growth, and this effect was associated with a reduction in the frequency of MDSCs in the spleen, in the blood as well as in the tumour micro‐environment. In addition, we found that CD8⁺ T cells and DCs were increased. Furthermore, DATS reduced the immuno‐suppressive activity of MDSCs, restoring T cell proliferation.

Conclusions and Implications

The H₂S donor compound, DATS, inhibited the expansion and the suppressive functions of MDSCs, suggesting a novel role for H₂S as a modulator of MDSCs in cancer. Therefore, H₂S donors may provide a novel approach for enhancing the efficacy of melanoma immunotherapy.

Linked Articles

This article is part of a themed section on Hydrogen Sulfide in Biology & Medicine. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v177.4/issuetoc

What is already known

• Myeloid‐derived suppressor cells are responsible for resistance to immunotherapy in patients with melanoma

• Hydrogen sulfide donors, such as diallyl trisulfide, suppress proliferation of cancer cells

What this study adds

• In melanoma‐bearing mice, diallyl trisulfide inhibited tumour growth and expansion of myeloid‐derived suppressor cells

• Diallyl trisulfide also inhibited the immuno‐suppressive effects of myeloid‐derived suppressor cells, restoring T cell proliferation

What is the clinical significance

• Our data suggest a new strategy to inhibit differentiation and function of myeloid‐derived suppressor cells

• Our data support the development of H₂S‐based drugs to enhance T cell‐mediated melanoma immunotherapy.

Abbreviations

ARG1

arginase 1

CBS

cystathionine‐β synthase

CSE

cystathionine‐γ lyase

DATS

diallyl trisulfide

iNOS

inducible NO synthase

MDSCs

myeloid‐derived suppressor cells

3‐MST

3‐mercaptopyruvate sulfurtransferase

1. INTRODUCTION

Aberrant differentiation of myeloid cells is one of the hallmarks of cancer. Expansion and accumulation of dysregulated and functionally impaired immune cells in the tumour micro‐environment lead to cancer progression and failure of immunotherapeutic attempts to control tumour growth (Kerkar & Restifo, 2012). Myeloid‐derived suppressor cells (MDSCs) represent the major components of this immunosuppressive network mediating cancer‐associated immune evasion. Above all else, MDSCs are directly implicated in the promotion of tumour cell survival, angiogenesis, tumour cell invasion, and metastases (Condamine, Ramachandran, Youn, & Gabrilovich, 2015). MDSCs are a heterogeneous population of immature myeloid cells with potent immunosuppressive activity based on inhibition of tumour‐specific CD8⁺ cytotoxic T lymphocytes. The main immunosuppressive mechanism driven by MDSCs involves the http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=2509 pathway. In particular, a key role for l https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=721 metabolism, shifted toward http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1244 (http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1244) and http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1250 (http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1250) has been demonstrated in these cells (Gabrilovich & Nagaraj, 2009). Thus, a decreased availability of l https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=721 combined with the accumulation of NO derivatives (NO₂ ⁻, NO₃ ⁻, and N₂O₃) triggers the inhibition of T cell function and proliferation (Bronte, Serafini, Mazzoni, Segal, & Zanovello, 2003).

The non‐essential amino acid l http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4782 has recently gained attention in the modulation of the immune response. Indeed, L‐cysteine is required for protein synthesis and cell proliferation as well as for antigen presentation and subsequent T cell activation (Yan & Banerjee, 2010). Furthermore, both l‐cysteine and l‐arginine are the precursors of two important gasotransmitters: http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=9532 (H₂S) and NO, respectively. The former is produced in various mammalian cells and tissues by three principal enzymes: https://www.guidetopharmacology.org/GRAC/FamilyDisplayForward?familyId=279#1443, https://www.guidetopharmacology.org/GRAC/FamilyDisplayForward?familyId=279#1444 and https://www.guidetopharmacology.org/GRAC/FamilyDisplayForward?familyId=279#1446 H₂S is an endogenous signalling molecule with a wide range of cellular and molecular targets (Wallace & Wang, 2015). One of the most extensively investigated mechanisms of H₂S is its antioxidant effects. It acts as a dominant redox regulator of several aspects of physiological and pathophysiological functions (Stein & Bailey, 2013). Thus, changing the redox status of the environment could alter T cell activity. In particular, we have hypothesized that MDSCs in their effector state deplete the H₂S necessary to support T cell activation and function.

We used an in vivo syngeneic model of murine melanoma to investigate the ability of H₂S to modulate the host immune response to cancer. Recently, an increased number of immunosuppressive MDSCs has been associated with progression and recurrence in melanoma patients (Jordan et al., 2013). As immunotherapy is the most promising systemic therapy for patients with advanced melanoma, the development of new drugs targeting MDSCs may represent an useful strategy to solve this unmet need. Naturally occurring H₂S donors, such as diallyl trisulfide (DATS) and acetyl deacylasadisulfide, induce apoptosis in human melanoma cells and inhibit metastatic melanoma development and progression (De Cicco et al., 2017; Panza et al., 2015).

In the present study, we confirmed the anti‐tumour effect of DATS and investigated the ability of the H₂S‐donor to modify the profile of immune cells in the tumour micro‐environment, focusing on MDSCs. The results show that oral administration of DATS in melanoma‐bearing mice decreased the numbers of MDSCs in the tumour micro‐environment and in peripheral lymphoid organs, as well as inhibiting their immunosuppressive activity. In addition, increased levels of H₂S restored an anti‐tumour immune response promoting T cell proliferation, which resulted in a marked inhibition of tumour growth. Therefore, H₂S‐donors may provide a new therapeutic strategy for enhancing the efficacy of T cell‐mediated melanoma immunotherapy.

