Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2020 Feb 22;10(3):131. doi: 10.1007/s13205-020-2125-6

Goat CMTM2: mRNA expression profiles of different alternative spliced variants and associations analyses with growth traits

Libang He 1,#, Zihong Kang 1,#, Yuxin Kang 1, Weixuan Xiang 1, Chuanying Pan 1, Hong Chen 1, Haijing Zhu 2,3, Lei Qu 2,3, Xianyong Lan 1,✉, Xiaoyue Song 2,3,✉
PMCID: PMC7035400  PMID: 32154044

Abstract

CKLF like MARVEL transmembrane domain containing 2 (CMTM2) plays crucial roles in spermiogenesis, skeletogenous, growth, and development through PI3K/Akt and other pathways. The purpose of this study was to explore the expression profile and variation of different spliced CMTM2 gene in Shaanbei white cashmere goats, as well as to find the relationships between a CMTM2 promoter region 14 bp genetic variant and growth traits in 1366 Shaanbei white cashmere goats. In this study, we identified alternative CMTM2 splicing and detected the effects of the spliced variants on mRNA expression levels in tissues. Meanwhile, an unreported spliced variant of CMTM2 in goat was identified using in CDS cloning and RT-PCR, namely, CMTM2-AS2. Compared with the normal transcript (CMTM2-AS1), the novel variant had the higher expression level in muscle and liver tissues, indicating that it plays an effective role in growth traits. Furthermore, a 14 bp deletion was detected within CMTM2 promoter region, and the different genotypes were significantly associated with growth traits (e.g., body length, circumference of cannon bone) in the large group of 1366 individuals in Shaanbei white cashmere goats. We found that the body length of the individuals with II (n = 571) genotype had better phenotypes than those with DD (n = 118) and ID (n = 650) genotypes. These results have direct guiding significance for goat breeding in the future and provide a new idea for studying the characteristics and functions of CMTM2 gene in goats.

Electronic supplementary material

The online version of this article (10.1007/s13205-020-2125-6) contains supplementary material, which is available to authorized users.

Keywords: Alternative splicing, Association, CMTM2, Goat, Growth trait, mRNA expression

Introduction

The CMTM2 gene consists of four exons and three introns; it spans approximately 8.8 kb on chromosome 16q22.1 and encodes a 248-amino acid protein. According to recent studies, the CMTM2 gene is predominantly expressed in the testes and marrow tissues (Shi et al. 2005). It can bind to the androgen receptor (AR) in the Sertoli cells and regulate AR expression by functioning as a coactivator (Liu et al. 2009; O'Hara and Smith 2015). Previous studies demonstrated that AR and androgen can regulate bone metabolism (Mohamad et al. 2016). Androgen regulates bone metabolism by promoting the differentiation of mesenchymal stem cells (MSCs) into osteoblasts. AR can play an essential role in androgen signaling by promoting osteogenesis and inhibiting osteoclast activity (Fu and Wang 2018). Additionally, AR can indirectly regulate bone metabolism through several pathways such as Wnt/beta-catenin pathway (Li et al. 2016; Xu et al. 2016), bone morphogenetic protein (BMP)/Smads/runt-related transcription factor 2 (RunX2) pathway (Kimura et al. 2017) and receptor activator of NF-κB ligand (RANKL)/osteoprotegerin (OPG) pathway (Yuan et al. 2015; Xiong et al. 2014). Thus, it is inferred that the CMTM2 gene can indirectly affect the growth traits by regulating AR. Moreover, other studies showed that the overexpression of chemokine-like factor 2 promoted the proliferation and survival of C2C12 skeletal muscle cells (Xia et al. 2002). These findings indicated that CMTM2 indirectly plays an important role in bone formation and regeneration. It is observed that CMTM2 is highly conserved among mammals. Therefore, we hypothesized that CMTM2 is closely associated with goat reproduction.

Previous studies have shown that mRNA and DNA levels can affect gene expression and function. In recent years, alternative splicing (AS) has received more and more attention (Li et al. 2013). It can generate mRNAs that differ in their untranslated regions (UTRs) or coding sequences through mechanisms that include exon skipping, a choice between mutually exclusive exons, the use of alternative splice sites, and intron retention (Wang and Burge 2008; Baralle et al. 2017). These differences can affect the stability of mRNA as well as localization or translation of mRNA, resulting in the synthesis of diverse functional proteins. Additionally, since alternative splicing occurs at the mRNA level, it can affect the levels of gene expression. It is well-known that genetic mutations could enhance or inhibit gene transcriptional activity, leading to changes in expression level. The main genetic variations are indels, single nucleotide polymorphisms (SNPs), and copy number variations (CNVs) (Julienne et al. 2010; Zhang et al. 2019a). It has been reported that indels are closely related to various traits (An et al. 2015; Liang et al. 2019), including the growth traits of Cashmere goats (Wang et al. 2020b; Zhang et al. 2019b).

With the improvement in livestock breeding techniques, it is expected that some economic characteristics of local varieties can be thoroughly investigated (Wang et al. 2019a). It is well-known that the growth, development, and reproduction of goats are important factors that influence the development of the goat industry (E et al. 2019). However, growth trait is not a highly heritable character in many livestock animals. Traditional methods require a longer time for designing breeding and feeding strategies and are often accompanied by low efficiency. Currently, marker-assisted selection (MAS), which is based on relevant genetic variants, is used extensively to improve traits having low heritability (Wang et al. 2020a), such as those associated with growth and reproduction (Ma et al. 2015; Yang et al. 2016; Escobar-Chaparro et al. 2017; Wang et al. 2020b). Thus, selecting important potential genes and considering the relation between their polymorphisms and growth-related traits are more worthwhile for boosting livestock productivity.

