Abstract
The present study was performed to investigate the prevalence and characteristics of virulence genes in Escherichia coli (E. coli) isolated from piglets suffering post‐weaning diarrhoea (PWD) in Shandong Province, China. The standard bacteriological method was used to isolate and identify E. coli, and then multiplex polymerase chain reaction (mPCR) was performed to determine virulence genes in E. coli. Among the 300 isolates, 166 (55.3％) harboured at least one virulence gene. Among the 166 isolates, 155 (93.4％) contained toxin‐related genes. For enterotoxin genes, EAST1 (58/166, 34.9％) and LT‐I (45/166, 27.1％) were the most common, followed by STa (32/166, 19.3％) and STb (21/166, 12.7％); for pathogenicity island (PAI) genes, irp2 (49/166, 29.5％) was the most dominant, followed by eae (48/166, 28.9％); for Shiga toxigenic E. coli (STEC)‐associated toxin genes, Stx2e and hlyA genes were observed in 19 (19/166, 11.4％) and three strains (3/166, 1.8％) respectively. In addition, of the 166 isolates, 95 (95/166, 57.2％) contained adhesin genes, and AIDA‐I (33/166, 19.9％) was the most common, followed by paa (27/166, 16.3％), F5 (K99) (20/166, 12.0％), F18 (15/166, 9.0％) and F41 (12/166, 7.2％). In summary, these findings demonstrated the prevalence and characteristics of virulence factors in E. coli isolates from piglets with PWD in Shandong Province of China, and the data may be useful for establishing preventive measures for post‐weaning piglet diarrhoea.
Keywords: adhesin gene, Escherichia coli, post‐weaning diarrhoea, toxin gene, virulence factors
Conclusively, these results could provide epidemiological data about the distribution and characterization of virulence factors in E. coli isolates from piglets with PWD in Shandong province, China, and would be helpful for taking measures against diarrhea cases among piglets.
1. INTRODUCTION
Pathogenic Escherichia coli (E. coli) can induce post‐weaning diarrhoea (PWD) in piglets and can lead to significant economic losses in swine industry because of high morbidity, mortality, growth retardation and increased therapy costs (Alexa, Hamřík, Konstantinová, & Šrámková‐Zajacová, 2011; Fairbrother & Nadeau, 2005; van Beers‐Schreurs, Vellenga, Wensing, & Breukink, 1992). Numerous studies have showed that enterotoxigenic E. coli (ETEC) can cause piglet diarrhoea, which is primarily associated with the fact that ETEC can express fimbriae to mediate attachment to pig enterocytes and colonization; ETEC F4 (K88) and F18 are the leading cause of PWD of piglets, other fimbrial types, including F5 (K99), F6 (987P) and F41 are typical of neonatal diarrhoea (Kim, Kim, Hur, & Lee, 2010; Kwon et al., 2002; Vu‐Khac et al., 2007; Zhang, Zhao, Ruesch, Omot, & Francis, 2007). In addition, ETEC can produce enterotoxins, including heat‐labile (LT‐I and LT‐II) and heat‐stable (STa and STb), to destroy fluid homoeostasis in the intestine leading to diarrhoea (Liu et al., 2014; Luppi et al., 2016). Many investigations demonstrated that enteroaggregative E. coli heat‐stable enterotoxin 1 (EAST1) is frequently detected among pathogenic E. coli isolates from humans and animals with diarrhoea (Liu et al., 2014; Toledo et al., 2012; Vu‐Khac et al., 2007; Zhang et al., 2007).
Pathogenic E. coli can also produce other virulence factors, which are closely related with PWD cases in piglets. These virulence factors mainly included pathogenicity islands (PAI), Shiga toxigenic E. coli (STEC)‐associated virulence factors and non‐fimbrial adhesins (Liu et al., 2014). Specifically, the locus of enterocyte effacement (LEE) and high‐pathogenicity island (HPI) are the significant PAIs and are frequently detected in enteropathogenic E. coli (EPEC) isolated from piglets with diarrhoea (Cheng, Sun, Xu, & Gao, 2006; Liu et al., 2014). The LEE encodes attaching and effacing factor (eae) and a transcriptional regulator, ler (Barba et al., 2005; Jores, Rumer, & Wieler, 2004), and HPI carries irp2 gene, which is regarded as a specific detection marker for the HPI (Rakin, Noelting, Schubert, & Heesemann, 1999). STEC can cause oedema and diarrhoea in piglets due to expression of many kinds of virulence factors, such as Shiga toxins (Stx1, Stx2 and their variants), LEE, PAI, α‐haemolysin (hlyA) and the STEC autoagglutinating adhesin (saa) (Gyles, 2007; Toledo et al., 2012). Additionally, adhesins involved in diffuse adherence (AIDA‐I) and porcine attaching and effacing‐associated (paa) factors were important non‐fimbrial adhesins frequently found in E. coli strains isolated from piglets with diarrhoea (Liu et al., 2014; Zhang et al., 2007).
