Skip to main content
Bioscience Reports logoLink to Bioscience Reports
. 2020 Feb 20;40(2):BSR20200071. doi: 10.1042/BSR20200071

Clusterin role in hepatocellular carcinoma patients treated with oxaliplatin

Xiumei Wang 1, Yongqiang Liu 2,, Qiong Qin 3, Ti Zheng 2
PMCID: PMC7033306  PMID: 32039450

Abstract

Aim: To explore the prognostic value of clusterin (CLU) in hepatocellular carcinoma (HCC) patients treated with oxaliplatin (OXA).

Methods: Relative expression of plasma CLU mRNA was examined via fluorescence quantitative real-time PCR (qRT-PCR), and CLU protein level in tissue samples was detected through immunohistochemistry. Chi-square test was used to analyze the relationship between CLU mRNA expression and clinical features of HCC patients treated with OXA. Kaplan–Meier method was performed to assess overall survival for the patients, and prognostic value of CLU in HCC patients was estimated via Cox regression analysis.

Results: CLU expression in plasma and tissue specimens was significantly higher among HCC patients than in non-malignant controls (P < 0.001 for both). Moreover, elevated CLU mRNA was closely related to tumor stage, lymph node metastasis and response to OXA (P < 0.05). HCC patients with high CLU expression showed poor response to OXA. In addition, low CLU levels predicted long overall survival time among the study subjects (20.8 vs. 36.6 months, P < 0.001). CLU was an independent prognostic indicator for HCC patients treated with OXA (HR = 2.587, 95%CI = 1.749–3.828, P < 0.001).

Conclusion: CLU may be a novel prognostic marker for HCC patients treated with OXA.

Keywords: Clusterin, Hepatocellular carcinoma, Oxaliplatin resistance

Introduction

Hepatocellular carcinoma (HCC), accounting for 70–85% of all liver cancer cases, stands for a leading reason of tumor-relevant deaths around the world [1,2]. However, only less than 30% of HCC patients have the opportunity to receive curative treatments such as liver transplantation, surgical resection and ablation therapy, because most patients have entered into advanced stages at initial diagnosis [3]. Therefore, transcatheter hepatic arterial chemoembolization (TACE) and systemic chemotherapy represent main treatments for HCC [4]. Oxaliplatin (OXA), a third-generation platinum-derived chemotherapeutic agent, induces cell death through platinum-DNA adducts, and is more effective in inhibiting DNA replication than other platinum compounds [5,6]. OXA-based chemotherapy is widely used in treating several cancers, such as gastric cancer [7], colorectal cancer [8] and HCC [9]. However, clinical outcomes among HCC cases treated with OXA are varied, due to drug resistance. Therefore, finding key factors denoting HCC cases’ sensitivity to OXA will improve therapeutic effect of chemotherapeutic agents.

Secretory clusterin (sCLU), a heterodimeric secreted glycoprotein, is highly conserved, and its expression is observed in a variety of tissues and human fluids [10]. Clusterin (CLU) plays important roles in tissue remodeling, reproduction, lipid transport, complement regulation and apoptosis [11]. Growing evidences have demonstrated that the over-expression of CLU in malignancies may contribute to tumor progression [12,13]. Additionally, a report indicated that CLU enhances treatment resistance due to its antiapoptotic action [14]. Xiu and colleagues suggested that sCLU could strengthen OXA resistance through activating Akt pathway in HCC patients [15]. But the clinical effect of CLU in HCC is rarely reported.

Therefore, our study evaluated the prognostic value of CLU in HCC patients treated with OXA. We measured CLU expression for HCC patients before OXA treatment, and its connections with clinical features and response to OXA were also analyzed. Besides, we also estimated overall survival for the cases with varied CLU degrees, and Cox regression analysis was performed to estimate prognostic value of CLU.

Materials and methods

Patients and samples

About 104 cases were pathologically and clinically diagnosed with HCC in Inner Mongolia Autonomous Region Cancer Hospital and The Affiliated People’s Hospital of Inner Mongolia Medical University between October, 2018 and July, 2019, based on histopathological examination. Meanwhile, 60 healthy volunteers were selected as the control group. Fresh blood specimen from each participant was collected into EDTA tubes at 4°C, and then centrifuged for 5 min at 2500 rpm. Plasma specimens were kept at −80°C for later. No patients had received any chemotherapy or radiotherapy before the blood extraction. Besides, both HCC and adjacent normal tissue specimens were collected from HCC patients, and frozen in liquid nitrogen. Then, the tissue specimens were stored at −80°C for subsequent application.