To explore the function of CMTM2 polymorphism in ruminants, our team analyzed goat CMTM2 mRNA expression in the testes and ovaries, as well as the activity of a 14-bp promoter region indel in CMTM2 gene, and found that it was significantly associated with litter size in goats (Kang et al. 2019). However, there is no information available on the relationship between CMTM2 gene indel variation and the growth traits in goats.

Therefore, based on previous studies, we first identified a novel transcript of goat CMTM2, namely CMTM2-AS2, following which we analyzed the characteristics of different CMTM2 splice variants and their effects on mRNA expression levels. Secondly, the 14-bp promoter region indel was found to be significantly associated with growth traits in SBWC goats (n = 1366). We believe that these findings will enhance the understanding of the CMTM2 gene function in goats, thus promoting MAS-based goat breeding.

Material and methods

All experiments in this study involving animals were approved by the Faculty Animal Policy and Welfare Committee of Northwest A&F University (Protocol No. NWAFAC1008). Furthermore, the care and use of experimental animals were completely in agreement with the local animal welfare laws and policies.

Samples and data collection

For DNA experiments, a total of 1,366 female SBWC goats, which were reaching physical maturity, were randomly selected from a large population. These goats received the same diet and were reared under standard conditions after weaning. The data of SBWC growth-related traits, including body height (BH), height across the hip (HH), body length (BL), heart girth (HG), cannon circumference (CC), chest depth (CD), chest width (CW), hip-width (HW), body weight (BW), were collected by the farm staff (Wang et al. 2017; Kang et al. 2019).

Apart from these female goats, we also collected six male goat samples belonging to two developmental age groups, i.e., 7-day-old and 42-day-old male goats for RNA experiments. Four tissue types (liver, muscle, heart, and brain) were collected from each male goat. All tissue samples were snap-frozen in liquid nitrogen and stored at − 80 °C until RNA isolation.

Identification of goat CMTM2 splicing variants and bioinformatic analysis

One primer pair named CDS cloning (Table 1) was used to amplify the whole coding region of the goat CMTM2 gene. The primer was based on the goat CMTM2 reference sequence (GenBank: XM_005692106.3) and designed using the software Primer Premier 5. The PCR products were separated by 2.5% agarose gel electrophoresis, purified, and ligated to the pMD19-T vector (TaKaRa, Dalian, China). The clones were then confirmed by sequencing. Sequences were compared with the reference sequence using Basic Local Alignment Search Tool (BLAST) by the National Center for Biological Information (NCBI) (https://blast.ncbi.nlm.nih.gov/Blast.cgi). In addition, the nucleotide and amino acid sequence alignments were also analyzed using BLAST and BioXM2.6.

Table 1.

Primers for PCR amplification of CMTM2

Primers name Sequences (5′–3′) Sizes (bp) Function Location Note
P1 F: AGTGCCCTTTTCTCCTCCTA 145/131 Indel detection Promoter Original design
R: TGACCCTCCACTACCTCTTT
CDS cloning F: ATGGCTGATAAAAAGGACAA 746/587 AS detection CDS New design
R: CACTTCTTGCCTCCCTTT
CMTM2-AS1 F: ATCTACACCTTCGCCATCC 132 qPCR Exon 2–3 Original design
R: CACTGTTTGCCGACTTCTG
CMTM2-AS2 F: GCTCATTAGCTTGGATCTTC 83 qPCR Exon 1/3–4 New design
R: GCCGACTTCTGATAGCG
GAPDH F: AAAGTGGACATCGTTGCCAT 116 Internal control Exon 3–4 Original design
R: CCGTTCTCTGCCTTGACTGT
Open in a new tab

The original design comes from the essay of Kang et al. (2019)

Quantitative real-time PCR (qPCR)

For determining CMTM2 mRNA expression levels, total RNA was extracted from the goat tissues using TRIzol total RNA extraction reagent (TaKaRa Biotech Co. Ltd., Dalian, China), and preserved at − 80 °C according to the manufacturer’s instructions. First-strand cDNA was synthesized using PrimeScript™ RT Reagent Kit (TaKaRa Biotech Co. Ltd.) according to the manufacturer's protocol. The synthesized cDNA was preserved at − 20 °C. Then, qPCR was performed using CFX96 Real-Time PCR Detection System (Bio-Rad, USA), SYBR green detection dye, and a 20-µL reaction mixture containing 10 μL of SYBR Premix Ex TaqTMII (TaKaRa Biotech Co. Ltd.) and 2 μL of cDNA. Thermal cycling conditions were as follows: 95 °C for 1 min, followed by 40 cycles of 95 °C for 10 s and 55 °C for 30 s (Jia et al. 2015). For each tissue, qPCR analysis was performed on cDNA in triplicate and the gene expression was normalized to that of GAPDH using the 2−ΔΔCt method as described previously (Livak et al. 2001).