In general, E. coli isolated from piglets with diarrhoea carry different types of virulence factors, which can enhance pathogenicity of E. coli via synergistic effects. Furthermore, the detection frequency of these virulence factors is known to vary greatly over time (Kim et al., 2010; Liu et al., 2014; Toledo et al., 2012; Zhang et al., 2007). In Shandong Province of China, a large number of small‐scale pig farms (10–50 sows per each farm, and semi‐intensive management method), many of which frequently suffer economic losses due to PWD in piglets caused by pathogenic E. coli, however, little data are available about characteristics of virulence genes of E. coli isolated from piglets with PWD (Chen & He, 2017). Therefore, the present study was performed to characterize virulence genes of E. coli isolated from piglets with PWD in Shandong Province, China, with the aim to provide reference data for controlling PWD in piglets.
2. MATERIALS AND METHODS
2.1. Collection of samples
A cross‐section sampling was carried out between 2016 and 2018. Rectal samples were obtained from weaned piglets (5–7 weeks old) with obvious symptoms of PWD on 36 pig farms (10–50 sows per each farm, semi‐intensive management method and the pigs were kept in backyard farms) in Shandong Province, China. Clinical signs of piglets were diarrhoea, depression, dehydration and increased mortality (van Beers‐Schreurs et al., 1992).
When clinical signs of piglets with PWD were observed by farmers, faecal samples were immediately collected within 24 hr.
Sampling was conducted using sterile cotton swabs. Collected samples were promptly transported on ice in a cool box to our microbiological laboratory within 24 hr for bacterial culture and isolation (Ikwap et al., 2014).
2.2. Culture, isolation and identification of E. coli
Bacterial cultivation for E. coli was conducted based on previously published procedures (Ikwap et al., 2016). Briefly, each sample was directly cultured onto sterile MacConkey agar (Hopebiol, Qingdao, China) and incubated at 37°C overnight under aerobic condition. From each sample, 2–4 lactose‐fermenting colonies with obvious morphological differences were selected and biochemically confirmed. The confirmed E. coli were stored at −20°C in Luria–Bertani (LB) broth containing 20％ glycerol (Hopebiol, Qingdao, China) for DNA extraction.
2.3. DNA extraction and multiplex PCR for virulence genes
The boiling method was used to extract total bacterial DNA of each E. coli strain (Levesque, Piche, Larose, & Roy, 1995). As previously described (Bertin, Martin, Girardeau, Pohl, & Contrepois, 1998; Cheng et al., 2006; Liu et al., 2014; Osman, Mustafa, Aly, & AbdElhamed, 2012; Paton & Paton, 1998, 2002; Vu‐Khac et al., 2007; Zhang et al., 2007), multiplex polymerase chain reaction (mPCR) was used to determine 21 virulence genes encoding enterotoxins (LT‐I, LT‐II, STa, STb, and EAST1), fimbriae (K88, K99, 987P, F41, and F18), non‐fimbrial adhesins (AIDA‐I, paa, eae, and saa), Shiga toxins (Stx1, Stx2, and Stx2e), HPI and α‐haemolysin (hlyA). The reaction volume (20μL) comprised 2μM of each primer (Table 1), 2 × Master Mix (Takara, Dalian, China) and 3μl of DNA template. mPCR conditions were as follows: 95°C denaturation (15 min), 94°C denaturation for 1 min, 58°C annealing for 1 min, 72°C extension for 1 min (30 cycles) and a final extension for 7 min at 72°C. The products were visualized in 2% agarose gels stained with ethidium bromide using electrophoresis. Positive and negative control bacteria used in the mPCR were displayed in the Table 2.
Table 1.
Primers used in this study to amplify E. coli virulence factor genes
| Virulence factors | Forward primers (5’−3’) | Reverse primers (5’−3’) | Size of product (base pairs) |
|---|---|---|---|
| LT‐I | TAGAGACCGGTATTACAGAAATCTGA | TCATCCCGAATTCTGTTATATATGTC | 282 |
| LT‐II | AGATATAATGATGGATATGTATC | TAACCCTCGAAATAAATCTC | 300 |
| STa | GGGTTGGCAATTTTTATTTCTGTA | ATTACAACAAAGTTCACAGCAGTA | 183 |
| STb | ATGTAAATACCTACAACGGGTGAT | TATTTGGGCGCCAAAGCATGCTCC | 360 |
| EAST1 | ATGCCATCAACACAGTATATC | TCAGGTCGCGAGTGACGG | 117 |
| K88 | GATGAAAAAGACTCTGATTGCA | GATTGCTACGTTCAGCGGAGCG | 841 |
| K99 | CTGAAAAAAACACTGCTAGCTATT | CATATAAGTGACTAAGAAGGATGC | 543 |
| 987P | GTTACTGCCAGTCTATGCCAAGTG | TCGGTGTACCTGCTGAACGAATAG | 463 |
| F41 | GATGAAAAAGACTCTGATTGCA | TCTGAGGTCATCCCAATTGTGG | 682 |
| F18 | ATGAAAAGACTAGTGTTTATTTCTT | TTACTTGTAAGTAACCGCGTAAGCC | 520 |
| AIDA‐I | ACAGTATCATATGGAGCCA | TGTGCGCCAGAACTATTA | 586 |
| paa | CCATAAAGACAGCTTCAGTGAAAA | GTATTACTGGTACCACCACCATCA | 162 |
| eae | ATATCCGTTTTAATGGCTATCT | AATCTTCTGCGTACTGTGTTCA | 425 |
| ler | AACAAGCCCATACATTCAGC | GCCATCATCAGGCACATTAG | 169 |
| irp2 | AAGGATTCGCTGTTACCGGAC | TCGTCGGGCAGCGTTTCTTCT | 287 |
| Stx1 | ATTCGCTGAATGTCATTCGCT | ACGCTTCCCAGAATTGCATTA | 664 |
| Stx2 | GAATGAAGAAGATGTTTATAGCGG | GGTTATGCCTCAGTCATTATTAA | 281 |
| Stx2e | GAATGAAGAAGATGTTTATAGCGG | TTTTATGGAACGTAGGTATTACC | 454 |
| saa | CGTGATGAACAGGCTATTGC | ATGGACATGCCTGTGGCAAC | 119 |
| hlyA | GCATCATCAAGCGTACGTTCC | AATGAGCCAAGCTGGTTAAGCT | 533 |
Table 2.