The HCC patients were followed up for 5 years, every 3 months for the first year, every 6 months for the subsequent 2 years, and then annually. Clinical parameters including gender, age, tumor size or tumor stage, lymph node metastasis, serum AFP, vascular invasion, cirrhosis and recurrence were recorded when the patients were enrolled in the study, via questionnaire and their medical records. The present study was approved by the ethics committee of the Inner Mongolia Autonomous Region Cancer Hospital and The Affiliated People’s Hospital of Inner Mongolia Medical University, and written informed consents were also signed by all patients or their families.

RNA extraction and qRT-PCR

Total RNA was extracted from plasma samples using Trizon reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The concentration of total RNA was examined through UV absorbance (A260/A280), and 1% agarose gel electrophoresis was employed to test the quality of RNA sample. Total RNA samples with high quality, referring TO those with a concentration of 200 ng/μl, were used for synthesizing the first chain of cDNA, which was performed using Prime Scrip RT reagent kit (Takara, China). Fluorescence quantitative real-time polymorphism chain reaction (qRT-PCR) was performed via SYBR Green assay (Takara, China). β-Actin was an internal control. Data were analyzed through 2−∆∆Ct method. Primer sequences were displayed in Table 1.

Table 1. The sequences of the primers used in the present study.

Name Sequences
CLU Forward ATTCATACGAGAAGGCGACG
Reverse CAGCGACCTGGAGGGATT
β-Actin Forward GAAATCGTGCGTGACATTAA
Reverse AAGGAAGGCTGGAAGAGTG

Immunohistochemistry (IHC)

Both HCC and adjacent normal tissue specimens were cut into sections reaching a thickness of 4μm, and then deparaffinized in 65°C oven. The slides were incubated for 2 min in citrate buffer (10 mM) at 100°C for antigen retrieval and then blocked by goat serum. Next, the sections were incubated with anti-clusterin antibody (1:300, Sino Biological Inc., Catalog No. 11297-R210) or anti-GAPDH antibody (1:1000,Sino Biological Inc., Catalog No. 100242-T08) at 4°C overnight. Then, the sections were incubated with horseradish peroxidase (HRP) conjugated anti mouse secondary antibody (1:200, Abcam, U.S.A.) at room temperature for 30 min. Finally, the sections were stained using 3,3’-diaminobenzidine (DAB) solution, followed by counterstaining with hematoxylin.

Staining results were analyzed by two physicians who were blind to the information about the slides. Staining range was scored according to the following standards: 0, (<5%); 1, (5–25%; 2, (26–50% positive tumor cells); 3, (51–75%); and 4, (>75%). Staining intensity was graded according to the following criteria: 0, nonstaining; 1, light yellow; 2, brownish yellow; and 3, brown. Final scores referred to the sum of staining range and staining intensity scores. Final score ≤3 stood for low expression and >3 meant high expression.

OXA treatments

All patients received OXA treatment with a dosage of 100 mg/m2 on day 1 and 15 through a 2-h intravenous infusion and were pretreated with antiemetics. Treatment was repeated every 28 days [9]. Tumor response to OXA was evaluated by a radiation oncologist on the basis of response evaluation criteria in solid tumors (RECIST) version 2.

Statistical analysis

Continuous data were presented as mean ± standard deviation (SD), and their comparison between two groups was carried out using Student’s t test. Correlation of CLU mRNA level with clinical characteristics of HCC patients was evaluated through Chi-square test. Overall survival of the patients was analyzed via Kaplan–Meier method with log rank test. Cox regression analysis was performed to estimate prognostic significance of CLU in HCC patients treated with OXA. All statistical analyses were carried out in SPSS 18.0 software. P < 0.05 stood for the presence of statistical significance of results.