2. METHODS

2.1. Animals

All animal care and experimental procedures were approved by the Italian Ministry in accordance with Italian (DL 26/2014) and European (Directive 2010/63/EU) regulations on the protection of animals used for experimental and other scientific purposes. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010; McGrath & Lilley, 2015) and with the recommendations made by the British Journal of Pharmacology. All the animals were housed at the Animal Research Facility of the Department of Pharmacy of the University of Naples Federico II.

Female C57BL/6J mice, 6 weeks old and weighing 18–20 g, were purchased from Charles River Laboratories (Germany). They were subdivided in groups of five animals in clear transparent plastic cages with autoclaved dust‐free sawdust bedding. They were fed a pelleted diet and had unrestricted access to food and drinking water. The light/dark cycle in the room consisted of 12/12 hr with artificial light. Mice were killed by CO₂ inhalation.

2.2. Cell lines and media

The murine melanoma cell line B16F10 (ICLC Cat# ATL99010, RRID:CVCL_0159) was purchased from IRCCS AOU San Martino – IST (Genova, Italy) and was cultured in DMEM containing 10% FBS, 2 mmol·L⁻¹ l‐glutamine, 100 μmol·L⁻¹ nonessential amino acids, penicillin (100 U·ml⁻¹), streptomycin (100 μg·ml⁻¹), and 1 mmol·L⁻¹ sodium pyruvate (all from Sigma‐Aldrich, Milan, Italy). Cells were grown at 37°C in a humidified incubator under 5% CO₂.

2.3. Induction of subcutaneous melanoma

The B16F10 syngeneic murine melanoma model has been widely used to study the mechanisms of melanoma development and progression and to evaluate the effect of any candidate drug (McKinney & Holmen, 2011). B16F10 murine melanoma cells (1 × 10⁵) in 100‐μl saline were injected subcutaneously into the right flank of C57BL/6 mice (7 weeks old). Animals were randomly divided into two groups of eight animals each: one control group and one treatment group. The control group was treated with vehicle (0.5% carboxymethyl cellulose/0.1% DMSO in double distilled water) whereas the other group received DATS (50 mg· kg⁻¹), as previously described (Panza et al., 2015). Vehicle or DATS were administered by oral gavage every day. Treatments were started immediately after the injection of the tumour cells and continued until Day 21. All efforts were made to minimize suffering. Mice were observed daily and humanely killed by CO₂ inhalation if a single subcutaneous tumour exceeded 1.5 cm in diameter or mice showed signs of metastatic cancer. Tumour sizes were measured using a digital caliper, and tumour volumes were calculated using the following equation: tumour volume = π/6(D1 × D2 × D3) where D1 = length; D2 = width; D3 = height and expressed as cm³. Drug preparation, treatment, and animal data collection were conducted blindly and independently by two investigators.

2.4. Preparation of single cell suspensions from spleen, tumour, and peripheral blood of melanoma‐bearing mice.

Spleens were harvested and disrupted mechanically to prepare single cell suspensions, which were then incubated in red blood cell (RBC) lysis buffer (Biolegend, San Diego, CA) for 5 minutes at room temperature. Single cell suspensions from tumour tissue were prepared using the GentleMACS single cell isolation protocol (Miltenyi Biotec, Bergisch Gladbach, Germany). Briefly, tumours were isolated and minced into small pieces followed by a mechanical dissociation step using the GentleMACS dissociator (Miltenyi Biotec, Bergisch Gladbach, Germany). Samples were then incubated for 40 min at 37°C with the following enzymes: collagenase I (10,000 U·ml⁻¹) and dispase II (32 mg·ml⁻¹). After the last mechanical disruption step, the digested tumours were harvested and filtered (over a 70‐μM nylon filter), and RBCs were lysed by adding RBC buffer. Whole blood was collected in heparinized tubes by cardiac puncture, and leukocytes were isolated by using erythrocyte sedimentation followed by two rounds of lysis with RBC buffer. The resulting cells from spleen, tumour, and blood were resuspended in PBS with 1% BSA and counted with a haemocytometer and Trypan blue.

2.5. Flow cytometry

Aliquots of 5 × 10⁵ cells were incubated with anti‐Fc receptor (αCD16/32; Thermo Fisher Scientific Cat# 14–0161, RRID:AB_467135) and then stained using the following panel of monoclonal antibodies (mAbs) to murine cell surface molecules (all from eBiosciences Inc., San Diego, CA): PerCP‐Cy5.5‐conjugated anti‐CD11b (Thermo Fisher Scientific Cat# 45‐0112‐82, RRID:AB_953558), PE‐conjugated anti‐Ly6G (Thermo Fisher Scientific Cat# 12‐9668‐80, RRID:AB_2572719), Alexa Fluor 488‐conjugated anti‐Ly6C (Thermo Fisher Scientific Cat# 53‐5932‐80, RRID:AB_2574426), APC‐conjugated anti‐CD45 (Thermo Fisher Scientific Cat# 17‐0451, RRID:AB_469393), Alexa Fluor 488‐conjugated anti‐CD11c (Thermo Fisher Scientific Cat# 53‐0114, RRID:AB_469902), APC‐coniugated anti‐F4/80 (Thermo Fisher Scientific Cat# 17‐4801, RRID:AB_469452), FITC‐conjugated anti‐CD3 (Thermo Fisher Scientific Cat# 11‐0031, RRID:AB_464881), and PerCP‐Cy5.5‐conjugated anti‐CD8 (Thermo Fisher Scientific Cat# 45‐0081‐82, RRID:AB_1107004). Flow cytometry and data analysis were performed by using a two‐laser equipped FACSCalibur apparatus and the CellQuest analysis software (Becton Dickinson, Mountain View, CA).