Positive and negative control bacteria used in the mPCR
| Strain | Virulence factor | Source |
|---|---|---|
| C83903 | K88, LT‐I, STb, EAST1 | CIVDC |
| C83920 | K99, F41, STa | CIVDC |
| C83529 | K99, STa | CIVDC |
| C83915 | 987P, STa | CIVDC |
| C83684 | F18ab, Stx2e | CIVDC |
| CMCC44498 | F18ab, Stx2e | CIVDC |
| TSMC152 | LEE, hlyA | TSMC |
| TSMC129 | EAST1, HPI, F17 | TSMC |
| TSMC117 | Stx1, LEE, HPI, EAST1, K88, CS31A | TSMC |
| TSMC02 | HPI, F17, 987P | TSMC |
| TSMC09 | HPI, AIDA‐I | TSMC |
| TSMC107 | HPI, eae | TSMC |
| TSMC122 | Stx1, irp2, saa | TSMC |
| TSMC163 | K88, ler | TSMC |
| TSMC103 | AIDA‐I | TSMC |
| TAMC108 | paa | TSMC |
| TSMC212 | None | TSMC |
CIVDC, China Institute of Veterinary Drug Control; TSMC, Taishan Medical University, China.
2.4. Statistical analyses
The Chi‐squared test was employed to analyse the data. When P values were less than 0.05, difference was considered statistically significant. Data analyses were performed using the Stata 11 software (StataCorp Lp).
3. RESULTS
3.1. E. coli isolates
A total of 300 E. coli isolates were obtained from 162 samples from different piglets with PWD. The results of mPCR showed that 166 E. coli isolates contained at least one virulence gene (166/300, 55.3％), whereas no virulence gene was detected in the other 134 strains (134/300, 44.7％).
3.2. Toxin‐associated genes and category
Among the 166 isolates carrying virulence genes, 155 (155/166, 93.4％) were detected positive for toxin‐related genes. In terms of enterotoxin genes, EAST1 (58/166, 34.9％) and LT‐I (45/166, 27.1％) were the most common, followed by STa (32/166, 19.3％) and STb (21/166, 12.7％), but no LT‐II gene was found in this study. In terms of PAI genes, irp2 (49/166, 29.5％) was the most dominant, followed by eae (48/166, 28.9％), whereas no ler gene was detected. In terms of STEC‐associated toxin genes, Stx2e and hlyA genes were respectively observed in 19 (19/166, 11.4％) and three strains (3/166, 1.8％), but no isolate carried the Stx1 or Stx2 genes (Table 3).
Table 3.
Distribution and category of E. coli isolates positive for toxin‐associated genes
| Category | Toxin gene | No. of isolates |
|---|---|---|
| ETEC | STa | 1 |
| STa/LT‐I | 5 | |
| STa/STb/LT‐I | 8 | |
| LT‐I/STa/STb/EAST1 | 8 | |
| LT‐I | 1 | |
| EAST1 | 29 | |
| 52 (52/166, 31.3％) | ||
| EPEC | eae | 16 |
| irp2 | 25 | |
| 41 (41/166, 24.7％) | ||
| STEC | Stx2e | 1 |
| 1 (1/166, 0.6％) | ||
| ETEC/EPEC | STa/eae | 2 |
| STa/LT‐I/eae | 5 | |
| LT‐I/eae | 12 | |
| irp2/EAST1 | 21 | |
| 40 (40/166, 24.1％) | ||
| ETEC/EPEC/STEC | STa/irp2/hlyA | 3 |
| LT‐I/Stx2e/eae | 6 | |
| 9 (9/166, 5.4％) | ||
| ETEC/STEC | STb/Stx2e | 5 |
| STEC/EPEC | Stx2e/eae | 7 |
| Nonea | 11(11/166, 6.6％) | |
| Total | 166 |
Isolates negative for toxin‐associated genes.