Results

Clinical information of HCC patients

About 104 HCC patients including 58 men and 46 women were recruited in our research. The average age of included patients was 56.9 years old. Of the patients, 46 exhibited complete response (CR) or partial response (PR), showing an overall response rate of 44.2%. Table 2 described clinical profiles for all enrolled subjects.

Table 2. The association between CLU expression and clinical features in HCC.

Characteristics Total number (n) CLU expression χ2 P
High (n) Low (n)
Gender 0.122 0.727
Male 58 27 31
Female 46 23 23
Age 0.732 0.392
≥55 60 31 29
<55 44 19 25
Tumor size 0.555 0.456
≥5 46 24 22
<5 58 26 32
Tumor stage 7.550 0.006
I+II 52 18 34
III+IV 52 32 20
Lymph node Metastasis 9.861 0.002
Yes 52 33 19
No 52 17 35
Serum AFP 0.594 0.441
≥200 ng/dl 50 26 24
<200 ng/dl 54 24 30
Vascular invasion 0.472 0.492
Absent 72 33 39
Present 32 17 15
Cirrhosis 2.143 0.143
Yes 61 33 28
No 43 17 26
Recurrence 1.135 0.287
Yes 43 18 25
No 61 32 29

Expression of CLU and its association with clinical features of HCC patients

Relative expression of CLU mRNA in patients with HCC was determined via qRT-PCR. Accordingly, plasma CLU expression was higher in HCC cases than in normal controls (1.48 ± 0.22 vs. 0.22 ± 0.12, P < 0.001, Figure 1).

Figure 1. Relative expression of plasma CLU in HCC cases and normal controls (β-actin as normalized control).

Figure 1

In addition, the expression of CLU protein in HCC tissues and non-malignant tissues was also estimated using IHC method. The results suggested that the expression of CLU protein in HCC tissues was significantly higher and the percentage of positively stained cells was as high as 94.2% (98/104); while CLU protein expression in non-malignant tissues was relatively weaker and the proportion of positively stained cells was only 14.4% (15/104). The difference between two sides was significant (P < 0.001, Figure 2).

Figure 2. Representative IHC images for negative expression of CLU protein in non-malignant tissues (A) and for positive expression of CLU protein in HCC tissues (B).

Figure 2

The patients were classified into two groups on the basis of their average CLU mRNA levels. Chi-square test indicated that CLU level was closely related to tumor stage (P = 0.006) and lymph node metastasis (P = 0.002), but not to gender, age, tumor size, serum AFP, vascular invasion, cirrhosis or recurrence (P > 0.05 for all). All data were listed in Table 2.

Response rate and CLU expression in HCC patients treated with OXA

Patients with low CLU mRNA expression emerged more frequently in CR+PR group than in SD+PD group. It suggested that CLU mRNA levels were obviously related to response to OXA treatment in HCC patients (Table 3, P = 0.001). Subjects possessing high expression exhibited high OXA resistance, while low ones showed well response rate.

Table 3. Response rate of HCC patients to OXA treatment according to CLU expression.

Response rate CR+PR SD+PD χ2 P
CLU high expression (n) 14 (13.5%) 36 (34.6%)
CLU low expression (n) 32 (30.8%) 22 (21.2%) 10.284 0.001
Total number (n) 46 (44.2%) 58 (55.8%)

Abbreviations: CR, complete response; PD, progressive disease; PR, partial response; SD, stable disease.

Overall survival analysis for HCC patients treated with OXA

The average overall survival time was 20.8 months in HCC patients with high CLU expression, and 36.6 months in patients with low expression (Figure 3), showing remarkable difference (Log rank test, P < 0.001). Cox regression analysis results suggested that CLU was related to the outcomes of HCC patients treated with OXA (P < 0.001). CLU could be an independent prognostic biomarker (Table 4, HR = 2.587, 95%CI = 1.749–3.828, P < 0.001).

Figure 3. Overall survival of HCC cases treated with OXA stratified by CLU expression.

Figure 3

Cases showing high expression suffered poor survival rate (red line), while those in low expression group had well survival rate (black line), showing significant difference (Log rank test, P < 0.001)

Table 4. Univariate and multivariate analysis for prognostic factors in HCC patients.