2.6. Proliferation assay

Splenocytes from healthy C57BL6 mice, depleted of red cells, were placed in triplicates into U‐bottom 96‐well plates (3 × 10⁵ per well) and stimulated with coated 3 μg·ml⁻¹ anti‐CD3 (BioLegend Cat# 100238, RRID:AB_2561487) antibody and 2 μg·ml⁻¹ anti‐CD28 antibody (BioLegend Cat# 102112, RRID:AB_312877). MDSCs were purified from the spleen of C57BL6 melanoma‐bearing mice using mouse MDSC isolation kits (Miltenyi Biotec, Bergisch Gladbach, Germany) according to the manufacturer's protocol and then added to splenocytes at different ratio. Cells were cultured in a humidified 5% CO₂ atmosphere at 37°C for 72 hr, and [³H]‐thymidine (1 μCi per well; Promega) was added 18 hr before harvesting. [³H]‐thymidine uptake was counted using a scintillation counter (Beckman Coulter, Brea, CA, USA) and expressed as counts per minute (CPM).

2.7. Fluorescence measurement of H₂S

The fluorescent dye WSP‐1 (Cayman Chemical, Ann Arbor, MI, USA) was used to assess H₂S levels in the plasma of C57BL/6 melanoma‐bearing mice or in the supernatant of BM‐MDSCs. WSP‐1 (100 μM) fluorescence was determined (Ex_465nm, Em_515nm) using GloMax®‐Multi Detection System microplate reader (Promega, Milan, Italy) at 30 min.

2.8. Western blot analysis

The immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology. Whole‐cell extracts were prepared from melanoma tissue homogenate, as previously described (Panza et al., 2015). The protein concentration was measured by the Bradford method (Bio‐Rad, Milan, Italy). Equal amounts of protein (50 μg per sample) were separated by SDS‐PAGE and blotted onto nitrocellulose membranes (Trans‐Blot Turbo Transfer Starter System, Biorad). The membranes were blocked for 2 hr in 5% low‐fat milk in PBS with 0.1% Tween 20 (PBST) at room temperature. Then the filters were incubated with the following primary antibodies: anti‐CSE (Proteintech Group Cat# 12217‐1‐AP, RRID:AB_2087497; diluted 1:1,000), anti‐CBS (Proteintech Group Cat# 14787‐1‐AP, RRID:AB_2070970; diluted 1:1,000), and anti‐β‐actin (Santa Cruz Biotechnology Cat# sc‐47778 HRP, RRID:AB_2714189; diluted 1:5,000), overnight at 4°C. The membranes were washed three times with PBST and then incubated with anti‐mouse (Santa Cruz Biotechnology Cat# sc‐2005, RRID:AB_631736; diluted 1:2,000) or anti‐rabbit (Jackson ImmunoResearch Labs Cat# 111‐035‐144, RRID:AB_2307391; diluted 1:5,000) HRP‐conjugated antibodies for 2 hr at room temperature. The immune complexes were visualized by the ECL chemiluminescence method and acquired by ChemiDoc™ MP Imaging System (Bio‐Rad, Milan, Italy).

2.9. Ex vivo generation of MDSCs and flow cytometry

Bone marrow (BM) cells were obtained from femurs and tibias of C57BL/6 mice, and the RBCs were lysed. One million cells were seeded into six‐well plates in RPMI 1640 medium supplemented with 10% FBS, 10 ng·ml⁻¹ http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4942, 10 ng·ml⁻¹ http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4996 (both Miltenyi Biotec, Bergisch Gladbach, Germany), and 2‐ME 50 μM supplemented with 30% v/v of B16F10 cell‐derived conditioning medium (CM). The cultures were maintained at 37°C in 5% CO₂‐humidified atmosphere. On Day 3 of culture, floating cells were gently removed, and fresh medium with cytokines, 30% v/v of B16F10‐CM with or without DATS 30 μM, was added. Cells were collected on Day 5 and analysed by flow cytometry. For MDSCs staining, cells were incubated with Alexa Fluor 488‐conjugated anti‐Ly6C, PerCP‐Cy5.5‐conjugated anti‐CD11b, and PE‐conjugated anti‐Ly6G antibodies for 30‐min at 4°C. For dendritic cells staining, cells were incubated with Alexa Fluor 488‐conjugated anti‐CD11c, PerCP‐Cy5.5‐conjugated anti‐CD11b, and APC‐conjugated anti‐CD45 antibodies for 30 min at 4°C. For intracellular staining of ARG1 and iNOS, cells were fixed, permeabilized with Intracellular Fixation & Permeabilization Buffer (eBiosciences), washed with a 1× Permeabilization Buffer (eBiosciences), and stained with APC‐conjugated anti‐ARG1 (R&D System RRID:AB_2810265) and PE‐Cyanine7‐conjugated anti‐NOS2 (Thermo Fisher Scientific Cat# 25–5920‐82, RRID:AB_2573499). After washing, the samples were analysed using BriCyte E6 (Mindray, P.R. China).