These 155 E. coli can be divided into seven categories: ETEC, EPEC, STEC, ETEC/EPEC, ETEC/EPEC/STEC, ETEC/STEC and STEC/EPEC, with 52 (52/166, 31.3％), 41 (41/166, 24.7％), 1 (1/166, 0.6％), 40 (40/166, 24.1％), 9 (9/166, 5.4％), 5 (5/166, 3.0％) and 7 (7/166, 4.2％) strains for each category respectively (Table 3).
3.3. Fimbrial and non‐fimbrial adhesin genes
Among the 166 isolates carrying virulence genes, 95 (95/166, 57.2％) contained fimbrial and non‐fimbrial adhesin genes, and AIDA‐I (33/166, 19.9％) was the most common, followed by paa (27/166, 16.3％), F5 (K99) (20/166, 12.0％), F18 (15/166, 9.0％), F41 (12/166, 7.2％), F6 (987P) (10/166, 6.0％) and F4 (K88) (10/166, 6.0％).
Noticeably, seven different combinations of adhesin factors were observed, including K88/paa, F6/F41, K99/paa, AIDA‐I/paa, F18/F41, K99/F41 and K99/F18/F41. The most common combinations were AIDA‐I/paa (eight isolates), K99/paa (seven isolates) and K99/F41(six isolates) (Table 4).
Table 4.
Distribution and characteristics of E. coli isolates positive for adhesin genes
| Adhesin gene | No. of isolates (％) |
|---|---|
| K88 | 8 (4.8) |
| F6 | 8 (4.8) |
| K88/paa | 2 (1.2) |
| F6/F41 | 2 (1.2) |
| K99/paa | 7 (4.2) |
| paa | 10 (6.0) |
| AIDA‐I/paa | 8 (4.8) |
| AIDA‐I | 25 (17.5) |
| F18 | 11 (6.6) |
| K99 | 4 (2.4) |
| F18/F41 | 1 (0.6) |
| K99/F41 | 6 (3.6) |
| K99/F18/F41 | 3 (1.8) |
| Nonea | 71(42.8) |
| Total | 166 |
Isolates negative for adhesin genes.
3.4. Combination of fimbriae and enterotoxins
Among the 166 isolates carrying virulence genes, 20 (20/166, 12.0％) concurrently contained fimbriae and enterotoxins. Of the 20 isolates, 15 different combinations were observed, with K99/paa/EAST1 being the most predominant (four isolates), followed by F18/STa/LT‐I (two isolates) (Table 5).
Table 5.
Distribution of virulence genes among 166 virulence‐positive E. coli isolates in this study
| Adhesin gene | toxin gene | No. of isolates |
|---|---|---|
| K88 | NDa | 7 |
| K88 | STa/irp2/hlyA | 1 |
| F6 | eae | 8 |
| K88/paa | EAST1 | 1 |
| K88/paa | irp2 | 1 |
| F6/F41 | STa/LT‐I | 2 |
| K99/paa | EAST1 | 4 |
| K99/paa | irp2 | 3 |
| paa | ND | 4 |
| paa | EAST1 | 3 |
| paa | irp2 | 3 |
| AIDA‐I/paa | EAST1 | 4 |
| AIDA‐I/paa | irp2 | 4 |
| AIDA‐I | LT‐I/STa/STb/EAST1 | 5 |
| AIDA‐I | EAST1 | 12 |
| AIDA‐I | irp2 | 8 |
| F18 | eae | 1 |
| F18 | STa | 1 |
| F18 | LT‐I | 1 |
| F18 | STa/LT‐I | 2 |
| F18 | Stx2e/eae | 4 |
| F18 | LT‐I/Stx2e/eae | 1 |
| F18 | STa/LT‐I/eae | 1 |
| K99 | eae | 2 |
| K99 | STa/LT‐I | 1 |
| K99 | STa/STb/LT‐I | 1 |
| F18/F41 | Stx2e | 1 |
| K99/F41 | eae | 2 |
| K99/F41 | STa/eae | 1 |
| K99/F41 | LT‐I/eae | 1 |
| K99/F41 | STb/Stx2e | 1 |
| K99/F41 | STa/STb/LT‐I | 1 |
| K99/F18/F41 | Stx2e/eae | 3 |
| ND | eae | 3 |
| ND | EAST1 | 5 |
| ND | irp2 | 6 |
| ND | STa/eae | 1 |
| ND | irp2/EAST1 | 21 |
| ND | LT‐I/eae | 11 |
| ND | STb/Stx2e | 4 |
| ND | LT‐I/Stx2e/eae | 5 |
| ND | STa/LT‐I/eae | 4 |
| ND | STa/STb/LT‐I | 6 |
| ND | STa/irp2/hlyA | 2 |
| ND | LT‐I/STa/STb/EAST1 | 3 |
| Total | 166 |
Isolates negative for adhesin or toxin genes.