Characteristics Univariate analysis Multivariate analysis
HR 95%CI P HR 95%CI P
CLU (high vs. low) 2.575 1.755–3.778 0.000 2.587 1.749–3.828 0.000
Tumor size (>5 cm vs. <5 cm) 1.107 0.764–1.604 0.593 1.059 0.718–1.561 0.773
Tumor stage (III+IV vs. I+II) 1.122 0.777–1.619 0.540 0.986 0.667–1.459 0.944
Lymph metastasis (yes vs. no) 1.021 0.708–1.473 0.911 1.074 0.724–1.594 0.721

Discussion

Abnormal expression of CLU has been reported to be associated with treatment resistances in several malignancies. For example, Watari and colleagues have found significant relationship between CLU over-expression and poor overall survival in advanced cervical cancer patients receiving curative intended radiotherapy [16]. Brent et al. have indicated that decreased serum CLU level predicted longer survival time in castration-resistant prostate cancer cases [17]. In the study of He et al., CLU acted as a promising biomarker for esophageal squamous cell carcinoma patients who were resistant to chemoradiotherapy [18]. In the present study, the influence of CLU on OXA resistance in HCC patients was evaluated.

Expression patterns of CLU in HCC patients before OXA treatment were detected in the present study. The results demonstrated that CLU mRNA and protein levels significantly increased in HCC tissues compared with non-malignant tissues. Moreover, high serum CLU levels were related to advanced tumor stage and positive lymph node metastasis. Moreover, HCC patients with high expression of sCLU showed poor response to OXA treatment. Previous study has reported that sCLU could enhance OXA resistance via activating phosphorylated Akt in HCC [15]. CLU was associated with OXA resistance in HCC patients.

CLU was associated not only with OXA resistance, but also with resistances to other chemotherapeutic agents. Hassan et al. have indicated that CLU was associated with paclitaxel resistance in ovarian cancer patients [19]. While in melanoma cells, CLU could regulate their resistance to cytotoxic drugs in vitro and in vivo. Moreover, knocking-down CLU might provide a novel way to overcome drug resistance in melanoma [20]. In human osteosarcoma cells, sCLU down-regulation could enhance individual sensitivity to cisplatin via activating ERK1/2 signals [21]. Besides, CLU expression was also related to irradiation and oxidative stress [22]. All of these studies indicated that CLU was a broad-resistant gene and might be a potential therapy target in cancer management.

Prognostic significance of CLU in malignancies has been reported in previous studies. And sCLU over-expression was detected in colon cancer cells, and further research indicated that sCLU was a potential diagnostic marker for colorectal cancer [23]. Lokamani and colleagues indicated that CLU might serve as a potential marker to distinguish cervical neoplasis with borderline morphology features [24]. Abnormal expression of CLU has also been reported in patients with transitional bladder cell carcinoma, which might act as a diagnostic and prognostic biomarker for the disease [25]. In the present research, we explored prognostic significance of CLU in HCC patients treated with OXA. The results demonstrated that high expression of CLU meant poor overall survival among HCC cases. CLU could predict HCC patients’ prognosis who were treated with OXA.

Several limitations in our study should be stated here. First, the sample size was relatively small that might lead to low statistical power and affect the accuracy of our results. Second, all patients were collected from one hospital, which might cause bias into final results. Third, molecular mechanisms of CLU affecting resistance to OXA among HCC patients remained unclear. Fourth, tumor stage and lymph node metastasis were closely associated with CLU expression, and subgroup analysis based on these factors will increase the stringency of data synthesis. However, sample size was not large enough to perform such subgroup analysis. In addition, how CLU changed over time and after each treatment should be explored as well, which might help us understand the mechanism of CLU affecting OXA treatment in HCC patients. In further investigations, in vitro and in vivo experiments should be carried out to address the issue.

Conclusion

In conclusion, CLU over-expression is observed in plasma specimens from HCC cases, and its levels are related to tumor stage and lymph node metastasis. Besides, CLU is related to OXA resistance in HCC patients, and its high expression associates with low response rate. CLU could predict overall survival for HCC patients treated with OXA, which may offer a new way to overcome therapeutic resistance in the cancer management.

Abbreviations

CLU

clusterin

CR

complete response

DAB

3,3’-diaminobenzidine

HCC

hepatocellular carcinoma

HRP

horseradish peroxidase

IHC

immunohistochemistry

OXA

oxaliplatin

PR

partial response

qRT-PCR

quantitative real-time PCR

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

The authors declare that there are no sources of funding to be acknowledged.