DNA isolation, primer design and genotyping

Genomic DNA was extracted from the goat ear tissues using a high-salt extraction protocol, (Lan et al. 2013; Wang et al. 2020a) and its quality was assessed using Nanodrop 1000 (Thermo Fisher Scientific Inc., Wilmington, DE, USA), following which it was standardized to a concentration of 50 ng/mL. One reported 14-bp indel (NC_030825.1: g.35582961_35582974delTGGTAATGCCCCAA; rs664189991) was detected in the CMTM2 promoter region using P1 (Table 1) (Kang et al. 2019). PCR-based amplified fragment length polymorphism (AFLP), coupled with agarose gel electrophoresis, was applied to genotype this indel. Indel identification and genotyping were performed by touch-down PCR using a 25-μL reaction mixture containing 50 ng genomic DNA (Zhang et al. 2015a; Jin et al. 2016). The PCR program was performed under the following conditions: initial denaturation at 95 °C for 5 min; 18 cycles at 94 °C for 30 s, 68 °C for 30 s with a decrease of 1 °C per cycle, and 72 °C for 15 s; another 30 cycles at 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 15 s; with a final extension at 72 °C for 10 min. Subsequently, each PCR product was electrophoresed using a 3.5% agarose gel, followed by staining with ethidium bromide to identify the indel locus.

Statistical analysis

Genotype frequencies, allele frequencies and Hardy–Weinberg equilibrium (HWE) of the indel locus in the goat CMTM2 were calculated using SHEsis program (https://analysis.bio-x.cn/myAnalysis.php) (Lachance et al. 2011). Population indexes (heterozygosity, He; homozygosity, Ho; polymorphism information content, PIC) were calculated online using Nei’s methods (https://www.msrcall.com/Gdicall.aspx) (Table 2) (Menchaca et al. 2002). Ho and He are measures of the genetic variations of a population. PIC is an indicator of polymorphism (Li et al. 2017; Wang et al. 2020a). The χ2 test using the SHEsis online platform (https://analysis.bio-x.cn/myAnalysis.php) to evaluate the HWE.

Table 2.

Genetic parameters of the indel within CMTM2 in Shaanbei white cashmere goat

Observed genotypes Frequencies Ho He PIC χ2 (P value)
(N = 1366) Genotypes Alleles
II (582) 0.426 0.668 (I) 0.557 0.443 0.345 11.304 (P = 0.0007)
ID (661) 0.484 0.332 (D)
DD (123) 0.090
Open in a new tab

Ho homozygosity, He heterozygosity, PIC polymorphism information content

Association between the indel locus and growth traits in SBWC goats was analyzed using one-way ANOVA by SPSS software (version 24.0) (International Business Machines Corporation, New York, USA). The statistical model used for measuring the growth traits was as follows: Yijk = u + Ai + Gj + eijk, where Yijk represents the body measurement trait, u is the population mean, Ai is the fixed effect of age, Gj is the fixed effect of genotype, and eijk is the random error (Wang et al. 2019b). The model excluded the influence of farm, gender, birth season, and other factors, which had no significant effect on the population traits (Jin et al. 2016).

Results

Identification and biological significance of goat CMTM2 alternative splicing

Based on the sequencing maps and sequence alignments, a novel transcript of the goat CMTM2 gene denoted as CMTM2-AS2, was identified (Figs. 1a and 2). The structural map of CMTM2 gene transcripts is shown in Fig. 1b. To further investigate the characteristics of these variants, sequence alignments were performed for the DNA and amino acid sequences of the coding regions (Fig. 1c and d). The alignment results showed that the lack of exon 2 did not cause frameshift of the amino acid sequence, but caused deletion of 53 amino acids in the resulting protein. CMTM2-AS1 and CMTM2-AS2 were found to form complete open reading frame, in which CMTM2-AS1 encoded 248 amino acids, whereas CMTM2-AS2 was found to encode 195 amino acids.

Fig. 1.

Fig. 1

Open in a new tab

Comparison of CMTM2-AS1 and CMTM2-AS2 in goat. a, b The electrophoresis diagrams and the map of structure of goat CMTM2 alternative splicing. c, d The nucleotide and amino acid sequence alignments of CMTM2-AS1 and CMTM2-AS2

Fig. 2.

Fig. 2

Open in a new tab

Tissue expression of CMTM2-AS1 and CMTM2-AS2 in 7d and 42d male goat. Each column denotes the mean ± SE. *P < 0.05

Tissue-specific and time-dependent expression of CMTM2 transcripts

To evaluate the tissue-specific expression of CMTM2-AS1 and CMTM2-AS2, two pairs of primers (CMTM2-AS1 and CMTM2-AS2) were designed (Table 1 and Fig. 1b). The result showed that CMTM2-AS2 expression levels were significantly higher than those of CMTM2-AS1 in muscle tissues of the 7-day-old male goats (P < 0.05) (Fig. 2). In addition, the expression levels of the two transcripts of the goat CMTM2 gene were significantly higher in muscle tissues of 42-day-old male goats than those of 7-day-old male goats (P < 0.05) (Fig. 2). To summarize, the novel CMTM2 gene variant showed higher expression in muscle tissues. In addition, as the tissues continue to grow, the expression level increases significantly. At the same time, we analyzed the expression level of different genes, and we found that the expression level of type II genotypes in muscles was higher than that of ID and DD genotypes (Fig. 3). Although there was no significant difference between them, this may indicate that genotype II individuals performed better at growth traits.

Fig. 3.

Fig. 3

Open in a new tab

The indel locus influence CMTM2-AS1 and CMTM2-AS2 mRNA expression

Genotyping and genetic parameters of the 14-bp indel

Agarose gel electrophoresis and sequencing maps (Kang et al. 2019) showed that the 14-bp indel in the CMTM2 promoter region generated three genotypes: homozygotic insertion type (II, insertion/insertion; 145 bp), heterozygote type (ID, insertion/deletion; 145 bp and 131 bp), and homozygotic deletion type (DD, deletion/deletion; 131 bp).