3.5. Distribution and characteristics of virulence factors
Among the 166 isolates carrying virulence genes, 71 (71/166, 42.8％) did not contain any fimbrial or non‐fimbrial adhesin genes. Of the 71 isolates, nine different combinations of toxin‐associated genes were observed, with irp2/EAST1 being the most predominant (21 isolates) (Table 5).
For the most common adhesin factors AIDA‐I and paa, the AIDA‐I‐positive strains frequently carried EAST1 (21/33) or irp2 (12/33); the paa‐positive strains also frequently contained EAST1 (12/27) and irp2 (11/27). Of note, no toxin‐associated genes were detected in seven K88‐positive isolates and four paa positive isolates (Table 5).
There were 31 different combinations of colonization factors and toxin‐associated genes in this study, and the most common profiles were AIDA‐I/EAST1 (12 isolates), AIDA‐I/irp2 (8 isolates) and F6/eae (8 isolates) (Table 5). AIDA‐I was significantly related with EAST1 and irp2 (p < .05).
4. DISCUSSION
During the past decades, the occurrence and spread of the PWD in piglets have posed an enormous economic loss to the development of swine breeding industry in mainland China (Cheng et al., 2006; Liu et al., 2014). Numerous studies have showed that ETEC are the most important agents of enteric colibacillosis in pig, and fimbrial adhesins are necessary in the pathogenetic mechanism (Do, Byun, & Lee, 2018; Toledo et al., 2012; Vu‐Khac et al., 2007; Zhang et al., 2007). Of note, E. coli with fimbrial adhesins can be also detected in pigs without diarrhoea. Moredo et al. (2015) demonstrated that the percentage of ETEC‐positive non‐diarrhoeic pigs was 16.6% during the lactation period, 66% in the nursery phase and 17.3% in the finisher population.
In this study, F5 (K99) (12.0％), F18 (9.0％), F41 (7.2％), F6 (987P) (6.0％) and F4 (K88) (6.0％) were also frequently identified, which indicated that fimbriae were closely related with pathogenic E. coli from piglets with PWD.
F4 and F18 fimbriae have been frequently detected in weaned piglets in several countries such as Korea, Japan, Europe and United States (Do, Byun, & Lee, 2019; Kusumoto et al., 2016; Luppi et al., 2016; Zhang et al., 2007). It is interesting and surprising to observe such a high prevalence of genes enconding for fimbriae F5, F41, F6 in this study. The frequency of different virotypes (with different adhesins) is mainly mediated by the different specific receptors on porcine intestinal brush border epithelial cells (enterocytes). These receptors change from pigs depending on the age (Luppi, 2017) and infection with ETEC carrying the F5, F6 or F41 fimbriae, occurs in pigs less than 2 weeks of age (Nagy & Fekete, 2005). Another possible explanation is that in Shandong Province of China, inactivated vaccines for sows have been used widely, and these vaccines contain E. coli whole cells with F4 and F18 (Chen & He, 2017), which may have decreased the frequency of F4 and F18 and caused the emergence of new adhesin antigens such as F5, F6 and F41 (Do et al., 2019, 2006).
It has been reported that AIDA‐I is related with ETEC strains isolated from weaned pigs with PWD, but its role in colibacillosis in pigs is needed to be elucidated (Luppi, 2017). Both AIDA‐I (33/166, 19.9％) and paa (27/166, 16.3％) were commonly observed in this study. Similarly, the two non‐fimbrial adhesin genes were also frequently identified in China and other countries. For example, the AIDA‐I gene was detected in 27/104 (26.0％) pathogenic E. coli isolated from piglets with diarrhoea in Hessia, Germany (Niewerth et al., 2001). Both the AIDA‐I and paa genes were detected in 79/304 (26.0％) and 133/304 (43.8％) pathogenic E. coli isolates from young pigs with diarrhoea in the United States respectively (Zhang et al., 2007). In the northeastern region of China, both the AIDA‐I (34/206, 16.5％) and paa (50/206, 24.3％) were observed in the virulence gene‐positive E. coli from suckling pigs with diarrhoea (Liu et al., 2014). Noticeably, seven K88‐positive isolates and four paa‐positive E. coli isolates in the study did not harbour any toxin‐related genes. Similarly, paa was also detected in non‐EPEC isolates (Ngeleka, Pritchard, Appleyard, Middleton, & Fairbrother, 2003). In addition, seven K88‐positive E.coli isolates in the study did not carry any toxin‐related genes, which should be further studied in animal experiments.
Noticeably, relatively high isolation rate of E. coli without any fimbrial or non‐fimbrial adhesin genes (71/166, 42.8％) was observed in the present study, which was in agreement with the result conducted in the northeastern region of China (Liu et al., 2014). A previous animal experiment showed that if EPEC cannot complete attachment to epithelial cells via adhesins, young pigs would not develop diarrhoea (Sellwood, Gibbons, Jones, & Rutter, 1975), so the result should be further investigated and studied in animal experiments.
For enterotoxins detected in this study, the gene encoding the STa was frequently identified (32/166, 19.3％), which was consistent with the results conducted in Argentina (Paton & Paton, 1998), Korea (Kwon et al., 2002) and Vietnam (Do et al., 2006). Of note, the detection of LT‐I (45/166, 27.1％) was more frequent than the STa in this study, which was similar with the findings reported in China and other countries (Liu et al., 2014; Madoroba et al., 2009; Vu‐Khac et al., 2007).
