Abstract
Premise
Pteroceltis tatarinowii (Ulmaceae), the only species of the genus Pteroceltis, is an endangered tree in China. Here, novel expressed sequence tag–simple sequence repeat (EST‐SSR) markers were developed to illuminate its genetic diversity for conservation and assisted breeding.
Methods and Results
Based on Illumina transcriptome data from P. tatarinowii, a total of 70 EST‐SSR markers were initially designed and tested. Forty‐eight of 70 loci (68.6%) were successfully amplified, of which 20 were polymorphic. The number of alleles per locus ranged from two to six, and the levels of observed and expected heterozygosity ranged from 0.018 to 0.781 and from 0.023 to 0.702, respectively. Additionally, cross‐amplification was successful for 17 loci in two related species, Ulmus gaussenii and U. chenmoui.
Conclusions
These new EST‐SSR markers are valuable transcriptomic resources for P. tatarinowii and will facilitate population genetics and molecular breeding of this species and its relatives in Ulmaceae.
Keywords: endangered tree, microsatellite, Pteroceltis tatarinowii, transcriptome, transferability, Ulmaceae
Pteroceltis tatarinowii Maxim. (Ulmaceae), the only species of Pteroceltis Maxim., is an endangered Tertiary relict deciduous tree endemic to China (Li et al., 2013). Its bark (phloem fiber) has been famously utilized as a raw material to make the traditional Chinese Xuan paper (Cao, 1993; Li et al., 2012). Pteroceltis tatarinowii can adapt well to high‐calcium soil and barren drought conditions, which makes it a popular tree in ecological restoration (You et al., 2018; Zhang et al., 2019). However, in recent decades, the distribution and size of wild P. tatarinowii populations have dramatically decreased due to fragmentation of native habitats and overexploitation for Xuan paper. This species is categorized as a National Class III Key Protected Species in China (Zhang et al., 2019). Therefore, there is an urgent need to perform population genetic studies that will assist in the development of conservation strategies.
With the advent of high‐throughput transcriptome sequencing technologies, expressed sequence tag–simple sequence repeat (EST‐SSR) markers have been rapidly mined in recent years. Compared to anonymous genomic SSRs, EST‐SSRs have many advantages such as linking to species’ functional traits, high polymorphism, more transfer across taxonomic boundaries, and less susceptibility to null alleles and homoplasy (Varshney et al., 2005; Ellis and Burke, 2007; Yoichi et al., 2016). Previous population genetic studies of P. tatarinowii have utilized 12 genomic SSRs composed of dinucleotide repeat and imperfect SSR types (Li et al., 2015; Fan et al., 2019). However, the lack of EST‐SSR markers developed from a transcriptional data set and the insufficient SSR repeat motif types of P. tatarinowii restrict the investigation of population genetics and molecular breeding using abundant information sites. Moreover, EST‐SSR markers are relatively easy and inexpensive to develop, and are more accessible to studies based on functional traits than other types of genomic SSR markers (Hinchliffe et al., 2011; Ukoskit et al., 2018). In this study, we developed novel polymorphic EST‐SSR markers for P. tatarinowii from an Illumina transcriptome data set to elucidate its population genetic diversity and test the transferability of the studied loci in two phylogenetically related Ulmaceae species, Ulmus gaussenii W. C. Cheng and U. chenmoui W. C. Cheng.
METHODS AND RESULTS
Fresh young leaf tissue from one P. tatarinowii tree from Nanjing Botanical Garden, Memorial Sun Yat‐sen in Jiangsu Province, China (Appendix 1), was sampled for transcriptome sequencing. TRIzol reagent (Invitrogen Life Technologies, Carlsbad, California, USA) was used to extract RNA from collected leaves, and an RNA‐Seq data set containing 5.64 Gbp of paired‐end raw reads was generated by the Beijing Genomics Institute using the Illumina HiSeq 2500 platform (Illumina, San Diego, California, USA). The raw reads have been deposited into the National Center for Biotechnology Information Sequence Read Archive (SRA accession number: SRR10158849). Raw reads were initially filtered by removing ambiguous reads (N > 5%) and low‐quality reads (>20% of nucleotides with Q value ≤ 10) and trimming adapters using Trimmomatic (Bolger et al., 2014), yielding 15,264,074 clean reads. Clean reads were then assembled into 94,932 transcripts (N50 = 2212 bp) using Trinity version 2.5 (Grabherr et al., 2011) with the default parameters, and TGICL version 2.1 (Pertea et al., 2003) was used to cluster the transcripts into 42,477 unigenes (N50 = 1581 bp).