2.10. RNA purification and quantitative real‐time PCR (qPCR)

Total RNA was isolated from MDSCs, purified from the spleen as above described, or from melanoma tissue, by using TRI‐Reagent (Sigma‐Aldrich, Milan, Italy), according to the manufacturer's instructions, followed by spectrophotometric quantization. Final preparation of RNA was considered DNA‐ and protein‐free if the ratio between readings at 260/280 nm was ≥1.7. Isolated mRNA was reverse‐transcribed by use of iScript Reverse Transcription Supermix for RTqPCR (Bio‐Rad, Milan, Italy). Then quantitative real‐time‐PCR was performed using CFX384 real‐time PCR detection system (Bio‐Rad, Milan, Italy). Primer sequences were as follows:

• ARG1: 5′‐CTGGTTGTCAGGGGAGTGTT‐3′; GTGAAGAACCCACGGTCTGT‐3′

• iNOS: 5′‐CGAAACGCTTCACTTCCAA‐3′; 5′‐TGAGCCTATATTGCTGTGGCT‐3′

• https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4975: 5′‐CGGAAACAACTCCTTGGAAA‐3′; 5′‐AAGTGTGGCCAGCCTTAGAA‐3′

• http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1441(HMOX‐1): 5′‐GCCGTGTAGATATGGTACAAGGA‐3′; 5′‐AAGCCGAGAATGCTGAGTTCA‐3′

• GCLM: 5′‐AGGAGCTTCGGGACTGTATCC‐3′; 5′‐GGGACATGGTGCATTCCAAAA‐3′

• GCLC: 5′‐GTTGGGGTTTGTCCTCTCCC‐3′; 5′‐GGGGTGACGAGGTGGAGTA‐3′

• β‐actin: 5′‐TACCACCATGTACCCAGGCA‐3′; 5′‐CTCAGGAGGAGCAATGATCTTGA‐3′

Samples were amplified in triplicate using SYBR Green master mix kit (Bio‐ Rad, Milan, Italy). A non‐template control blank for each primer pair was used to control for contamination or primer dimers formation, and the Ct value for each experimental group was determined. The β‐actin housekeeping gene was used as an internal control to normalize the Ct values, using the 2^−ΔCt formula.

2.11. Measurement of NO production in BM‐MDSCs

Equal volumes (100 μl) of supernatants from cultures of BM‐MDSCs were mixed with Greiss reagent (1% sulfanilamide in 5% phosphoric acid and 0.1% N‐1‐naphthylethylenediamine dihydrochloride in double‐distilled water). After incubation at room temperature for 10 min, the absorbance at 550 nm was measured using a microplate photometer reader (Multiskan FC, Thermo Scientific™, Waltham, Massachusetts, USA). Nitrite concentrations were determined by comparing the absorbance values for the test samples with a standard curve generated by a serial dilution of 0.16‐mM sodium nitrite.

2.12. MTT assay

B16F10 cells were seeded on 96‐well plates (2 × 10³ cells per well) and treated with DATS (10–100 μM). After 48 hr, 25 μl of 3‐(4,5‐dimethyl‐2‐thiazolyl)‐2,5‐diphenyl‐2H‐tetrazolium bromide (MTT; Sigma, Milan, Italy; 5 mg/ml in saline) was added to each well. Cells were then incubated for an additional 3 hr at 37°C. After this time interval, cells were lysed, and dark blue crystals were solubilized with a solution containing 50% N,N‐dimethyl formamide and 20% SDS with an adjusted pH of 4.5. The OD of each well was measured at 620 nm with a microplate photometer reader (Multiskan FC, Thermo Scientific™, Waltham, Massachusetts, USA).

2.13. Apoptosis assay

The apoptosis of B16F10 cells was assessed by flow cytometry using annexin V‐FITC/PI staining. Briefly, the cells were seeded into six‐well plates and incubated overnight. DATS 100 μM was added to the cells and incubated for 48 hr. The cells were then collected, washed, and resuspended in binding buffer. The apoptotic cells were identified by annexin V‐FITC and PI‐PE double staining using the annexin V‐FITC apoptosis detection kit (Thermo Fisher Scientific Cat# BMS500FI/100, RRID:AB_2575598) according to the manufacturer's instructions. Following the annexin V and PI staining, the cells were subjected to flow cytometric analysis. A minimum of 20,000 events for each sample was collected, and data were analysed using BriCyte E6 (Mindray, P.R. China).

2.14. Data and statistical analysis

Data are expressed as mean ± SEM. Statistical analysis was performed when group numbers were n ≥ 5. Data were analysed with GraphPad Prism 6.0 software program (GraphPad Software Inc., San Diego, CA, USA). Statistical significance between two groups was determined by unpaired Student's t test. A value of P < .05 was considered statistically significant. The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018).

2.15. Materials

DATS (LKT Laboratories) was diluted in DMSO to produce a stock solution of 10 mM for in vitro experiments. For the treatment in mice, DATS was dissolved in 0.5% carboxymethyl cellulose/0.1% DMSO in double‐distilled water and administered at the dose of 50 mg·kg⁻¹.

2.16. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2017/18 (Alexander et al., 2017).

3. RESULTS

3.1. DATS inhibits tumour growth of B16F10‐bearing mice by stimulating the production of H₂S

C57BL/6 mice were injected subcutaneously with 1 × 10⁵ B16F10 melanoma cells and treated daily with DATS (50 mg·kg⁻¹) or vehicle, for 21 days. As shown in Figure 1a, DATS‐treated mice displayed a significant inhibition of tumour growth of about 75% as compared to the vehicle control group. Western blot analysis of whole tumour lysates showed a significant increase of CSE and CBS expression in melanoma samples following DATS treatment with a greater effect on CSE expression (Figure 1b,c). In addition, an enhancement of circulating H₂S levels was observed in the plasma of treated mice compared to untreated mice (Figure 1d), confirming that H₂S generation promoted the anti‐tumour effects of DATS in this melanoma model.

Figure 1.