The genotype and allele frequencies, as well as other genetic parameters associated with the CMTM2 indel loci were calculated to determine the genotype distribution among SBWC goats (Table 2). The data indicated that the “I” allele (0.668) of the 14-bp indel was more frequent than the “D” allele (0.332). Additionally, the genotype distribution was not consistent with the HWE (P < 0.05). Based on the PIC value, medium genetic diversity was observed (0.25 < PIC < 0.5).

Analyses of associations between the 14-bp indel and growth-related traits

The associations between the 14-bp indel and growth-related traits are listed in Table 3. According to the results of 1366 goats that were genotyped in this study, the 14-bp indel was significantly correlated with body length (P = 0.016) and cannon circumference (P = 0.045). In terms of body length, the goats with II genotype showed better phenotypes than those with DD and ID genotypes.

Table 3.

Associations of the indel with growth traits in detected groups

Traits Genotypes (14-bp) (mean ± SD) P values
II ID DD
BH (cm) 56.67 ± 4.83 (n = 573) 56.60 ± 4.40 (n = 648) 56.96 ± 4.23 (n = 119) 0.736
HH (cm) 59.89 ± 4.47 (n = 572) 59.93 ± 4.65 (n = 649) 60.25 ± 4.52 (n = 118) 0.742
BL (cm) 66.04a ± 5.66 n = 571) 65.23a ± 6.23 (n = 650) 64.65b ± 6.30 (n = 118) 0.016
HG (cm) 84.46 ± 19.74 (n = 572) 83.88 ± 19.98 (n = 646) 85.95 ± 15.00 (n = 119) 0.552
CC (cm) 9.40ab ± 4.55 (n = 572) 9.55a ± 6.48 (n = 648) 8.62b ± 3.11 (n = 119) 0.045
CD (cm) 31.10 ± 12.48 (n = 572) 30.89 ± 12.15 (n = 650) 28.99 ± 9.03 (n = 118) 0.220
CW (cm) 18.43 ± 4.08 (n = 573) 18.18 ± 4.20 (n = 650) 18.62 ± 4.13 (n = 118) 0.408
HW (cm) 19.07 ± 3.54 (n = 402) 18.87 ± 3.02 (n = 380) 18.65 ± 3.14 (n = 69) 0.498
BW (kg) 47.75 ± 14.76 (n = 217) 49.27 ± 15.64 (n = 216) 48.62 ± 14.97 (n = 48) 0.581
Open in a new tab

The mean values with different superscripts (a, b) within the same row differ significantly at P < 0.05 level

BH body height, HH height at hip cross, BL body length, HG heart girth, CC Cannon circumference, CD chest depth, CW chest width, HW hip-width, BW body weight, II normal genotype, DD deletion genotype, ID heterozygote genotype

Discussion

The cashmere goat enterprise is one of the crucial industries of animal husbandry in China. However, goats do not exhibit high fertility rates such as pigs, cattle, or other livestock. This has impeded the progress of the goat industry. It is well-known that rapid and effective characterization of economic traits can be an indispensable driving force for the development of the goat industry. Hence, the following question arises: how can crucial traits that can be successfully applied to animal breeding can be selected? In recent years, MAS has been widely applied because of its fast and effective performance in promoting animal reproduction and productivity (Wang et al. 2020b). The CMTM2 gene is predominantly expressed in the testes and marrow tissues (Shi et al. 2005) and regulates the progress of mammal growth through C2C12 cells (Xia et al. 2002). In the present study, we found that CMTM2 gene is evolutionarily conserved among mammals. However, there is no information available about the CMTM2 gene variation and growth traits. Thus, the purpose of this study was to identify the relationship between CMTM2 and growth traits in goats by analyzing the mRNA and DNA levels. Moreover, we also investigated whether CMTM2 can be used as a potential gene for MAS to improve animal breeding.

Alternative splicing is a ubiquitous regulatory mechanism of gene expression that produces diverse mRNA species from a single gene, thereby resulting in the functional diversification of proteins (Maniatis and Tasic 2002; Chen and Manley 2009; Keren et al. 2010). Based on multiple studies, it is now known that alternative splicing can affect different levels of gene expression, which in turn, can affect several animal phenotypes (Kelemen et al. 2013; Hassan and Saeij 2014; Baralle et al. 2017). Thus, alternative splicing is useful in analyzing evolutionary pathways, metabolic activities, and biological complexity (Zhou et al. 2014). Previous studies on alternative splicing conducted in our laboratory have confirmed this phenomenon. For example, Zhang et al. found that different splicing variants of the goat CTNNB1 gene have different expression levels in testicular tissues, which can ultimately affect the birth traits (Zhang et al. 2018). In addition, it is now established that alternative splicing designs can be used for organ development (Wang et al. 2008). Splicing networks operating during muscle cell differentiation have been identified in the murine myoblast cell line C2C12 (Singh et al. 2014). Besides, studies had shown that the overexpression of chemokine-like factor 2 promotes the proliferation and survival of C2C12 skeletal muscle cells (Xia et al. 2002). Thus, it was speculated that the alternative splicing of CMTM2 gene may play an important role in the growth of skeletal muscle. In this study, we identified a novel splice variant of goat CMTM2, namely CMTM2-AS2. Based on qRT-PCR, we found that CMTM2-AS1 and CMTM2-AS2 were expressed in all tissues, and the expression level varied with tissue type and sample age. These results indicated that CMTM2 gene performed different physiological functions in various tissues and exerted its influence on growth traits. Compared with the known transcript, we found that CMTM2-AS2 expression levels were significantly higher in muscle tissues of the 7-day-old male goats (P < 0.05). Therefore, we hypothesized that goat CMTM2 gene could affect the growth of skeletal muscles, thereby affecting the growth traits.