In the present study, for the most common colonization factors AIDA‐I and paa, the AIDA‐I‐positive strains also carried EAST1 (21/33) and irp2 (12/33); the paa‐positive strains also contained EAST1 (12/27) and irp2 (11/27). Similar findings have been reported in numerous studies (Ngeleka et al., 2003; Pritchard, Ngeleka, & Middleton, 2004; Ravi et al., 2007).
In this study, 155 (155/166, 93.4％) isolates were detected positive for toxin‐related genes. The 155 E. coli can be divided into seven combinations according to the presence of toxin‐related genes: ETEC, EPEC, STEC, ETEC/EPEC, ETEC/EPEC/STEC, ETEC/STEC and STEC/EPEC (Vidal et al., 2005). Of note, 52 E. coli isolates belonged to ETEC (52/166, 31.3％). The result is similar to findings conducted in Jiangsu and Guangdong Provinces, China (Chen, Gao, Jiao, & Liu, 2004; Wang et al., 2010), indicating that ETEC may be an important pathogen leading to PWD in piglets in China.
Haemolytic activity of E.coli strains was not evaluated and the diagnosis of enteric colibacillosis was not conducted in this study, which are limitations of our study, however, these findings demonstrated the distribution and characteristics of virulence factors in E. coli isolates from piglets with PWD in Shandong Province of China, and the data may be useful for establishing preventive measures for post‐weaning diarrhoea of piglets.
CONFLICT OF INTEREST
The authors declare that they have no conflict of interest.
ETHICAL STATEMENT
The sampling procedure was approved by the Animal Care and Use Committee of Taishan Medical University (Permit Number: TSMU201606018).
ACKNOWLEDGEMENTS
This study was supported by the National Natural Science Foundation of China (81672093).
Li S, Wang L, Zhou Y, Miao Z. Prevalence and characterization of virulence genes in Escherichia coli isolated from piglets suffering post‐weaning diarrhoea in Shandong Province, China. Vet Med Sci. 2020;6:69–75. 10.1002/vms3.207
REFERENCES
- Alexa, P. , Hamřík, J. , Konstantinová, L. , & Šrámková‐Zajacová, Z. (2011). Experimental infection of weaned piglets with enterotoxigenic Escherichia coli O149: F4. Acta Veterinaria Brno, 80, 337–341. 10.2754/avb201180040337 [DOI] [Google Scholar]
- Barba, J. , Bustamante, V. H. , Flores‐Valdez, M. A. , Deng, W. , Finlay, B. B. , & Puente, J. L. (2005). A positive regulatory loop controls expression of the locus of enterocyte effacement‐encoded regulators Ler and GrlA. Journal of Bacteriology, 187, 7918–7930. 10.1128/JB.187.23.7918-7930.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bertin, Y. , Martin, C. , Girardeau, J. P. , Pohl, P. , & Contrepois, M. (1998). Association of genes encoding P fimbriae, CS31A antigen and EAST 1 toxin among CNF1‐producing Escherichia coli strains from cattle with septicemia and diarrhea. FEMS Microbiology Letters, 162, 235–239. [DOI] [PubMed] [Google Scholar]
- Chen, H. , & He, J. J. (2017). The cause and preventive measures for diarrhea in piglets in Shandong Province, China. Shandong Agricultural Science, 9, 20–22. [Google Scholar]
- Chen, X. , Gao, S. , Jiao, X. , & Liu, X. F. (2004). Prevalence of serogroups and virulence factors of Escherichia coli strains isolated from pigs with postweaning diarrhoea in eastern China. Veterinary Microbiology, 103, 13–20. 10.1016/j.vetmic.2004.06.014 [DOI] [PubMed] [Google Scholar]
- Cheng, D. , Sun, H. , Xu, J. , & Gao, S. (2006). PCR detection of virulence factor genes in Escherichia coli isolates from weaned piglets with edema disease and/or diarrhea in China. Veterinary Microbiology, 115, 320–328. 10.1016/j.vetmic.2006.02.013 [DOI] [PubMed] [Google Scholar]
- Do, K. H. , Byun, J. W. , & Lee, W. K. (2018). Prevalence of O‐serogroups, virulence genes and F18 antigenic variants in isolated from weaned piglets with diarrhea in Korea during 2008–2016. Journal of Veterinary Science, 20, 43–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Do, K. H. , Byun, J. W. , & Lee, W. K. (2019). Prevalence of O‐serogroups, virulence genes, and F18 antigenic variants in Escherichia coli isolated from weaned piglets with diarrhea in Korea during 2008–2016. Journal of Veterinary Science, 20, 43–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Do, T. N. , Cu, P. H. , Nguyen, H. X. , Au, T. X. , Vu, Q. N. , Driesen, S. J. , … Trott, D. J. (2006). Pathotypes and serogroups of enterotoxigenic Escherichia coli isolated from pre‐weaning pigs in North Vietnam. Journal of Medical Microbiology, 55, 93–99. 10.1099/jmm.0.46247-0 [DOI] [PubMed] [Google Scholar]