(a) B16F10‐melanoma‐bearing mice were treated daily (os) with DATS (50 mg·kg⁻¹) or vehicle (untreated) as indicated. DATS significantly reduced tumour volume compared to untreated mice in a time‐dependent manner. Results are presented as mean ± SEM (n = 8). *P < .05, significantly different from untreated. (b, c) Representative CBS and CSE expression as determined by western blot in melanoma tissues excised from melanoma‐bearing mice after 21 days (n = 6). β‐actin was used as loading control. Quantitative analysis of the CSE/β‐actin and CBS/β‐actin ratio, expressed as a percentage of the control. (d) H₂S production in the plasma of melanoma‐bearing mice was evaluated following incubation with WSP‐1 (100 μM) for 30 min. Data are reported as fluorescence units (n = 6). *P < .05, significantly different from untreated. DATS, diallyl trisulfide

3.2. DATS reduces MDSCs subsets in tumour, spleen, and peripheral blood of B16F10‐bearing mice

Tumour progression is strongly sustained by immunosuppressive cells such as the MDSCs. These cells, by inhibiting cytotoxic T cell proliferation and activation, induce failure of the anti‐tumour immune response and lead to chemoresistance (Groth et al., 2019). Thus, we hypothesized that the anti‐tumour effect displayed by DATS was related not only to its pro‐apoptotic effect on B16F10 cells (Figure S1) but also to its ability to modify the immune cell composition in melanoma‐bearing mice. MDSCs have been previously identified and classified, based on the expression of the cell surface markers CD11b, Ly6C and Ly6G, in granulocytic (gr, Ly6C^lowLy6G⁺C) and monocytic (mo, Ly6C^highLy6G⁻) subsets (Bronte et al., 2016). In agreement with earlier work, we found that melanoma growth was associated with substantial accumulation of MDSCs subsets in tumour, spleen, and peripheral blood of mice. Three weeks after tumour cell injection, almost the half of CD45^+/CD11b⁺ splenocytes had the phenotype of MDSCs with equal proportions of mo‐MDSCs and gr‐MDSCs (about 20%; Figure 2a). However, in the blood of melanoma‐bearing mice, the frequency of gr‐MDSCs was significantly higher (>30%; Figure 2b) whereas in the tumour, about 15% of tumour‐infiltrating CD45⁺/CD11b⁺ cells displayed mononuclear features (Ly6C^highLy6G⁻) and less than 5% were granulocytic (Ly6C^lowLy6G⁺; Figure 2c). Treatment of melanoma‐bearing mice with DATS led to a significant modification of MDSCs accumulation in the different regions. In the spleen, a significant reduction in the percentage of both mo‐MDSCs and gr‐MDSCs, by 52% and 24%, respectively, was observed (Figure 2a). Conversely, in the peripheral blood, only the granulocytic fraction was significantly depressed (Figure 2b) whereas, in the tumour micro‐environment, treatment with DATS significantly decreased only the mo‐MDSCs subset (Figure 2c).

Figure 2.

Flow cytometric analysis and relative quantification of mo‐MDSCs (R1: Ly6C^highLy6G⁻) and gr‐MDSCs (R2: Ly6C^lowLy6G⁺), gated within CD45⁺/CD11b⁺ cells, in (a) spleen, (b) blood, and (c) tumour of melanoma‐bearing mice after 21 days of treatment with DATS or vehicle (untreated). Data are shown as mean ± SEM (n = 8 per group). *P < .05, significantly different from untreated. A number of 20,000 total events was recorded. DATS, diallyl trisulfide; MDSC, myeloid‐derived suppressor cell

3.3. DATS restores anti‐tumour immune response in B16F10‐bearing mice

Dendritic cells (DCs) are antigen presenting cells (APCs) that play an important role in shaping the host response to tumours (Dhodapkar, Dhodapkar, & Palucka, 2008). Thus, to better elucidate the effects of DATS on the composition and function of immune cells in murine melanoma, we analysed the percentage of DCs, identified by the surface marker CD11c, in peripheral blood, spleen, and tumour of melanoma‐bearing mice. We observed a significant enrichment of DCs only in the spleen of DATS‐treated mice, compared with those in vehicle treated animals (Figure 3a). This effect was related to an increase in CD8⁺ T cell frequencies in the spleen of DATS‐treated mice, compared with untreated mice (Figure 3b). However, the number of both tumour‐infiltrating and circulating CD8⁺ T cells was not significantly modified by DATS (Figure 3c,d). Finally, we did not observe differences in the percentage of F4/80 macrophages in any compartment analysed (data not shown).

Figure 3.

(a) Percentage of DCs defined as CD45⁺/CD11c⁺ in spleen, blood, and tumour of melanoma‐bearing mice after 21 days of treatment with DATS or vehicle (untreated). Flow cytometric analysis and relative quantification of CD8⁺ T cells, gated within the CD45⁺/CD3⁺ cells, in (b) spleen, (c) blood, and (d) tumour of melanoma‐bearing mice after 21 days of treatment with DATS or vehicle (untreated). Data are shown as mean ± SEM (n = 8 per group). *P < .05, significantly different from untreated. A number of 20,000 total events was recorded. DATS, diallyl trisulfide; DC, dendritic cell