Besides, studies have shown that a mutation in promoter elements help promote and inhibit the transcription, translation, and expression of gene, thereby affecting phenotypic traits (Huang et al. 2013; Gao et al. 2016; Li et al. 2019). The main genetic variations are indels, SNPs, CNVs, etc. (Julienne et al. 2010). Unlike other genetic variations, the indel is the easiest and the most cost-effective variation, which can be directly detected by simple PCR amplification and agarose gel electrophoresis (Naicy et al. 2016). Therefore, key indel variants are more suitable for production practices such as animal breeding. It has been reported that indels are closely associated with certain traits (Liang et al. 2019), including the growth traits of Cashmere goats (Wang et al. 2019b; Zhang et al. 2019b).

Herein, the association between the 14-bp indel and growth traits were investigated in a large commercial population of SBWC goats (n = 1366). Based on the results, we concluded that the 14-bp indel was strongly correlated with growth traits (body length, the circumference of cannon bone) in SBWC goats. However, the 14-bp indel disturbed the HWE (P < 0.05). This disequilibrium can be attributed to the artificial selection that promoted mutations at this site (Zhang et al. 2015b; Liu et al. 2017). In summary, based on a large number of samples, the association analysis showed that the 14-bp indel of CMTM2 was strongly correlated with growth traits in goats. Thus, our findings showed that the 14-bp indel of the CMTM2 gene could be utilized as a candidate marker for MAS in SBWC goats.

The results of our previous study showed that the 14-bp promoter region indel can significantly influence the expression of CMTM2 mRNA (Kang et al. 2019) and its presence can increase promoter activity. In addition, the overexpression of CMTM2 promoted the proliferation and survival of C2C12 skeletal muscle cells (Xia et al. 2002). Therefore, we postulate that the 14-bp promoter region indel can impact the activity of C2C12 cells, thereby affecting growth traits. The present study also showed that a functional promoter region of the CMTM2 gene is located in the last intron/exon region of the upstream CMTM1 gene (Xu et al. 2005). It is well-known that an intronic mutation might activate an alternative splicing mechanism (Wang et al. 2014). Furthermore, CMTM1 may be involved in a variety of physiological processes, including skeletal muscle cell regeneration in vivo (Xu et al. 2005), indicating that the 14-bp indel may also affect bone development by affecting the function of CMTM1. However, the exact mechanism underlying its effect on growth needs to be addressed. We believe that this is the first study that explores the correlation between CMTM2 gene and growth traits in goats and provides a new direction for goat breeding.

Conclusions

Briefly, CMTM2 was found to produce one novel alternative splice variants, and the 14-bp deletion mutation in CMTM2 gene was significantly associated with growth-related traits in Shaanbei white cashmere goats (P < 0.05). It hints that this deletion could be assigned to an effective molecular marker for growth traits in goat breeding.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary file1 (DOCX 867 kb) (867.2KB, docx)

Acknowledgements

This work was funded by the National Scientific and Technological Innovation Project of Undergraduate of Northwest A&F University (201910712070), the Scientific Research Foundation of the Education Department of Shaanxi Province (No. 19JK1004), Young Talent Fund of University Association for Science and Technology in Shaanxi (No. 20190208) and Research Foundation for High-Level Talents of Yulin University (No. 17GK22) and Provincial Key Projects of Shaanxi (2014KTDZ02-01). We greatly thanked the staffs of Shaanbei white cashmere goat breeding farm, Shaanxi province, P.R. China for their collecting samples. We are also very grateful to the Life Science Research Core Services (LSRCS), Northwest A&F University, for the equipment.

Abbreviations

SBWC

Shaanbei white cashmere goat

MAS

Marker-assisted selection

MSCs

Mesenchymal stem cells

indel

Insertion/deletion

PCR

Polymerase chain reaction

RT-PCR

Real-time polymerase chain reaction

bp

Base pair

II

Insertion/insertion

DD

Deletion/deletion

ID

Insertion/deletion

Ho

Homozygosity

He

Heterozygosity

PIC

Polymorphism information content

HWE

Hardy–Weinberg equilibrium

AS

Alternative splicing

AR

Androgen receptor

qRT-PCR

Quantitative real-time quantitative PCR

CMTM2

CKLF like MARVEL transmembrane domain containing 2

C2C12

A mouse myoblast cell line

BH

Body height

HH

Height at hip cross

BL

Body length

HG

Heart girth

CC

Cannon circumference

CD

Chest depth

CW

Chest width

HW

Hip width

BW

Body weight

SNP

Single nucleotide polymorphisms

CNV

Copy number variations

BLAST

Bell labs layered space–time

cDNA

Complementary DNA

Author contributions

All the experiments were performed by LBH, YXK and WXX with the technical assistance of ZHK. CYP, HC and XYS provided molecular biology expertise and reviewed reports and associated thesis. HJZ and LQ contacted the sheep farm and gave instructions on the collection of samples. XYL and ZHK conceived and designed the experiments, and LBH led the data analysis and manuscript preparation.

Compliance with ethical standards

Conflict of interest

We confirm that this manuscript has not been published in whole or in part and is not being considered for publication elsewhere. There are no any ethical conflicts of interest for all authors. The corresponding authors, Dr. XYS and Dr. XYL take responsibility on behalf of all authors for the authorship, authenticity and integrity of this manuscript, and affirms that all authors and acknowledged contributors have read and approved this manuscript.

Footnotes

Libang He and Zihong Kang contributed equally to this work.

Contributor Information

Libang He, Email: helibangyl@nwafu.edu.cn.