SSR screening was performed using MISA (Thiel et al., 2003) with repeat identification ranging from mono‐ to hexanucleotides within the identified unigenes. A total of 6543 EST‐SSR motifs were identified, and 3945 primer pairs were designed using Primer3 software (Rozen and Skaletsky, 1999) with default settings. Seventy primer pairs were randomly chosen for initial screening with five samples (one individual per population; Appendix 1) of P. tatarinowii to ensure the availability and optimal annealing temperature of each pair. One hundred forty‐seven individuals of P. tatarinowii from five wild populations (Appendix 1) were collected to evaluate and validate the polymorphism of the EST‐SSR markers. Two related Ulmaceae species (U. gaussenii and U. chenmoui [n = 10 for each species]; Appendix 1) were selected to test the cross‐amplification of the markers. Total genomic DNA was extracted from silica gel–dried leaves with Plant DNAzol Reagent (Invitrogen Life Technologies) following the manufacturer's protocol. DNA quality was examined on a 0.8% agarose gel stained with 1× GelRed (Biotium Inc., Fremont, California, USA), and the concentration was checked using a Nano‐Drop Lite spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). PCR amplifications were performed on a GeneAmp PCR System 9700 DNA thermal cycler (Perkin‐Elmer, Norwalk, Connecticut, USA) following the standard protocol of the 2× Taq Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China) in a final volume of 15 μL, containing 1 μL (100 ng) of genomic DNA, 7.5 μL of 2× Taq Master Mix, 5.5 μL of deionized water, and 0.5 μL of forward and reverse primers (10 μM). The PCR procedure consisted of 5 min of initial denaturation at 95°C; 35 cycles of 45 s at 95°C, a temperature gradient for annealing from 48°C to 60°C for 30 s, and 30 s of synthesis at 72°C; followed by a final 15‐min extension step at 72°C and a 4°C holding temperature. The resulting 48 primer pairs (68.6%) that produced a clear band in initial screening of five individuals of P. tatarinowii were selected for further tests of polymorphism and transferability.
To screen polymorphisms of these 48 EST‐SSR loci, fluorescence‐based genotyping was performed using 147 individuals from five wild populations (Appendix 1). For all loci, the 5′ end of each forward primer was tagged with one of four fluorescent dyes (FAM, ROX, HEX, or TAMRA; Sangon Biotech, Shanghai, China). The same PCR conditions described above were used for amplification, except for 30 s of annealing at the optimal primer temperature (Table 1). After amplification, we analyzed the multiplex DNA products labeled with the four above‐mentioned fluorescent dyes on an ABI 3730XL DNA Analyzer (Applied Biosystems, Foster City, California, USA) with GeneScan 500 LIZ Size Standard as an internal reference. GeneMarker version 2.2.0 (SoftGenetics, State College, Pennsylvania, USA) was then used to score the electrophoresis peaks and identify polymorphisms. Of the 48 candidate EST‐SSR markers, 20 (41.7%) exhibited polymorphism in P. tatarinowii. All 20 EST‐SSR sequences were deposited in GenBank (Table 1) and were used for cross‐amplification tests. Furthermore, the corresponding sequences of these 20 EST‐SSRs were BLASTed against the GenBank nonredundant database using BLASTX (Altschul et al., 1997) (Table 1). The characteristics of the 28 monomorphic EST‐SSR markers are provided in Appendix 2.
Table 1.