3.4. H₂S decreases expression of immunosuppressive genes and functions in MDSCs subsets and in BM‐MDSCs

It is well known that MDSCs suppress CD8⁺ T cell function and proliferation, mostly via expression of several genes related to immunosuppressive activity such as the enzymes iNOS and ARG1 and cytokines such as IL‐10, as well as through the production of reactive nitrogen species (NO_x) and ROS (Bronte et al., 2003). Thus, in order to elucidate the mechanisms underlying the effects of DATS on MDSCs, we isolated and purified mo‐MDSCs and gr‐MDSCs from the spleen of B16F10 melanoma‐bearing mice. The mo‐MDSCs displayed significant higher ARG1 and IL‐10 mRNA expression, compared with their granulocytic counterparts (Figure 4a). In fact, in mo‐MDSCs, ARG1 levels were almost 13‐fold higher as compared with gr‐MDSCs (Figure 4a). Moreover, IL‐10 was expressed only in the monocytic subset. On the other hand, iNOS mRNA expression was significantly higher in gr‐MDSCs as compared to mo‐MDSCs (Figure 4a). Interestingly, in MDSCs subsets isolated from DATS‐treated mice, the expression of all these immunosuppressive genes was down‐regulated as compared with MDSCs subsets isolated from untreated mice (Figure 4b). Noteworthy, following treatment with DATS, an increased expression of several genes with antioxidant activity was evident in murine melanoma tissues. DATS substantially increased the expression of both glutamate‐cysteine ligase modifier and catalytic subunits (GCLM and GCLC) and of http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1441 whose primary function is to maintain the cellular redox balance and to reduce ROS levels (Figure 4c). Inhibition of antigen‐specific CD8⁺ T cells is the main function of MDSCs. To assess the effect of DATS on MDSCs suppression of T cell responses, gr‐ and mo‐MDSCs were isolated from spleens of melanoma‐bearing mice and cultured with CD3/CD28 activated splenocytes. MDSCs isolated from untreated mice significantly reduced T cell proliferation in a dose‐dependent manner. We observed that, at the highest dilution rate (25%), mo‐MDSCs and gr‐MDSCs suppressed T cell proliferation by 30% and 20%, respectively. However, both mo‐ and gr‐MDSCs isolated from DATS‐treated mice caused less suppression inducing a significant restoration of T cell proliferation (Figure 4d,e).

Figure 4.

(a) ARG1, IL‐10, and iNOS mRNA levels evaluated by real‐time RT‐PCR in mo‐MDSCs and gr‐MDSCs sorted from the spleen of untreated melanoma‐bearing mice after 21 days. *P < .05, significantly different from levels in gr‐MDSCs. (b) ARG1, IL‐10, and iNOS mRNA levels evaluated by real‐time RT‐PCR in mo‐MDSCs and gr‐MDSCs sorted from the spleen of untreated or DATS‐treated melanoma‐bearing mice after 21 days. (c) GCLC, GCLM, and HMOX mRNA levels evaluated by real‐time RT‐PCR in melanoma tissues excised from melanoma‐bearing mice after 21 days of treatment with DATS or vehicle (untreated). Values were normalized to the β‐actin expression. Results are presented as mean ± SEM (n = 6 per group). *P < .05, significantly different from untreated. Gr‐ and mo‐MDSCs isolated from the spleen of melanoma‐bearing mice were co‐cultured at different ratio with splenocytes stimulated with coated anti‐CD3 and anti‐CD28 antibody, for 96 hr. T cell proliferation was measured in triplicates by [³H]‐thymidine and expressed as counts per minute (CPM). Data are shown as mean ± SEM of three separate experiments. *P < .05, significantly different from untreated. ARG1, arginase 1; DATS, diallyl trisulfide; HMOX, haem oxygenase; iNOS, inducible NO synthase; MDSC, myeloid‐derived suppressor cell

Results obtained so far led us to hypothesize that H₂S could modify myelopoiesis within the tumour micro‐environment. Thus, to investigate whether DATS might interfere on MDSCs differentiation, we induced differentiation MDSCs ex vivo from murine bone marrow (BM‐MDSCs). BM cells were isolated from tumour‐free mice and cultured for 5 days with GM‐CSF and IL‐4 in the presence of B16F10 conditioned medium to mimic the tumour micro‐environment. The purity of the BM‐MDSCs preparation was evaluated analysing the Ly6C‐Ly6G expression profile by flow cytometry. In particular, mo‐MDSCs (Ly6C+, Ly6G⁻) represented about 30% and gr‐MDSCs (Ly6C+, Ly6G^high) about 15% of the total CD11b⁺ cells (Figure 5a,b). DATS (30 μM) was added on Day 3. The concentration of DATS used was not cytotoxic for the cells (data not shown). Consistent with previous observations, in the presence of DATS, the proportion of mo‐MDSCs was significantly decreased (Figure 5a,b). In addition, we examined the effect of DATS on the immunosuppressive effects of BM‐MDSCs and found that treatment with DATS significantly down‐regulated iNOS expression in the gr‐MDSCs subset whereas the ARG1 levels were not modified in mo‐ or in gr‐MDSCs (Figure 5c–f). The inhibition of iNOS was also confirmed by the reduction of the amounts of NO_x in cell supernatants compared to not‐treated cells (Figure 5g). We further evaluated the presence of CD11c⁺ DCs in BM cells in order to verify if the reduction of MDSCs was subsequent to their differentiation into mature myeloid cells. Treatment of BM cells with DATS significantly increased the number of DCs, to almost double as compared to not‐treated cells (Figure 6a,b).

Figure 5.

Bone marrow cells from tumour‐free C57BL/6 mice were differentiated in vitro and cultured for 5 days with GM‐CSF (10 ng·ml⁻¹), IL‐4 (10 ng·ml⁻¹), and 30% B16F10 conditioning medium. On Day 3, DATS 30 μM was added at the culture. On Day 5, cells were stained with CD11b, Ly6G, Ly6C, ARG1, and iNOS antibodies and analysed by flow cytometry. (a) Flow cytometric analysis and (b) relative quantification of mo‐MDSCs (P4: Ly6C+, Ly6G⁻) and gr‐MDSCs (P5: Ly6C+, Ly6G^high), gated within CD11b⁺ cells. Data are shown as mean ± SEM (n = 5). (c–f) ARG1 and iNOS flow cytometric analysis and relative quantification of populations P4 and P5 as gated in (a). Data are shown as MFI ± SEM (n = 5). A number of 20,000 total events was recorded. (g) NO_x production was evaluated in bone marrow‐MDSCs supernatants. Data are shown as mean ± SEM (n = 5). *P < .05, significantly different from N.T.(not treated cells). ARG1, arginase 1; DATS, diallyl trisulfide; iNOS, inducible NO synthase; MDSC, myeloid‐derived suppressor cell

Figure 6.