- Fairbrother, J. M. , & Nadeau, E. (2005). Escherichia coli in post‐weaning diarrhea in pigs: An update on bacterial types, pathogenesis, and prevention strategies. Animal Health Research Reviews, 6, 17–39. [DOI] [PubMed] [Google Scholar]
- Gyles, C. L. (2007). Shiga toxin‐producing Escherichia coli: An overview. Journal of Animal Science, 85, 45–62. [DOI] [PubMed] [Google Scholar]
- Ikwap, K. , Erume, J. , Owiny, D. O. , Nasinyama, G. W. , Melin, L. , Bengtsson, B. , … Jacobson, M. (2014). Salmonella species in piglets and weaners from Uganda: Prevalence, antimicrobial resistance and herd‐level risk factors. Preventive Veterinary Medicine, 115, 39–47. 10.1016/j.prevetmed.2014.03.009 [DOI] [PubMed] [Google Scholar]
- Ikwap, K. , Larsson, J. , Jacobson, M. , Owiny, D. O. , Nasinyama, G. W. , Nabukenya, I. , … Erume, J. . (2016). Prevalence of adhesin and toxin genes in E. coli strains isolated from diarrheic and non-diarrheic pigs from smallholder herds in northern and eastern Uganda. BMC Microbiol, 16, 178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jores, J. , Rumer, L. , & Wieler, L. H. (2004). Impact of the locus of enterocyte effacement pathogenicity island on the evolution of pathogenic Escherichia coli . International Journal of Medical Microbiology, 294, 103–113. 10.1016/j.ijmm.2004.06.024 [DOI] [PubMed] [Google Scholar]
- Kim, Y. J. , Kim, J. H. , Hur, J. , & Lee, J. H. (2010). Isolation of Escherichia coli from piglets in South Korea with diarrhea and characteristics of the virulence genes. Canadian Journal of Veterinary Research, 74, 59–64. [PMC free article] [PubMed] [Google Scholar]
- Kusumoto, M. , Hikoda, Y. , Fujii, Y. , Murata, M. , Miyoshi, H. , Ogura, Y. , … Akiba, M. (2016). Emergence of a multidrug‐resistant Shiga toxin‐producing enterotoxigenic Escherichia coli lineage in diseased swine in Japan. Journal of Clinical Microbiology, 54, 1074–1081. 10.1128/JCM.03141-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kwon, D. , Choi, C. , Jung, T. , Chung, H. K. , Kim, J. P. , Bae, S. S. , … Chae, C. (2002). Genotypic prevalence of the fimbrial adhesins (F4, F5, F6, F41 and F18) and toxins (LT, STa, STb and STx2e) in Escherichia coli isolated from post‐weaning pigs with diarrhea or oedema disease in Korea. Veterinary Record, 150, 35–37. [DOI] [PubMed] [Google Scholar]
- Levesque, C. , Piche, L. , Larose, C. , & Roy, P. H. (1995). PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrobial Agents and Chemotherapy, 39, 185–191. 10.1128/AAC.39.1.185 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, W. , Yuan, C. , Meng, X. , Du, Y. , Gao, R. , Tang, J. , & Shi, D. (2014). Frequency of virulence factors in Escherichia coli isolated from suckling pigs with diarrhea in China. Veterinary Journal, 199, 286–289. [DOI] [PubMed] [Google Scholar]
- Luppi, A. (2017). Swine enteric colibacillosis: Diagnosis, therapy and antimicrobial resistance. Porcine Health Management, 3, 16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luppi, A. , Gibellini, M. , Gin, T. , Vangroenweghe, F. , Vandenbroucke, V. , Bauerfeind, R. , … Hidalgo, Á. (2016). Prevalence of virulence factors in enterotoxigenic Escherichia coli isolated from pigs with post‐weaning diarrhea in Europe. Porcine Health Management, 2, 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Madoroba, E. , Van Driessche, E. , De Greve, H. , Mast, J. , Ncube, I. , Read, J. , & Beeckmans, S. (2009). Prevalence of enterotoxigenic Escherichia coli virulence genes from scouring piglets in Zimbabwe. Tropical Animal Health and Production, 41, 1539–1547. 10.1007/s11250-009-9345-4 [DOI] [PubMed] [Google Scholar]
- Moredo, F. A. , Piñeyro, P. E. , Márquez, G. C. , Sanz, M. , Colello, R. , Etcheverría, A. , … Leotta, G. A. (2015). Enterotoxigenic Escherichia coli subclinical infection in pigs: Bacteriological and genotypic characterization and antimicrobial resistance profiles. Foodborne Pathogens and Disease, 12, 704–711. [DOI] [PubMed] [Google Scholar]
- Nagy, B. , & Fekete, P. Z. (2005). Enterotoxigenic Escherichia coli in veterinary medicine. International Journal of Medical Microbiology, 295, 443–454. 10.1016/j.ijmm.2005.07.003 [DOI] [PubMed] [Google Scholar]