Characteristics of 20 EST‐SSR markers developed for Pteroceltis tatarinowii.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | T a (°C) | Fluorescent dyea | BLASTX top hit description | E‐value | GenBank accession no. |
|---|---|---|---|---|---|---|---|---|
| E2 | F: AAACGTTTTCGTTTTCGGTG | (CCAATA)6 | 218–248 | 58 | FAM | Hypothetical protein L484_008773 [Morus notabilis] | 2.E‐11 | JZ980980 |
| R: TCTATTCTAGCCTTGGGCGA | ||||||||
| E3 | F: AGTTTTGTGTATGCATGCGG | (GATGAA)6 | 115–127 | 58 | HEX | Serine/threonine protein kinase [Trema orientale] | 4.E‐13 | JZ980981 |
| R: CATCCTACCAAAGTCGCCAT | ||||||||
| E4 | F: CCAAGGGATCATCTGGAGAA | (AGACAA)5 | 154–178 | 58 | TAMRA | Splicing factor‐like protein [Parasponia andersonii] | 2.E‐69 | JZ980982 |
| R: ATCCTTCCTCACGACAATGC | ||||||||
| E5 | F: GATTGAAGCCGGGATACTGA | (GGTTGC)5 | 254–272 | 58 | ROX | Splicing factor‐like protein [Trema orientale] | 3.E‐64 | JZ980983 |
| R: ATCGAGGGGTTTTGCTCTTT | ||||||||
| E6 | F: TCTATTCCCCCAAACCACAA | (CAATTT)5 | 248–272 | 58 | FAM | Zinc finger protein [Trema orientale] | 7.E‐31 | JZ980984 |
| R: GAATCCGACATGGGTAAACG | ||||||||
| E15 | F: AGGATGTTGCTATTGTGCCC | (GGTA)6 | 201–221 | 60 | TAMRA | Glycosyl transferase [Trema orientale] | 9.E‐14 | JZ980985 |
| R: TCCCAGTATGTACAAAGCCGT | ||||||||
| E16 | F: AGTGGTTTGTTTTGCCCTTG | (CTTT)5 | 245–257 | 60 | HEX | No significant similarity found | – | JZ980986 |
| R: TGGCATCTTCACACCCAATA | ||||||||
| E19 | F: ATCCCAGGCCTAATGCTTCT | (ATGT)5 | 110–125 | 60 | TAMRA | MYC/MYB transcription factor [Parasponia andersonii] | 6.E‐50 | JZ980987 |
| R: CAGGAATTTGCACGATCTCA | ||||||||
| E21 | F: CACCGTATTGGAAAATAAGTTATCA | (GAAA)5 | 208–220 | 60 | FAM | Mitogen‐activated protein kinase kinase kinase [Trema orientale] | 1.E‐21 | JZ980988 |
| R: GGTTTCGTCATGTTCCTGGT | ||||||||
| E23 | F: CCAGATACATCCAGGCAACA | (AGAA)5 | 185–191 | 60 | HEX | No significant similarity found | – | JZ980989 |
| R: TTGGCAATCTCAGCTTGATG | ||||||||
| E24 | F: CCATGTCACTCCAGGGAATC | (TTGT)5 | 112–132 | 60 | FAM | Golgi SNAP receptor complex, subunit [Trema orientale] | 4.E‐18 | JZ980990 |
| R: CCTCATTTTAGAGGTGCCCA | ||||||||
| E36 | F: TGTCCCAGAGAAAATGGTCC | (ATGA)5 | 196–202 | 60 | HEX | Rab‐GTPase‐TBC domain‐containing protein [Trema orientale] | 3.E‐03 | JZ980991 |
| R: GTTGGCTGAGTTTCGGTCAT | ||||||||
| E42 | F: AAATCCACCACATGGCAGTT | (AGA)5 | 215–233 | 60 | FAM | Chromatin structure‐remodeling complex protein BSH [Morus notabilis] | 3.E‐63 | JZ980992 |
| R: GCACTCTTATTGCCTCTGCC | ||||||||
| E44 | F: AAACGGAGACATTCGGTTTG | (ACC)6 | 111–114 | 60 | HEX | Hypothetical protein Prudu_020836 [Prunus dulcis] | 2.E‐30 | JZ980993 |
| R: CTCCGAACTAGTCTGCCCTG | ||||||||
| E48 | F: AAGATGGAGGAAGAGGGCAT | (GGA)5 | 264–279 | 60 | TAMRA | Chlorophyll A‐B binding protein [Parasponia andersonii] | 2.E‐24 | JZ980994 |
| R: GATTCAAAGGCATCGCAAAT | ||||||||
| E53 | F: AACTACAGCATGGGTTTGCC | (GTG)5 | 255–267 | 60 | TAMRA | 43‐kDa postsynaptic protein [Trema orientale] | 5.E‐73 | JZ980995 |
| R: TGATAGACCCAGGATGAGCC | ||||||||
| E65 | F: AATCGAGTCATCGGAAAACG | (TCT)5 | 238–256 | 60 | ROX | Plastid division protein PDV [Parasponia andersonii] | 8.E‐57 | JZ980996 |
| R: ATGGGGAACTGTAACGCTTG | ||||||||
| E68 | F: AAATGCACGCACACAGAGAC | (AAG)5 | 243–279 | 55 | ROX | DYW domain‐containing protein [Trema orientale] | 2.E‐54 | JZ980997 |
| R: AATTTGAACGATGCGTAATGG | ||||||||
| E69 | F: AAGAAGCAGCGGAAAGATCA | (CTT)5 | 259–279 | 60 | ROX | Protein DA1‐related 2 isoform X1 [Sesamum indicum] | 3.E‐31 | JZ980998 |
| R: ATCCCCAACAAACACCGATA | ||||||||
| E70 | F: AACAGTAATCGTTGGCGTCC | (CTT)6 | 253–257 | 60 | ROX | 43‐kDa postsynaptic protein [Parasponia andersonii] | 4.E‐53 | JZ980999 |
| R: ACCATAGCCGTCGAAATCAC |
T a = annealing temperature.