Author Contribution

X.W. and Y.L. conceived and designed the experiments, analyzed the data, and wrote the paper. Q.Q. and T.Z. performed the experiments. All authors read and approved the final manuscript.

Ethical Statement

This study was supported by the Ethics Committee of Inner Mongolia Autonomous Region Cancer Hospital & The Affiliated People’s Hospital of Inner Mongolia Medical University and also has been carried out in accordance with the World Medical Association Declaration of Helsinki. The subjects had been informed the objective. Certainly, written consents were signed by every subject in this study.

References

  • 1.Jemal A., Bray F., Center M.M., Ferlay J., Ward E. and Forman D. (2011) Global cancer statistics. CA Cancer J. Clin. 61, 69–90 10.3322/caac.20107 [DOI] [PubMed] [Google Scholar]
  • 2.Forner A., Llovet J.M. and Bruix J. (2012) Hepatocellular carcinoma. Lancet 379, 1245–1255 10.1016/S0140-6736(11)61347-0 [DOI] [PubMed] [Google Scholar]
  • 3.Ye S.L., Takayama T., Geschwind J., Marrero J.A. and Bronowicki J.P. (2010) Current approaches to the treatment of early hepatocellular carcinoma. Oncologist 15, 34–41 10.1634/theoncologist.2010-S4-34 [DOI] [PubMed] [Google Scholar]
  • 4.Bruix J., Sala M. and Llovet J.M. (2004) Chemoembolization for hepatocellular carcinoma. Gastroenterology 127, S179–S188 10.1053/j.gastro.2004.09.032 [DOI] [PubMed] [Google Scholar]
  • 5.El-Serag H.B. (2011) Hepatocellular carcinoma. N. Engl. J. Med. 365, 1118–1127 10.1056/NEJMra1001683 [DOI] [PubMed] [Google Scholar]
  • 6.Raymond E., Faivre S., Chaney S., Woynarowski J. and Cvitkovic E. (2002) Cellular and molecular pharmacology of oxaliplatin. Mol. Cancer Ther. 1, 227–235 [PubMed] [Google Scholar]
  • 7.Yang L., Song Y., Zhou A.P., Qin Q., Chi Y., Huang J. et al. (2013) A phase II trial of oxaliplatin plus S-1 as a first-line chemotherapy for patients with advanced gastric cancer. Chin. Med. J. (Engl.) 126, 3470–3474 [PubMed] [Google Scholar]
  • 8.Marschner N., Arnold D., Engel E., Hutzschenreuter U., Rauh J., Freier W. et al. (2015) Oxaliplatin-based first-line chemotherapy is associated with improved overall survival compared to first-line treatment with irinotecan-based chemotherapy in patients with metastatic colorectal cancer - Results from a prospective cohort study. Clin. Epidemiol. 7, 295–303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yen Y., Lim D.W., Chung V., Morgan R.J., Leong L.A., Shibata S.I. et al. (2008) Phase II study of oxaliplatin in patients with unresectable, metastatic, or recurrent hepatocellular cancer: a California Cancer Consortium Trial. Am. J. Clin. Oncol. 31, 317–322 10.1097/COC.0b013e318162f57d [DOI] [PubMed] [Google Scholar]
  • 10.Klock G., Baiersdorfer M. and Koch-Brandt C. (2009) Chapter 7: Cell protective functions of secretory Clusterin (sCLU). Adv. Cancer. Res. 104, 115–138 [DOI] [PubMed] [Google Scholar]
  • 11.Rohne P., Prochnow H. and Koch-Brandt C. (2016) The CLU-files: disentanglement of a mystery. Biomol. Concept. 7, 1–15 10.1515/bmc-2015-0026 [DOI] [PubMed] [Google Scholar]
  • 12.Guo W., Ma X., Xue C., Luo J., Zhu X., Xiang J. et al. (2014) Serum clusterin as a tumor marker and prognostic factor for patients with esophageal cancer. Dis. Markers 2014, 168960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Watari H., Kanuma T., Ohta Y., Hassan M.K., Mitamura T., Hosaka M. et al. (2010) Clusterin expression inversely correlates with chemosensitivity and predicts poor survival in patients with locally advanced cervical cancer treated with cisplatin-based neoadjuvant chemotherapy and radical hysterectomy. Pathol. Oncol. Res. 16, 345–352 10.1007/s12253-009-9235-0 [DOI] [PubMed] [Google Scholar]