- Ngeleka, M. , Pritchard, J. , Appleyard, G. , Middleton, D. M. , & Fairbrother, J. M. (2003). Isolation and association of Escherichia coli AIDA‐I/STb, rather than EAST1 pathotype, with diarrhea in piglets and antibiotic sensitivity of isolates. Journal of Veterinary Diagnostic Investigation, 15, 242–252. [DOI] [PubMed] [Google Scholar]
- Niewerth, U. , Frey, A. , Voss, T. , Le Bouguenec, C. , Baljer, G. , Franke, S. , & Schmidt, M. A. (2001). The AIDA autotransporter system is associated with F18 and stx2e in Escherichia coli isolates from pigs diagnosed with edema disease and postweaning diarrhea. Clinical and Diagnostic Laboratory Immunology, 8, 143–149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Osman, K. M. , Mustafa, A. M. , Aly, M. A. , & AbdElhamed, G. S. (2012). Serotypes, virulence genes, and intimin types of Shiga toxin‐producing Escherichia coli and enteropathogenic Escherichia coli isolated from mastitic milk relevant to human health in Egypt. Vector Borne and Zoonotic Disease, 12, 297–305. [DOI] [PubMed] [Google Scholar]
- Paton, A. W. , & Paton, J. C. (1998). Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. Journal of Clinical Microbiology, 36, 598–602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paton, A. W. , & Paton, J. C. (2002). Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. Journal of Clinical Microbiology, 40, 271–274. 10.1128/JCM.40.1.271-274.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pritchard, J. , Ngeleka, M. , & Middleton, D. M. (2004). In vivo and in vitro colonization patterns of AIDA‐I‐positive Escherichia coli isolates from piglets with diarrhea. Journal of Veterinary Diagnostic Investigation, 16, 108–115. [DOI] [PubMed] [Google Scholar]
- Rakin, A. , Noelting, C. , Schubert, S. , & Heesemann, J. (1999). Common and specific characteristics of the high‐pathogenicity island of Yersinia enterocolitica . Infection and Immunity, 67, 5265–5274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ravi, M. , Ngeleka, M. , Kim, S. H. , Gyles, C. , Berthiaume, F. , Mourez, M. , … Simko, E. (2007). Contribution of AIDA‐I to the pathogenicity of a porcine diarrheagenic Escherichia coli and to intestinal colonization through biofilm formation in pigs. Veterinary Microbiology, 120, 308–319. 10.1016/j.vetmic.2006.10.035 [DOI] [PubMed] [Google Scholar]
- Sellwood, R. , Gibbons, R. A. , Jones, G. W. , & Rutter, J. M. (1975). Adhesion of enteropathogenic Escherichia coli to pig intestinal brush borders: The existence of two pig phenotypes. Journal of Medical Microbiology, 8, 405–411. 10.1099/00222615-8-3-405 [DOI] [PubMed] [Google Scholar]
- Toledo, A. , Gomez, D. , Cruz, C. , Carreon, R. , Lopez, J. , Giono, S. , & Castro, A. M. (2012). Prevalence of virulence genes in Escherichia coli strains isolated from piglets in the suckling and weaning period in Mexico. Journal of Medical Microbiology, 61, 148–156. 10.1099/jmm.0.031302-0 [DOI] [PubMed] [Google Scholar]
- van Beers‐Schreurs, H. , Vellenga, L. , Wensing, T. H. , & Breukink, H. J. (1992). The pathogenesis of the post‐weaning syndrome in weaned piglets: A review. Veterinary Quarterly, 14, 29–34. 10.1080/01652176.1992.9694322 [DOI] [PubMed] [Google Scholar]
- Vidal, M. , Kruger, E. , Durán, C. , Lagos, R. , Levine, M. , Prado, V. , … Vidal, R. (2005). Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. Journal of Clinical Microbiology, 43, 5362–5365. 10.1128/JCM.43.10.5362-5365.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vu‐Khac, H. , Holoda, E. , Pilipcinec, E. , Blanco, M. , Blanco, J. E. , Dahbi, G. , … Blanco, J. (2007). Serotypes, virulence genes, intimin types and PFGE profiles of Escherichia coli isolated from piglets with diarrhea in Slovakia. Veterinary Journal, 174, 176–187. [DOI] [PubMed] [Google Scholar]
- Wang, X. M. , Jiang, H. X. , Liao, X. P. , Zhang, W. J. , Zhu, H. Q. , Zhang, Y. , & Liu, Y. H. (2010). Prevalence of serotypes and virulence genes and antimicrobial susceptibility of pathogenic Escherichia coli isolates from swine. Scientia Agricultural Sinica, 43, 4109–4115. [Google Scholar]
- Zhang, W. , Zhao, M. , Ruesch, L. , Omot, A. , & Francis, D. (2007). Prevalence of virulence genes in Escherichia coli strains recently isolated from young pigs with diarrhea in the US. Veterinary Microbiology, 123, 145–152. 10.1016/j.vetmic.2007.02.018 [DOI] [PubMed] [Google Scholar]