Fluorescent dye used to tag the 5′ of each forward primer.
Genetic diversity parameters (number of alleles and levels of expected and observed heterozygosity) were calculated in the five wild populations of P. tatarinowii using GenAlEx 6.5 (Peakall and Smouse, 2012). Significant deviation from Hardy–Weinberg equilibrium for each population and linkage disequilibrium for each primer pair were examined with GENEPOP version 4.2 (Rousset, 2008) using a Bonferroni correction. For each population of P. tatarinowii, levels of observed and expected heterozygosity varied from 0.000 to 0.917 (mean = 0.402) and from 0.000 to 0.789 (mean = 0.405), respectively (Table 2). The Hardy–Weinberg equilibrium test indicated that three primer pairs (E3 in the SD population, E4 in the JX and YZJ populations, and E5 in the LYS and TMS populations) deviated significantly from expectations after applying a Bonferroni correction (P < 0.05; Table 2), which might be caused by the Wahlund effect. No significant linkage disequilibrium was observed for any pair of loci after applying a Bonferroni correction.
Table 2.
Genetic diversity statistics for five populations of Pteroceltis tatarinowii and two related taxa based on 20 newly developed EST‐SSR markers.a
| Locus | Pteroceltis tatarinowii | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| LYS (N=32) | JX (N =21) | TMS (N =24) | YZJ (N =34) | SD (N =36) | Ulmus gaussenii (N = 10) | Ulmus chenmoui (N = 10) | |||||||||||||||
| A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | |
| E2 | 6 | 0.844 | 0.789 | 3 | 0.571 | 0.550 | 4 | 0.667 | 0.576 | 4 | 0.647 | 0.520 | 5 | 0.528 | 0.595 | 4 | 0.900 | 0.625 | 4 | 0.400 | 0.645 |
| E3 | 3 | 0.438 | 0.398 | 3 | 0.571 | 0.543 | 3 | 0.583 | 0.624 | 2 | 0.382 | 0.344 | 3 | 0.500 | 0.457* | 3 | 0.700 | 0.515 | 2 | 0.100 | 0.495 |
| E4 | 5 | 0.469 | 0.511 | 3 | 0.286 | 0.346* | 4 | 0.625 | 0.601 | 4 | 0.353 | 0.364* | 3 | 0.583 | 0.481 | 4 | 0.700 | 0.625 | 1 | 0.000 | 0.000 |
| E5 | 4 | 0.219 | 0.556* | 4 | 0.048 | 0.529 | 4 | 0.208 | 0.605* | 3 | 0.235 | 0.211 | 4 | 0.444 | 0.639 | 3 | 0.200 | 0.620 | 2 | 0.000 | 0.500 |
| E6 | 2 | 0.188 | 0.219 | 3 | 0.143 | 0.135 | 4 | 0.375 | 0.438 | 2 | 0.412 | 0.327 | 1 | 0.000 | 0.000 | 2 | 0.100 | 0.095 | 3 | 0.500 | 0.595 |
| E9 | 3 | 0.375 | 0.456 | 2 | 0.619 | 0.482 | 3 | 0.625 | 0.555 | 2 | 0.029 | 0.029 | 3 | 0.444 | 0.439 | 1 | 0.000 | 0.000 | 2 | 0.100 | 0.095 |