Bone marrow cells from tumour‐free C57BL/6 mice were differentiated in vitro and cultured for 5 days with GM‐CSF (10 ng·ml⁻¹), IL‐4 (10 ng·ml⁻¹), and 30% B16F10 conditioning medium. On Day 3, DATS 30 μM was added to the cell culture. On Day 5, cells were stained with CD45, CD11b, and CD11c antibodies and analysed by flow cytometry. (a) Flow cytometric analysis and (b) relative quantification of CD11b⁺/CD11c⁺ cells, gated within CD45⁺ cells. Data are shown as mean ± SEM (n = 5). A number of 20,000 total events was recorded. *P < .05, significantly different from N.T. (not treated cells). DATS, diallyl trisulfide

4. DISCUSSION AND CONCLUSION

H₂S is the third gaseous signalling molecule, along with NO and carbon monoxide (CO), emerging as a new factor in the pathophysiology of cancer. Recent studies indicate that H₂S has both pro‐cancer and anti‐cancer effects. Indeed, different types of cancer utilize different H₂S‐associated pathways, and the final effect on cell survival or cell death appear to be dose‐ and tumour celltype‐dependent (Hellmich & Szabo, 2015). We have previously demonstrated that during human melanoma progression, (Panza et al., 2015) whereas others showed that overexpression of CBS enhances tumour growth and spread in colon and ovarian cancer (Bhattacharyya et al., 2013; Szabo et al., 2013). However, several H₂S donors and H₂S‐releasing hybrids have been proposed as novel anti‐cancer drugs. In fact, relatively high concentrations of exogenous H₂S could suppress cancer cells growth via a range of mechanisms, including intracellular acidification, inhibition of NF‐κB activation, induction of cell death signalling, and activation of caspase 3 and apoptosis (Chattopadhyay et al., 2012; De Cicco et al., 2016; De Cicco et al., 2017; Lee et al., 2011; Lu, Gao, Huang, & Wang, 2014; Panza et al., 2015).

Here, we delineate a novel mechanism for the anti‐cancer effect of H₂S based on its ability to inhibit the accumulation and function of immunosuppressive MDSCs, in melanoma. There is growing evidence that even targeted agents and chemotherapies require an endogenous immune response to induce tumour regression. Mature myeloid cells such as macrophages, DCs, and granulocytes are essential for the normal function of both innate and adaptive immune systems. Unfortunately, many soluble factors present in the tumour micro‐environment or released in distant sites, such as the bone marrow and spleen, affect the differentiation of myeloid cells and can convert them into potent immunosuppressive cells, known as MDSCs (Gabrilovich, Ostrand‐Rosenberg, & Bronte, 2012). The numbers of MDSCs dramatically increase in tumour sites and in the spleen during tumour progression supporting tumour promotion and forming the “metastatic niche.” In addition, the presence of MDSCs in the tumour micro‐environment has been correlated with decreased efficacy of immunotherapies making MDSCs an important target for enhancing the efficacy of cancer treatment (de Haas, de Koning, Spilgies, de Vries, & Hato, 2016). Indeed, in patients with pancreatic cancer, oesophageal cancer, gastric cancer, and melanoma, it has been clearly demonstrated that the frequency of MDSCs in peripheral blood correlates with clinical outcomes and it has been considered an independent prognostic indicator of clinical disease progression (Jordan et al., 2013). In this study, we found a positive correlation between tumour growth and expansion of MDSCs in tumour, spleen, and peripheral blood of melanoma‐bearing mice. MDSCs were originally identified in tumour‐bearing mice as comprising two main subsets, mo‐MDSCs and gr‐MDSCs (Bronte et al., 2016). Available data strongly suggest that, in tumour‐bearing mice, gr‐MDSCs represent the major subset in peripheral lymphoid organs whereas mo‐MDSCs are more prominent in the tumour (Kumar, Patel, Tcyganov, & Gabrilovich, 2016). Thus, in accordance with data present in the literature, we observed that in the spleen and in the peripheral blood of melanoma‐bearing mice, gr‐MDSCs were in the majority whereas, in the tumour, the frequency of mo‐MDSCs were three times higher than gr‐MDSCs. Moreover, our results are in agreement with previous reports demonstrating that, in melanoma patients, the monocytic MDSCs fraction (defined as CD14⁻ in human), plays a key role in immunosuppression and should be considered a new target for future combinatorial treatments (Jordan et al., 2013).