Xianyong Lan, Email: lanxianyong79@nwsuaf.edu.cn.

Xiaoyue Song, Email: songxiaoyue@yulinu.edu.cn.

References

  1. An XP, Hou JX, Lei YN, Gao TY, Song YX, Wang JG, Cao BY. Two mutations in the 5′-flanking region of the KITLG gene are associated with litter size of dairy goats. Anim Genet. 2015;46:308–311. doi: 10.1111/age.12277. [DOI] [PubMed] [Google Scholar]
  2. Baralle FE, Giudice J. Alternative splicing as a regulator of development and tissue identity. Nat Rev Mol Cell Biol. 2017;18(7):437–451. doi: 10.1038/nrm.2017.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen M, Manley JL. Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches. Nat Rev Mol Cell Biol. 2009;10(11):741–754. doi: 10.1038/nrm2777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. E GX, Duan XH, Zhang JH, Huang YF, Zhao YJ, Na RS, Zhao ZQ, Ma YH, Chu MX, Basang WD, Zhu YB, An TW, Luo XL, Han YG, Zeng Y. Genome-wide selection signatures analysis of litter size in Dazu black goats using single-nucleotide polymorphism. 3 Biotech. 2019;9(9):336. doi: 10.1007/s13205-019-1869-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Escobar-Chaparro RA, Guillén G, Espejo-Galicia LU, Meza-Villalvazo VM, Peña-Castro JM, Abad-Zavaleta J. qPCR and HRM-based diagnosis of SNPs on growth differentiation factor 9 (GDF9), a gene associated with sheep (Ovis aries) prolificacy. 3 Biotech. 2017;7(3):204. doi: 10.1007/s13205-017-0837-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Fu S, Wang X. Progress in the effects of androgen and androgen receptor on bone metabolism and its mechanisms. Chin J Cell Biol. 2018;40(6):1041–1048. [Google Scholar]
  7. Guo XM, Liu XP, Chang GB, Xu L, Bi YL, Wang HZ, Zhang Y, Zhu PF, Wu Y, Chen GH. Characterization of the NLRC5 promoter in chicken: SNPs, regulatory elements and CpG islands. Anim Genet. 2016;47:579–587. doi: 10.1111/age.12450. [DOI] [PubMed] [Google Scholar]
  8. Hassan MA, Saeij JP. Incorporating alternative splicing and mRNA editing into the genetic analysis of complex traits. BioEssays. 2014;36(11):1032–1040. doi: 10.1002/bies.201400079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Huang FW, Hodis E, Xu MJ, Kryukov GV, Chin L, Garraway LA. Highly recurrent TERT promoter mutations in human melanoma. Science. 2013;339:957–959. doi: 10.1126/science.1229259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jia W, Wu X, Li X, Xia T, Lei C, Chen H, Pan C, Lan X. Novel genetic variants associated with mRNA expression of signal transducer and activator of transcription 3(STAT3) gene significantly affected goat growth traits. Small Ruminant Research. 2015;129:25–36. [Google Scholar]
  11. Jin Y, Cai H, Liu J, Lin F, Qi X, Bai Y, Lei C, Chen H, Lan X. The 10 bp duplication insertion/deletion in the promoter region within paired box 7 gene is associated with growth traits in cattle. Arch Anim Breed. 2016;59(4):469–476. [Google Scholar]
  12. Julienne MM, Ryan EM, Scott ED. Small insertions and deletions (INDELs) in human genomes. Hum Mol Genet. 2010;19:R131–R136. doi: 10.1093/hmg/ddq400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kang Z, Zhang S, He L, Zhu H, Wang Z, Yan H, Huang Y, Dang R, Lei C, Chen H, Qu L, Lan X, Pan C. A 14-bp functional deletion within the CMTM2 gene is significantly associated with litter size in goat. Theriogenology. 2019;139:49–57. doi: 10.1016/j.theriogenology.2019.07.026. [DOI] [PubMed] [Google Scholar]
  14. Kelemen O, Convertini P, Zhang Z, Wen Y, Shen M, Falaleeva M, Stamm S. Function of alternative splicing. Gene. 2013;514:1–30. doi: 10.1016/j.gene.2012.07.083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Keren H, Lev-Maor G, Ast G. Alternative splicing and evolution: diversification, exon definition and function. Nat Rev Mol Cell Biol. 2010;11(5):345–355. doi: 10.1038/nrg2776. [DOI] [PubMed] [Google Scholar]
  16. Kimura K, Terasaka T, Iwata N, Katsuyama T, Komatsubara M, Nagao R, Inagaki K, Otsuka F. Combined effects of androgen and growth hormone on osteoblast marker expression in mouse C2C12 and MC3T3-E1 cells induced by bone morphogenetic protein. J Clin Med. 2017;6(1):6. doi: 10.3390/jcm6010006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lachance C, Leclerc P. Mediators of the jak/stat signaling pathway in human spermatozoa. Biol Reprod. 2011;85(6):1222–1231. doi: 10.1095/biolreprod.111.092379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lan XY, Peñagaricano F, DeJung L, Weigel KA, Khatib H. A missense mutation in the PROP1 (prophet of Pit 1) gene affects male fertility and milk production traits in the US Holstein population. J Dairy Sci. 2013;96:1255–1257. doi: 10.3168/jds.2012-6019. [DOI] [PubMed] [Google Scholar]