| E15 | 4 | 0.719 | 0.667 | 4 | 0.714 | 0.659 | 3 | 0.750 | 0.625 | 4 | 0.706 | 0.625 | 4 | 0.917 | 0.674 | — | — | — | 3 | 0.300 | 0.555 |
| E16 | 3 | 0.125 | 0.250 | 2 | 0.000 | 0.091 | 3 | 0.125 | 0.227 | 2 | 0.206 | 0.375 | 3 | 0.417 | 0.335 | 2 | 0.600 | 0.420 | 2 | 0.200 | 0.320 |
| E19 | 3 | 0.563 | 0.471 | 3 | 0.571 | 0.490 | 3 | 0.292 | 0.317 | 3 | 0.471 | 0.514 | 4 | 0.639 | 0.522 | 1 | 0.000 | 0.000 | 2 | 0.100 | 0.095 |
| E21 | 2 | 0.125 | 0.264 | 2 | 0.095 | 0.091 | 2 | 0.083 | 0.080 | 2 | 0.500 | 0.465 | 2 | 0.222 | 0.239 | 2 | 0.200 | 0.180 | 3 | 0.200 | 0.335 |
| E23 | 2 | 0.281 | 0.242 | 3 | 0.476 | 0.421 | 2 | 0.542 | 0.457 | 2 | 0.029 | 0.029 | 1 | 0.000 | 0.000 | 3 | 0.400 | 0.540 | 2 | 0.300 | 0.255 |
| E24 | 2 | 0.469 | 0.460 | 5 | 0.524 | 0.689 | 2 | 0.458 | 0.430 | 4 | 0.324 | 0.590 | 3 | 0.278 | 0.509 | 2 | 0.200 | 0.180 | — | — | — |
| E36 | 3 | 0.156 | 0.200 | 3 | 0.238 | 0.217 | 3 | 0.333 | 0.288 | 2 | 0.364 | 0.397 | 3 | 0.083 | 0.081 | 3 | 0.200 | 0.185 | 2 | 0.500 | 0.455 |
| E38 | 3 | 0.031 | 0.061 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.029 | 0.029 | 2 | 0.028 | 0.027 | 2 | 0.100 | 0.095 | 2 | 0.300 | 0.255 |
| E42 | 3 | 0.563 | 0.510 | 4 | 0.667 | 0.627 | 3 | 0.375 | 0.555 | 4 | 0.412 | 0.386 | 5 | 0.500 | 0.482 | 2 | 0.200 | 0.320 | 1 | 0.000 | 0.000 |
| E44 | 6 | 0.906 | 0.744 | 7 | 0.762 | 0.688 | 5 | 0.750 | 0.670 | 5 | 0.765 | 0.681 | 7 | 0.722 | 0.728 | — | — | — | 1 | 0.000 | 0.000 |
| E48 | 2 | 0.625 | 0.498 | 3 | 0.429 | 0.441 | 3 | 0.500 | 0.469 | 3 | 0.706 | 0.501 | 2 | 0.833 | 0.500 | 2 | 0.400 | 0.420 | 2 | 0.600 | 0.480 |
| E53 | 3 | 0.250 | 0.271 | 3 | 0.143 | 0.357 | 3 | 0.125 | 0.192 | 2 | 0.412 | 0.327 | 2 | 0.056 | 0.105 | 2 | 0.200 | 0.180 | 2 | 0.100 | 0.255 |
| E68 | 2 | 0.531 | 0.488 | 2 | 0.429 | 0.482 | 2 | 0.333 | 0.278 | 2 | 0.441 | 0.489 | 2 | 0.500 | 0.500 | 3 | 0.700 | 0.515 | 2 | 0.500 | 0.375 |
| E70 | 2 | 0.344 | 0.390 | 2 | 0.714 | 0.482 | 3 | 0.375 | 0.430 | 2 | 0.265 | 0.271 | 2 | 0.472 | 0.500 | 1 | 0.000 | 0.000 | 2 | 0.100 | 0.095 |
| Average | 3.15 | 0.411 | 0.422 | 3.10 | 0.400 | 0.416 | 3.00 | 0.406 | 0.421 | 2.80 | 0.384 | 0.374 | 3.05 | 0.408 | 0.391 | 2.55 | 0.405 | 0.373 | 2.50 | 0.320 | 0.395 |
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
Significant departure from Hardy–Weinberg equilibrium at P < 0.05.