To better elucidate the mechanisms underlying the anti‐tumour immune response effect promoted by H₂S, we treated melanoma‐bearing mice with DATS, an organosulfur compound naturally present in garlic. Administration of DATS to melanoma‐bearing mice induced up‐regulation of CSE and CBS expressions, which was reflected by increased plasma H₂S. DATS‐derived H₂S along with the inhibition of tumour growth induced a reduction in the frequency of MDSCs in the spleen, in the blood as well as in the tumour micro‐environment. Interestingly, the effect of DATS on the subtype of MDSCs was region‐dependent as, in the tumour tissue, only the mo‐MDSCs subset was significantly reduced. This localized and selective effect of H₂S has already been observed in a model of colitis‐associated cancer. Administration of DATS to infected mice induced a significant reduction of gr‐MDSCs in colon, where these cells are considered to play a pivotal role in the development of colits (De Cicco, Sanders, Cirino, Maloy, & Ianaro, 2018). The predominant inhibitory effect displayed by DATS on mo‐MDSCs was observed also in the spleen where this monocytic subset was reduced by more than 50%. Although both mo‐ and gr‐MDSCs efficiently suppress CD8⁺ T cell proliferation, mo‐MDSCs have higher suppressive activity than gr‐MDSCs (Movahedi et al., 2008). Analogously, in our model, mo‐MDSCs were found to be more potent suppressors than gr‐MDSCs. In addition, we found that DATS inhibited the immunosuppressive activity of both subpopulations and increased splenic CD8⁺ T cells number, demonstrating that DATS restored T cell proliferation and function. MDSCs have been shown to suppress CD8⁺ T cells and antitumour immune responses through multiple mechanisms. The main factors implicated in MDSCs‐mediated immune suppression include ARG1, iNOS, http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=5060, http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4975, http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1376, and the sequestration of cysteine by http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=2829 (http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=2829). The mo‐MDSC and gr‐MDSC utilize different mechanisms for immune suppression. Indeed, the prevalence of a particular immune suppressive mechanism depends on the type of MDSCs expanded, as well as on the stage of the disease and on the site where the suppression is occurring (Gabrilovich, 2017; Movahedi et al., 2008). Interestingly, in our in vivo experiments DATS down‐regulated iNOS, ARG1, and IL‐10 mRNA levels, which are differently expressed in spleen‐derived mo‐ and gr‐MDSCs. Furthermore, we found that treatment with DATS promoted the activation of the antioxidant pathway in melanoma‐bearing mice throughout the up‐regulation of GCL, the key enzyme in http://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=6737 synthesis, and HMOX‐1. Moreover, by using ex vivo‐differentiated B16F10‐MDSCs, appropriately resembling in vivo melanoma‐infiltrating MDSCs (Liechtenstein et al., 2014), we demonstrated that DATS preferentially inhibited iNOS expression and NO production. This is not surprising since recent studies have demonstrated that NO and H₂S and their enzymatic pathways may be mutually interactive and may influence each other in their production and pathophysiological functions (Kolluru, Shen, & Kevil, 2013).

Targeting the essential components of the suppressive machinery of MDSCs resulted also in inhibition of the suppression of T cell responses induced by both mo‐ and gr‐MDSCs. One of the main impediments to overcome the immunosuppressive function of MDSCs is inducing their differentiation into mature myeloid cells. Notably, in melanoma‐bearing mice, daily treatment with DATS induced a significant increase in the number of splenic DCs, which are the APCs most likely responsible for activating T cells. Moreover, also in in vitro experiments, we demonstrated that treatment of mouse BM immature cells with DATS resulted in reduction of MDSCs induction in favour of mature DCs differentiation.

In conclusion, our results show that DATS inhibited both the expansion and the immunouppressive actions of MDSCs in melanoma‐bearing mice, with different mechanisms according to the MDSCs subset, as well as to their tissue of origin. In addition, DATS might reduce the presence of MDSCs by promoting their differentiation into mature APCs, preferentially DCs, suggesting a novel role for H₂S in the modulation of immune responses in cancer. It is worth noting that DATS is a trisulfide compound containing the so‐called sulfane sulfur in its structure. Sulfane sulfur–containing compounds are present in mammalian cells where they participate in several biological processes. They are formed during anaerobic cysteine metabolism in a reaction catalysed mainly by CSE and 3‐MST (Iciek & Wlodek, 2001). However, earlier studies have demonstrated non‐enzymic production of H₂S from DADS and DATS in the presence of GSH in erythrocytes (Benavides et al., 2007). Hence, it appears that DATS can be an exogenous source of sulfane sulfur as well as of H₂S. In this study, we also found that DATS is an activator of CSE, which is involved in sulfane sulfur biosynthesis and in endogenous production of H₂S. Thus, the nature of the effector species, either H₂S or the DATS sulfane sulfur, remains to be determined. Further studies are required for a better understanding of the mechanisms underlying the therapeutic effects of garlic‐derived allyl sulfides.

AUTHOR CONTRIBUTIONS

P.D.C developed the study concept, carried out in vitro and in vivo studies, performed statistical analysis of the results and interpretation of data for the work, and drafted the manuscript. G.E. carried out in vivo experiments. V.R. carried out cytofluorimetric studies. G.R. and G.T. supervised over cytofluorimetric studies and interpreted data. A.I. developed the study concept, supervised over the entire study, interpreted data, and provided critical revisions. All authors read and approved the final manuscript.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14207, https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14208, and https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14206, and as recommended by funding agencies, publishers and other organisations engaged with supporting research.

Supporting information

Figure S1.

Effect of DATS on B16F10 cell proliferation measured using the MTT assay. The cells were exposed to the indicated concentrations of DATS for 48 h. Data are expressed as OD values. Data are shown as mean ± SEM (n = 5). ***P < 0.001 (vs B16 CTRL) (A). B16F10 cells were treated with DATS (100 μM) for 48 h and apoptosis was determined by annexin V (AV)/propidium iodide (PI) staining using flow cytometric analysis. This dual staining distinguishes between unaffected cells (unlabeled; quadrant 3, Q3), early apoptotic cells (annexin V‐positive; quadrant 4, Q4), late apoptotic cells (annexin V‐positive, PI positive; quadrant 2, Q2), and necrotic (PI‐positive; quadrant 1, Q1) (B). Quantitative analysis of cell apoptosis at 48 h. Data are shown as mean ± SEM (n = 5). A number of 20,000 total events was recorded.

De Cicco P, Ercolano G, Rubino V, et al. Modulation of the functions of myeloid‐derived suppressor cells : a new strategy of hydrogen sulfide anti‐cancer effects. Br J Pharmacol. 2020;177:884–897. 10.1111/bph.14824