  19. Li M, Sun X, Hua L, Huang Y, Wang J, Cao X, Zhan Z, Lan X, Chen H. Molecular characterization, alternative splicing and expression analysis of bovine DBC1. Gene. 2013;527:689–693. doi: 10.1016/j.gene.2013.05.065. [DOI] [PubMed] [Google Scholar]
  20. Li YC, Xu G, Xu CF. Wnt/β-catenin signaling pathway and its regulation on multi-directional differentiation of bone marrow mesenchymal stem cells. J Mu Dan Jiang Med Univ. 2016;37:99–102. [Google Scholar]
  21. Li J, Zhu X, Lin M, Xu H, Xin C, Chen H, Sun X, Cai Y, Lan X. Detection of a new 20-bp insertion/deletion (indel) within sheep prnd gene using mathematical expectation (ME) method. Prion. 2017;11(2):143–150. doi: 10.1080/19336896.2017.1300740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li Y, Zhang J, Qian Y, Meng C, Wang H, Zhong J, Cao S. A T %3e G mutation in the NR5A2 gene is associated with litter size in Hu sheep through upregulation of promoter activity by transcription factor MTF-1. Front Genet. 2019;10:1011. doi: 10.3389/fgene.2019.01011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liang K, Wang X, Tian X, Geng R, Li W, Jing Z, Han R, Tian Y, Liu X, Kang X, Li Z. Molecular characterization and an 80-bp indel polymorphism within the prolactin receptor (PRLR) gene and its associations with chicken growth and carcass traits. 3 Biotech. 2019;9(8):296. doi: 10.1007/s13205-019-1827-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liu D, Yin C, Zhang Y, Tian L, Li T, Li D, Ma D, Guo Y, Wang Y. Human CMTM2/CKLFSF2 enhances the ligand-induced transactivation of the androgen receptor. Chin Sci Bull. 2009;54(6):1050–1057. [Google Scholar]
  25. Liu S, He S, Chen L, Li W, Di J, Liu M. Estimates of linkage disequilibrium and effective population sizes in Chinese Merino (Xinjiang type) sheep by genome-wide SNPs. Genes Genom. 2017;39:733–745. doi: 10.1007/s13258-017-0539-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Livak K, Schmittgen T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  27. Ma Y, Chen NB, Li F, Fu WW, Han YP, Chang YL, Jiang XX, Li JY, Bai YY, Tan XX. Bovine HSD17B8 gene and its relationship with growth and meat quality traits. Sci Bull. 2015;60(8):1617–1621. [Google Scholar]
  28. Maniatis T, Tasic B. Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature. 2002;418:236–243. doi: 10.1038/418236a. [DOI] [PubMed] [Google Scholar]
  29. Menchaca A, Pinczak A, Rubianes E. Follicular recruitment and ovulatory response to fsh treatment initiated on day 0 or day 3 postovulation in goats. Theriogenology. 2002;58(9):1713–1721. doi: 10.1016/s0093-691x(02)01084-1. [DOI] [PubMed] [Google Scholar]
  30. Mohamad NV, Soelaiman IN, Chin KY. A concise review of testosterone and bone health. Clin Interv Aging. 2016;11:1317–1324. doi: 10.2147/CIA.S115472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Naicy T, Venkatachalapathy RT, Aravindakshan TV, Radhika G, Raghavan KC, Mini M, Shyama K. Nerve Growth Factor gene ovarian expression, polymorphism identification, and association with litter size in goats. Theriogenology. 2016;86:2172–2178. doi: 10.1016/j.theriogenology.2016.07.011. [DOI] [PubMed] [Google Scholar]
  32. O'Hara L, Smith B. Androgen receptor roles in spermatogenesis and infertility. Best Pract Res Clin Endocrinol Metab. 2015;29(4):595–605. doi: 10.1016/j.beem.2015.04.006. [DOI] [PubMed] [Google Scholar]
  33. Shi S, Rui M, Han W, Wang Y, Qiu X, Ding P, Zhang P, Zhu X, Zhang Y, Gan Q, Ma D. CKLFSF2 is highly expressed in testis and can be secreted into the seminiferous tubules. Int J Biochem Cell Biol. 2005;37(8):1633–1640. doi: 10.1016/j.biocel.2004.04.028. [DOI] [PubMed] [Google Scholar]
  34. Singh RK, Xia Z, Bland CS, Kalsotra A, Scavuzzo MA, Curk T, Ule J, Li W, Cooper TA. Rbfox2-coordinated alternative splicing of Mef2d and Rock2 controls myoblast fusion during myogenesis. Mol Cell. 2014;55(4):592–603. doi: 10.1016/j.molcel.2014.06.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang Z, Burge CB. Splicing regulation: from a parts list of regulatory elements to an integrated splicing code. RNA. 2008;14:802–813. doi: 10.1261/rna.876308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, Mayr C, Kingsmore SF, Schroth GP, Burge CB. Alternative isoform regulation in human tissue transcriptomes. Nature. 2008;456(7221):470–476. doi: 10.1038/nature07509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wang X, Zhong J, Gao Y, Ju Z, Huang J. A SNP in intron 8 of CD46 causes a novel transcript associated with mastitis in Holsteins. BMC Genom. 2014;15:630. doi: 10.1186/1471-2164-15-630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wang X, Yang Q, Wang K, Zhang S, Pan C, Chen H, Qu L, Yan H, Lan X. A novel 12-bp indel polymorphism within the GDF9 gene is significantly associated with litter size and growth traits in goats. Anim Genet. 2017;48:735–736. doi: 10.1111/age.12617. [DOI] [PubMed] [Google Scholar]