Cross‐species amplification tests of the 20 loci in U. gaussenii and U. chenmoui followed the PCR procedures mentioned above. PCR products were detected using 2% agarose gels, and amplification was considered successful when one clear band was visible in the expected size range. We further analyzed the successful amplification products on an ABI 3730XL DNA Analyzer (Applied Biosystems) with GeneScan 500 LIZ Size Standard as an internal reference. GeneMarker version 2.2.0 (SoftGenetics) was then employed to score the electrophoresis peaks and identify polymorphisms. Overall, all loci were successfully amplified and exhibited polymorphisms, except for locus E36 for U. chenmoui and loci E16 and E53 for U. gaussenii (Table 2).
CONCLUSIONS
Using high‐throughput RNA sequencing data, we developed 20 polymorphic EST‐SSR markers for P. tatarinowii. Most of these markers showed high transferability in two related species, suggesting that they may contribute to the population genetics and molecular breeding of other Ulmaceae species.
ACKNOWLEDGMENTS
The authors thank Jie Yang and Xin Zhuang for their assistance in collecting plant materials. This study was supported by the National Natural Science Foundation of China (grant no. 30970512).
Appendix 1. Locality and voucher information for populations of Pteroceltis tatarinowii, Ulmus gaussenii, and U. chenmoui used in this study.
| Species | Voucher specimensa | Population code | N | Collection locality | Geographic coordinates |
|---|---|---|---|---|---|
| P. tatarinowii Maxim. | WGZ 20180421 | LYS | 32 | Langya Mountain, Anhui, China | 32°17′N, 118°17′E |
| P. tatarinowii | ZMY 20180428 | JX | 21 | Jingxian, Anhui, China | 30°39′N, 118°23′E |
| P. tatarinowii | ZMY 20180429 | TMS | 24 | Tianmu Mountain, Zhejiang, China | 30°19′N,119°26′E |
| P. tatarinowii | ZMY 20180430 | YZJ | 34 | Swallow Promontory, Jiangsu, China | 32°09′N, 118°49′E |
| P. tatarinowii | ZMY 20180504 | SD | 36 | Shidu, Beijng, China | 39°40′N, 115°31′E |
| U. gaussenii W. C. Cheng | ZX 20171012 | ZWY | 10 | Langya Mountain, Anhui, China | 32°17′N, 118°17′E |
| U. chenmoui W. C. Cheng | ZX 20171012 | LYY | 10 | Langya Mountain, Anhui, China | 32°17′N, 118°17′E |
N = number of individuals sampled.
aVouchers were deposited in the Herbarium of Zhejiang University (HZU), Hangzhou, Zhejiang Province, China.
Appendix 2. Characteristics of 28 monomorphic EST‐SSR markers developed from the transcriptome of Pteroceltis tatarinowii.
| Locus | Primer sequences (5′–3′) | Repeat motif | T a (°C) | Allele size range (bp) |
|---|---|---|---|---|
| E7 | F: TTCCTTGGAAGCCTCAGTTG | (AACCTG)5 | 58 | 118 |
| R: CGAGGTTCGGTTTGTTGTTT | ||||
| E8 | F: TTGATGCTGATGGTGGTGAT | (TGTTGG)5 | 58 | 117 |
| R: CAAGATTCAGAAAAAGGGCG | ||||
| E11 | F: TAACGCCCAGTAGGAATCCA | (ATATC)5 | 60 | 275 |
| R: GCGCAGGGTAGTGATAGAGG | ||||
| E14 | F: AGGAGGTTCGACTCCTGGAT | (TTCC)5 | 60 | 250 |
| R: AAAAAGGAAGTGTGGTATGTGTATG | ||||
| E22 | F: CAGTGAGCCAACAGAGTGGA | (TTTC)5 | 58 | 172 |
| R: AAAGGCACCATGTCCAAAAC | ||||
| E25 | F: CCCTTAGTTTAGCCGCAGTG | (GGTT)5 | 60 | 251 |
| R: ATGGGCATGGATTGCCTAAT | ||||
| E27 | F: CGAGGCCGAGACAAGTAAAG | (ATTA)5 | 55 | 176 |
| R: CCAACAAAATCTTTAAGGATATGAAA | ||||
| E28 | F: GGAGACGAAATTGTTGGTGG | (CTTT)5 | 58 | 219 |
| R: TGGTCGAATCTTTCCCACTC | ||||
| E29 | F: GGCTTGATGTGCTCCAAGTT | (AAAC)5 | 60 | 251 |
| R: CCCAAAGGAAATAAAATAGGCA | ||||
| E35 | F: TGATGGAGGCGACATTGATA | (TTAA)5 | 60 | 251 |
| R: TTCCTCAGTCCACCATGACA | ||||
| E37 | F: TGTGGTGCTTCAGCTCATTC | (TTTG)6 | 60 | 224 |
| R: CCCTGCAGATCTGTCAAACA | ||||
| E39 | F: AAGGAATGTACCTCGGCTCA | (CCG)5 | 60 | 280 |
| R: CTCCTAAACACCAGGACCCA | ||||
| E41 | F: AATGGCGATTTGAAAGATGG | (ATG)5 | 60 | 271 |
| R: CACCCTCTGCCTCCTTAACA | ||||
| E43 | F: AACGTTCAAATGCGCCTAGT | (CAC)6 | 60 | 251 |
| R: CCAGAGCTTGACCTCTTTGG | ||||
| E45 | F: AATGGCGAATTTGAAGATGG | (GAA)5 | 60 | 241 |
| R: TTTCGGTTCTCTGAATTGGG | ||||
| E47 | F: AACCCACACTACCGCTCATC | (GGT)7 | 60 | 219 |
| R: CTTTGCTTCCCATTCAGCTC | ||||
| E50 | F: AACAACACCCCAACCAAAAA | (CTT)5 | 55 | 208 |
| R: TGGGATGACTTCCATTCCAT | ||||
| E51 | F: AAGGACGACAAGGGTGTTTG | (GGC)5 | 60 | 206 |
| R: TATTTGGCTCGTAACCGAGG | ||||
| E52 | F: AATTAGGGCAAGGGTCGAGT | (CAA)5 | 60 | 199 |
| R: CCATCACCTCCCATGTTACC | ||||
| E54 | F: AACCCCCTCCTTTCTTGTGT | (TTA)5 | 60 | 191 |
| R: GACAAAAGGTTGGCTTCGTG | ||||
| E56 | F: AAATTCACCACCGGATGAAA | (GAA)5 | 60 | 172 |
| R: CTTCCGCTTTCCTCTTCCTC | ||||
| E59 | F: AAACCCAAAGGAAAAGTTAAAAA | (ATA)6 | 55 | 162 |
| R: TGTGCTTTGGGCCTTAGAGT | ||||
| E60 | F: AAAGGCCAGAGAATTGGGTT | (AAT)5 | 60 | 155 |
| R: CAAACTTTGGCTTGAACGAA | ||||
| E61 | F: AACTCACTCGACCCAACCAC | (CCT)5 | 60 | 152 |
| R: GAGGCGATGGTGAAGAAGAG | ||||
| E62 | F: AACAAGGCTCGTCGAATGTC | (ATC)5 | 60 | 149 |
| R: GGACCTATGCAGTCCTTCCA | ||||
| E64 | F: AAGAAGGAGGAGATGGTGGG | (GAG)6 | 60 | 134 |
| R: TGGCTCAGACAGTTCCAATG | ||||
| E65 | F: AATCGAGTCATCGGAAAACG | (TCT)5 | 60 | 132 |
| R: ATGGGGAACTGTAACGCTTG | ||||
| E69 | F: AAGAAGCAGCGGAAAGATCA | (CTT)5 | 60 | 112 |
| R: ATCCCCAACAAACACCGATA |
T a = annealing temperature.
Zhang, M. , Zhang Y., Wang G., Zhou J., Tian Y., Geng Q., and Wang Z.. 2020. Development and characterization of 20 novel EST‐SSR markers for Pteroceltis tatarinowii, a relict tree in China. Applications in Plant Sciences 8(2): e11320.
Contributor Information
Qifang Geng, Email: gengqifang@126.com.
Zhongsheng Wang, Email: wangzs@nju.edu.cn.
DATA AVAILABILITY
Raw reads have been deposited into the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA accession number: SRR10158849). Primer sequences have been deposited to NCBI's GenBank database; accession numbers are listed in Table 1.
LITERATURE CITED
- Altschul, S. F. , Madden T. L., Schaffer A. A., Zhang J., Zhang Z., Miller W., and Lipman D. J.. 1997. Gapped BLAST and PSI‐BLAST: A new generation of protein database search programs. Nucleic Acids 25: 3389–3444. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bolger, A. M. , Lohse M., and Usadel B.. 2014. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cao, T. S. 1993. Xuan paper of China. China Light Industry Press, Beijing, China. [Google Scholar]
- Ellis, J. R. , and Burke J. M.. 2007. EST‐SSRs as a resource for population genetic analyses. Heredity 99: 125–132. [DOI] [PubMed] [Google Scholar]
- Fan, J. J. , Zhang X. P., Liu K., Liu H. J., Zhang L., Wang X. P., and Li X. H.. 2019. The population genetic diversity and pattern of Pteroceltis tatarinowii, a relic tree endemic to China, inferred from SSR markers. Nordic Journal of Botany 2019: e01922. [Google Scholar]
- Grabherr, G. M. , Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Full‐length transcriptome assembly from RNA‐Seq data without a reference genome. Nature Biotechnology 29: 644–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hinchliffe, D. J. , Turley R. B., Naoumkina M., Kim H. J., Tang Y., Yeater K. M., Li P., and Fang D. D.. 2011. A combined functional and structural genomics approach identified an EST‐SSR marker with complete linkage to the Ligon lintless‐2 genetic locus in cotton (Gossypium hirsutum L.). BMC Genomics 12: 445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, X. H. , Shao J. W., Lu C., Zhang X. P., and Qiu Y. X.. 2012. Chloroplast phylogeography of a temperate tree Pteroceltis tatarinowii (Ulmaceae) in China. Journal of Systematics and Evolution 50: 325–333. [Google Scholar]
- Li, X. H. , Zhang H., Wang D. Y., Zhang L., Shao J. W., and Zhang X. P.. 2013. The genetic structure of endemic plant Pteroceltis tatarinowii by ISSR markers. Acta Ecologica Sinica 33: 4892–4901. [Google Scholar]
- Li, X. H. , Zhang X. P., Liu K., Liu H. J., and Shao J. W.. 2015. Efficient development of polymorphic microsatellite loci for Pteroceltis tatarinowii (Ulmaceae). Genetic and Molecular Research 14: 16444–16449. [DOI] [PubMed] [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research: An update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pertea, G. , Huang X. Q., Liang F., Antonesc V., Sultana R., Karamycheva S., Lee Y. D., et al. 2003. TIGR Gene Indices clustering tools (TGICL): A software system for fast clustering of large EST datasets. Bioinformatics 9: 651–652. [DOI] [PubMed] [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete re‐implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Rozen, S. , and Skaletsky H.. 1999. Primer3 on the WWW for general users and for biologist programmers In Misener S. and Krawetz S. A. [eds.], Methods in molecular biology, vol. 132: Bioinformatics: Methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Thiel, T. , Michalek W., Varshney R. K., and Graner A.. 2003. Exploiting EST databases for the development and characterization of gene‐derived SSR‐markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
- Ukoskit, K. , Posudsavang G., Pongsiripat N., Chatwachirawong P., Klomsaard P., Poomipant P., and Tragoonrung S.. 2018. Detection and validation of EST‐SSR markers associated with sugar‐related traits in sugarcane using linkage and association mapping. Genomics 111: 1–9. [DOI] [PubMed] [Google Scholar]
- Varshney, R. K. , Graner A., and Sorrells M. E.. 2005. Genic microsatellite markers in plants: Features and applications. Trends in Biotechnology 23: 48–55. [DOI] [PubMed] [Google Scholar]
- Yoichi, W. , Sakaguchi S., Ueno S., Tomaru N., and Uehara K.. 2016. Development and characterization of EST‐SSR markers for the genus Rhododendron section Brachycalyx (Ericaceae). Plant Species Biology 32: 455–459. [Google Scholar]
- You, H. M. , Kazue F., and Tang Q.. 2018. Phytosociological study of Pteroceltis tatarinowii forest in the deciduous‐forest zone of eastern China In Greller A., Fujiwara K., and Pedrotti F. [eds.], Geographical changes in vegetation and plant functional types, 239–280. Springer, Cham, Switzerland. [Google Scholar]
- Zhang, Y. Y. , Wang G. Z., Zhou J. H., Zhou X. P., Li P. F., and Wang Z. S.. 2019. The first complete chloroplast genome sequence of Pteroceltis tatarinowii (Ulmaceae), an endangered tertiary relict tree endemic to China. Mitochondrial DNA Part B 4: 487–488. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Raw reads have been deposited into the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA accession number: SRR10158849). Primer sequences have been deposited to NCBI's GenBank database; accession numbers are listed in Table 1.