  • 14.Zellweger T., Chi K., Miyake H., Adomat H., Kiyama S., Skov K. et al. (2002) Enhanced radiation sensitivity in prostate cancer by inhibition of the cell survival protein clusterin. Clin. Cancer Res. 8, 3276–3284 [PubMed] [Google Scholar]
  • 15.Xiu P., Dong X., Xu Z., Zhu H., Liu F., Wei Z. et al. (2013) Secretory clusterin contributes to oxaliplatin resistance by activating Akt pathway in hepatocellular carcinoma. Cancer Sci. 104, 375–382 10.1111/cas.12088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Watari H., Kinoshita R., Han Y., Wang L., Hosaka M., Taguchi H. et al. (2012) Prognostic significance of clusterin expression in advanced-stage cervical cancer treated with curative intended radiotherapy. Int. J. Gynecol. Cancer 22, 465–470 10.1097/IGC.0b013e31821a03d9 [DOI] [PubMed] [Google Scholar]
  • 17.Blumenstein B., Saad F., Hotte S., Chi K.N., Eigl B., Gleave M. et al. (2013) Reduction in serum clusterin is a potential therapeutic biomarker in patients with castration-resistant prostate cancer treated with custirsen. Cancer Med. 2, 468–477 10.1002/cam4.93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.He L.R., Liu M.Z., Li B.K., Rao H.L., Liao Y.J., Zhang L.J. et al. (2009) Clusterin as a predictor for chemoradiotherapy sensitivity and patient survival in esophageal squamous cell carcinoma. Cancer Sci. 100, 2354–2360 10.1111/j.1349-7006.2009.01349.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hassan M.K., Watari H., Han Y., Mitamura T., Hosaka M., Wang L. et al. (2011) Clusterin is a potential molecular predictor for ovarian cancer patient’s survival: targeting clusterin improves response to paclitaxel. J. Exp. Clin. Cancer Res. 30, 113 10.1186/1756-9966-30-113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hoeller C., Pratscher B., Thallinger C., Winter D., Fink D., Kovacic B. et al. (2005) Clusterin regulates drug-resistance in melanoma cells. J. Invest. Dermatol. 124, 1300–1307 10.1111/j.0022-202X.2005.23720.x [DOI] [PubMed] [Google Scholar]
  • 21.Huang H., Wang L., Li M., Wang X. and Zhang L. (2014) Secreted clusterin (sCLU) regulates cell proliferation and chemosensitivity to cisplatin by modulating ERK1/2 signals in human osteosarcoma cells. World J. Surg. Oncol. 12, 255 10.1186/1477-7819-12-255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Djeu J.Y. and Wei S. (2009) Clusterin and chemoresistance. Adv. Cancer. Res. 105, 77–92 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rodriguez-Pineiro A.M., Garcia-Lorenzo A., Blanco-Prieto S., Alvarez-Chaver P., Rodriguez-Berrocal F.J., Cadena M.P. et al. (2012) Secreted clusterin in colon tumor cell models and its potential as diagnostic marker for colorectal cancer. Cancer Invest. 30, 72–78 [DOI] [PubMed] [Google Scholar]
  • 24.Lokamani I., Looi M.L., Ali S.A., Dali A.Z. and Jamal R. (2011) Clusterin as a potential marker in distinguishing cervical neoplasia. Anal. Quant. Cytol. Histol. 33, 223–228 [PubMed] [Google Scholar]
  • 25.Hazzaa S.M., Elashry O.M. and Afifi I.K. (2010) Clusterin as a diagnostic and prognostic marker for transitional cell carcinoma of the bladder. Pathol. Oncol. Res. 16, 101–109 10.1007/s12253-009-9196-3 [DOI] [PubMed] [Google Scholar]

Articles from Bioscience Reports are provided here courtesy of Portland Press Ltd

RESOURCES