  39. Wang K, Cui Y, Wang Z, Yan H, Meng Z, Zhu H, Qu L, Lan X, Pan C. One 16 bp insertion/deletion (indel) within the KDM6A gene revealing strong associations with growth traits in goat. Gene. 2019;686:16–20. doi: 10.1016/j.gene.2018.11.010. [DOI] [PubMed] [Google Scholar]
  40. Wang X, Yang Q, Wang K, Yan H, Pan C, Chen H, Liu J, Zhu H, Qu L, Lan X. Two strongly linked single nucleotide polymorphisms (Q320P and V397I) in GDF9 gene are associated with litter size in cashmere goats. Theriogenology. 2019;125:115–121. doi: 10.1016/j.theriogenology.2018.10.013. [DOI] [PubMed] [Google Scholar]
  41. Wang K, Kang ZH, Jiang EH, Yan HL, Zhu HJ, Liu JW, Qu L, Lan XY, Pan CY. Genetic effects of DSCAML1 identified in genome-wide association study revealing strong associations with litter size and semen quality in goat (Capra hircus) Theriogenologygenology. 2020;146:20–25. doi: 10.1016/j.theriogenology.2020.01.079. [DOI] [PubMed] [Google Scholar]
  42. Wang Z, Zhang X, Jiang E, Yan H, Zhu H, Chen H, Liu J, Qu L, Pan C, Lan X. InDels within caprine IGF2BP1 intron 2 and the 3'-untranslated regions are associated with goat growth traits. Anim Genet. 2020;51(1):117–121. doi: 10.1111/age.12871. [DOI] [PubMed] [Google Scholar]
  43. Xia D, Li X, Lou Y, Han W, Ding P, Zhang Y, Di C, Song Q, Ma D. Overexpression of chemokine-like factor 2 promotes the proliferation and survival of C2C12 skeletal muscle cells. Biochem Biophys Acta. 2002;1591(1–3):163–173. doi: 10.1016/s0167-4889(02)00270-7. [DOI] [PubMed] [Google Scholar]
  44. Xiong YQ, Zhou J, Lei T. Research progress in the signal pathways in bone metabolism. Chin J Osteoporos. 2014;20(2):200–204. [Google Scholar]
  45. Xu M, Yang S, Gao Y, Shi S, Ma D. A functional promoter region of the CKLFSF2 gene is located in the last intron/exon region of the upstream CKLFSF1 gene. Int J Biochem Cell Biol. 2005;37(6):1296–1307. doi: 10.1016/j.biocel.2005.01.004. [DOI] [PubMed] [Google Scholar]
  46. Xu WL, Niu LL, Wang WX, Cui PJ. The regulatory role of classic Wnt signaling pathway in bone me tabolism. Chin J Osteoporos. 2016;22:376–380. [Google Scholar]
  47. Yang M, Wei JG, Li PF, Wei SN, Huang YH, Qin QW. MHC polymorphism and disease resistance to Singapore grouper iridovirus (SGIV) in the orange-spotted grouper, Epinephelus coioides. Sci Bull. 2016;61:693–699. [Google Scholar]
  48. Yuan Y, Guo JM, Zou J. Research progress of OPG/RANKL/RANK signal pathway in exercise and osteoimmunology. Chin J Osteoporos. 2015;21(8):1005–1010. [Google Scholar]
  49. Zhang S, Dang Y, Zhang Q, Qin Q, Lei C, Chen H, Lan X. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) rapidly identified a critical missense mutation (P236T) of bovine ACADVL gene affecting growth traits. Gene. 2015;559(2):184–188. doi: 10.1016/j.gene.2015.01.043. [DOI] [PubMed] [Google Scholar]
  50. Zhang X, Wu X, Jia W, Pan C, Li X, Lei C, Chen H, Lan X. Novel nucleotide variations, haplotypes structure and associations with growth-related traits of goat at motif-binding factor (atbf1) gene. Asian–Aust J Anim Sci. 2015;28:1394–1406. doi: 10.5713/ajas.14.0860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang XW, Lan K, Yang WB, Li Q, Zhao YP, Yin HQ, Kite B, Bai WJ, Xu T. Expression and localization of transmembrane protein CMTM2 in human testis and sperm. Beijing Da Xue Xue Bao Yi Xue Ban. 2017;49:575–579. [PubMed] [Google Scholar]
  52. Zhang X, Yan H, Wang K, Zhou T, Chen M, Zhu H, Pan C, Zhang E. Goat CTNNB1: mRNA expression profile of alternative splicing in testis and association analysis with litter size. Gene. 2018;679:297–304. doi: 10.1016/j.gene.2018.08.061. [DOI] [PubMed] [Google Scholar]
  53. Zhang S, Jiang E, Wang K, Zhang Y, Yan H, Qu L, Chen H, Lan X, Pan C. Two Insertion/Deletion Variants within SPAG17 Gene Are Associated with Goat Body Measurement Traits. Animals (Basel) 2019;9(6):E379. doi: 10.3390/ani9060379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhang Y, Cui W, Yang H, Wang M, Yan H, Zhu H, Liu J, Qu L, Lan X, Pan C. A novel missense mutation (L280V) within POU1F1 gene strongly affects litter size and growth traits in goat. Theriogenology. 2019;135:198–203. doi: 10.1016/j.theriogenology.2019.06.021. [DOI] [PubMed] [Google Scholar]
  55. Zhou Y, Cai H, Xu Y, Sun J, Lan X, Lei C, Chen H. Novel isoforms of the bovine Nuclear factor I/X (CCAAT-binding transcription factor) transcript products and their diverse expression profiles. Anim Genet. 2014;45(4):581–584. doi: 10.1111/age.12177. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (DOCX 867 kb) (867.2KB, docx)

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES