Skip to main content
Iranian Journal of Microbiology logoLink to Iranian Journal of Microbiology
. 2019 Dec;11(6):510–519.

The potency of luliconazole against clinical and environmental Aspergillus nigri complex

Sahar Hivary 1, Mahnaz Fatahinia 1,2, Marzieh Halvaeezadeh 1, Ali Zarei Mahmoudabadi 1,2,*
PMCID: PMC7048962  PMID: 32148683

Abstract

Background and Objectives:

Black Aspergillus strains including, Aspergillus niger and A. tubingensis, are the most cause of otomycosis with worldwide distribution. Although, amphotericin B was a Gold standard for the treatment of invasive fungal infection for several decades, it gradually replaced by fluconazole and /or voriconazole. Moreover, luliconazole, appears to offer the best potential for in vitro activity against black Aspergillus strains. The aim of the present study was to compare the in vitro activity luliconazole, with commonly used antifungals against clinical and environmental strains of black Aspergillus.

Materials and Methods:

Sixty seven (37 clinical and 30 environmental) strains of black Aspergillus were identified using morphological and molecular technique (β-Tubulin gene). In addition, antifungal susceptibility test was applied according to CLSI M38 A2. The results were reported as minimum inhibitory concentration (MIC) or minimum effective concentration (MEC) range, MIC50 or MEC50, MIC90 or MEC90 and MIC geometric (GM) or MECGM.

Results:

Aspergillus niger was the common isolate followed by, A. tubingensis in both clinical and environmental strains. The lowest MIC range, MIC50, MIC90, and MICGM was attributed to luliconazole in clinical strains. The highest resistant rate was found in amphotericin B for both clinical (86.5%) and environmental (96.7%) strains whereas 54.1% of clinical and 30% of environmental isolates were resistant to caspofungin. Clinical strains of Aspergillus were more sensitive to voriconazole (86.7%) than environmental strains (70.3%). On the other hand, 83.8% of clinical and 70% of environmental isolates were resistant to posaconazole.

Conclusion:

Luliconazole versus amphotericin B, voriconazole, posaconazole and caspofungin is a potent antifungal for Aspergillus Nigri complex. The in vitro extremely antifungal efficacy against black Aspergillus strains of luliconazole, is different from those of other used antifungals.

Keywords: Black Aspergillus strains, Luliconazole, Clinical and environmental isolates, Antifungal profile

INTRODUCTION

Luliconazole (Luzu®), (-)-(E)-[(4R)-4-(2,4-dichlorophe-nyl)-1,3-dithiolan-2-ylidene] (1H-imidazol-1-yl) acetonitrile), is an imidazole antifungal with molecular formula: C14H9Cl2N3S2 (1). Luliconazole was basically introduced as anti-dermatophytic antifungal in Japan and India (1, 2). However, it has demonstrated activity in vitro against multiple Aspergillus species, including Aspergillus fumigatus (3, 4), A. terreus (4, 5), A. flavus (4, 6), A. niger (4) and A. tubingensis (4). The availability of a novel antifungal, luliconazole, appears to offer the potential for improved therapy for a wide range of invasive fungal infections, including aspergillosis, dermatophytosis, and onychomycosis (2, 7, 8).

While, amphotericin B was a Gold standard in the first-line treatment of invasive fungal infections for several decades (9), it has been replaced by several new antifungals including, voriconazole, posaconazole and caspofungin (10, 11). Voriconazole was presented as the primary therapy for invasive pulmonary aspergillosis in a clinical trials (12). Further studies have shown that posaconazole is a useful antifungal for invasive fungal infection including aspergillosis (13). On the other hand, during 2–3 last decades, caspofungin was developed to improve the prognosis of invasive aspergillosis (14).

The section Nigri (A. niger, sensu lato) contains more than 19 accepted species including, A. niger, A. tubingensis, A. awamory, A. welwitschiae, A. acidus, A. brasiliensis and others (15–18). The Aspergillus strains in this section are comprised of several closely related species, and their identification based on sequence analyses of β-tubulin gene (4). Aspergillus niger and A. tubingensis strains frequently isolated from clinical infections (16, 19–21). Black Aspergillus strains cause several types of aspergillosis among predisposed patients (22–25). Out of them, otomycosis is the most common cutaneous infection caused by black Aspergillus strains (4, 20).

The increasing of fungal opportunistic infections among patients receiving intensive chemotherapy, hematological malignancies and transplant patients was remarkable during last decades (10, 23, 26–28). Invasive Aspergillus infections are one of the life threatening human disease. On the other hand, some species of Aspergillus have inherent resistance to some antifungal agents (29). Moreover, some species have raised minimum inhibitory concentration (MIC) against specific antifungals. As a results, infection prevention consultant and the best choice antifungal are common clinical challenges.

The aim of the present study was to compare the in vitro activity of a novel antifungal agent, luliconazole, with amphotericin B, voriconazole, posaconazole and caspofungin against clinical and environmental strains of black Aspergillus. Furthermore, the potency of each antifungal against clinical and environmental isolates was compared.

MATERIALS AND METHODS

Fungal isolates.

Thirty seven clinical isolates of black Aspergillus strains were previously isolated from otomycosis samples, identified based on morphology characteristics and preserved at Medical Mycology laboratory affiliated to Ahvaz Jundishapur University of Medical Sciences. This project was approved by the ethical committee of Ahvaz Jundishapur University of Medical Sciences (IR.AJUMS. REC.1396.1066).

Environmental strains of black Aspergillus (30 strains) were trapped from airborne spores using Sabouraud dextrose agar (SDA) (BioLife, Italia) plates. Primary screening of black Aspergillus strains was applied based on macroscopic (Black colony) and microscopic morphology. All strains (clinical and environmental) were subcultured on SDA and re-identified using molecular tests.

DNA extraction.

All strains (clinical and environment isolates) were subcultured on SDA plates and incubated at 29ºC for 24–48 hours. Mycelia were collected in cryo-tubes containing 300 μL lysis buffer and 0.46 g glass beads and kept at 4ºC for 72 hours. The tube contents were homogenized using a Speed-Mill PLUS Homogenizer (Analytikjena, Germany) for 6 minutes (3 cycles) and boiled at 100ºC for 20 minutes. 300 μL of sodium acetate (3M) was added to each tube and stored at −20ºC for 10 minutes. Supernatants were removed after a centrifugation at 12000 rpm for 10 minutes. DNA was purified using phenol-chloroform-isoamyl alcohol (Merck, Germany) according to a protocol devised by Makimura et al. (30). Finally purified DNA was preserved at −20ºC for further tests.

Molecular identification.

β-Tubulin gene was used for the molecular detection of strains using primers pair, βt2a (forward), 5′ GGTAACCAAATCGGTGCTGCTTTC 3′ and βt2b (reverse) 5′ ACCCTCAGTGTAGTGACCCTTGGC 3′ (31). PCR products subjected for sequence analysis and then sequences were manually verified by MEGA6 software package (https://www.megasoftware.net/) and aligned using the CLUSTALW algorithm. All sequences were compared to reference sequences in the Gen-Bank (NCBI) and CBS database via the nucleotide BLAST™ algorithm to obtain a definitive identification (similarity values ≥ 99%). Finally, all nucleotide sequences representative were deposited in the Gen-Bank database.

Antifungal susceptibility assay.

Twofold serial dilutions of antifungals including, luliconazole (APIChem Technology, China) (from 0.00012 to 0.25 μg/mL), amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 μg/mL), voriconazole (Sigma- Aldrich, Germany) (from 0.0078 to 4 μg/mL), posaconazole (Sigma - Aldrich, Germany) (from 0.0312 to 4 μg/mL), and caspofungin (Sigma - Aldrich, Germany) (from 0.0078 to 1 μg/mL) were prepared in RPMI 1640 (Bio Idea, Iran). Antifungal susceptibility test was performed according to CLSI M38 A2 (32). A standard suspension (0.5 McFarland) of 48–72 hours cultures on SDA was prepared in sterile saline (0.85%) with 0.2% Tween 20 (Merck, Germany). Then, 100 μL of diluted suspension (1:50) and 100 μL of serial dilutions of each antifungal were added to each well of 96-well microplates. Micro-plates incubated at 35ºC for 24–72 hours and results were recorded as MIC or minimum effective concentration (MEC). Finally, MIC or MEC range, MIC50 or MEC50, MIC90 or MEC90 and MIC geometric (GM) or MECGM were calculated. CLSI or EUCAST have not been defined any clinical or epidemiologic breakpoints/cut-offs for amphotericin B, voriconazole, posaconazole, caspofungin and Aspergillus species. Strains susceptibility or resistance to each antifungals was evaluated according to commonly utilized breakpoints (Table 1) (33–38).

Table 1.

Defined breakpoints of amphotericin B, voriconazole, posaconazole and caspofungin for Aspergillus niger sensu lato

Antifungals MIC or MEC (μg/mL)

Sensitive Resistance
Amphotericin B ≤2 >2
Posaconazole ≤0.5 >0.5
Voriconazole ≤1 >1
Caspofungin ≤0.06 >0.06
Luliconazole Undefined Undefined

MIC, Minimum inhibitory concentration; MEC, Minimum effective concentration

Statistical analysis.

The Chi-squared test using the Social Science Statistics software (Online) was applied to determine the significant between variables and P value < 0.05 is considered as significance level.

RESULTS

Molecular detection of isolates.

37 clinical isolates of black Aspergillus were detected using molecular and sequencing techniques. Aspergillus niger (21, 56.8%) was the common strain followed by, A. tubingensis (11, 29.8%), A. luchuensis (1, 2.7%), and black Aspergillus strains (4, 10.8%) (Table 2). Furthermore, out of 30 environmental black Aspergillus isolates, 15 (50%) was identified as A. niger followed by, A. tubingensis (13, 43.3%), A. piperis (1, 3.3%) and black Aspergillus strains (1, 3.3%). However, we could not identified four clinical and one environmental black Aspergillus strains, using molecular technique due to inadequate DNA sample size.

Table 2.

Clinical and environmental black Aspergillus strains

Sources Morphological identification Molecular identification
Clinical isolates (37 isolates) Aspergillus niger A. niger, sensu stricto (21)
sensu lato A. tubingensis (11)
A. luchuensis (1)
Black Aspergillus strains (4) ************

Environmental isolates (30 isolates) Aspergillus niger A. niger, sensu stricto (15)
sensu lato A. tubingensis (13)
A. piperis (1)
Black Aspergillus strains (1) ************

Clinical isolates.

The lowest MIC range (0.00024–0.125 μg/mL), MIC50 (0.00195 μg/mL), MIC90, (0.125 μg/mL) and MICGM (0.00295 μg/mL) was attributed to luliconazole (Table 3). The MEC range for all clinical Aspergillus species was 0.0078–1 μg/ml for caspofungin. In addition, the 50% and 90% MEC (MEC50, MEC90) values were 0.125 and 0.5 μg/ml for caspofungin, respectively. Totally, the 54.1% of isolates were resistant to caspofungin. The results have shown that the MIC range of amphotericin B for tested isolates was 0.25–16 μg/mL. However, MIC50, MIC90 was similar, 8 μg/mL. The highest resistant rate (86.5%) was found for amphotericin B. The MIC ranges for clinical isolates of black Aspergillus strains were 0.0078–4 and 0.0625–4 μg/mL of voriconazole and posaconazole, respectively. However, the MICGM for voriconazole (0.77 μg/mL) was lower than posaconazole (1.45 μg/mL). In our study, 29.7% and 83.8% of isolates were resistant to voriconazole and posaconazole, respectively.

Table 3.

The antifungal susceptibility pattern of 67 (37 clinical and 30 environmental) strains of black Aspergillus

Clinical isolates of Aspergillus (37 isolates)
Luliconazole N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
Aspergillus niger 21 0.00024 – 0.125 0.00195 0.125 0.00378 -
A. tubingensis 11 0.00024 – 0.125 0.00195 0.00391 0.00251 -
A. luchuensis 1 0.00098 - - - -
Black Aspergillus 4 0.00049 – 0.00391 - - - -
Total 37 0.00024 – 0.125 0.00195 0.125 0.00295 -

Amphotericin B N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
A. niger 21 0.25 – 8 8 8 4.56 17 (81%)
A. tubingensis 11 4 – 16 8 8 8 11 (100%)
A. luchuensis 1 1 - - - -
Black Aspergillus 4 4 – 8 - - - 4 (100%)
Total 37 0.25 – 16 8 8 5 32 (86.5%)

Voriconazole N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
A. niger 21 0.0625 – 2 1 2 0.99 5 (23.8%)
A. tubingensis 11 0.5 – 4 1 2 1.20 4 (36.4%)
A. luchuensis 1 0.0078 - - - -
Black Aspergillus 4 0.5 – 2 - - - 2 (50%)
Total 37 0.0078 – 4 1 2 0.77 11 (29.7%)

Posaconazole N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
A. niger 21 0.0625 –4 2 2 1.26 17 (81%)
A. tubingensis 11 0.125 – 4 2 4 2.13 10 (90.9%)
A. luchuensis 1 0.5 - - - -
Black Aspergillus 4 0.25 – 4 - - - 4 (100%)
Total 37 0.0625 – 4 2 4 1.45 31 (83.8%)

Caspofungin N MEC range (μg/mL) MEC50 (μg/mL) MEC90 (μg/mL) MECGM (μg/mL) R (%)
A. niger 21 0.0078 – 1 0.125 0.5 0.099 11 (52.4%)
A. tubingensis 11 0.032 – 0.5 0.125 0.5 0.133 7 (63.6%)
A. luchuensis 1 0.032 - - - -
Black Aspergillus 4 0.0625 – 0.25 - - - 2 (50%)
Total 37 0.0078 – 1 0.125 0.5 0.107 20 (54.1%)

Environmental isolates of Aspergillus (30 isolates)

Luliconazole N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
Aspergillus niger 15 0.00098 – 0.0078 0.00195 0.00391 0.00214 -
A. tubingensis 13 0.00049 – 0.00781 0.00195 0.00391 0.00195 -
A. piperis 1 0.00195 - - - -
Black Aspergillus 1 0.00049 - - - -
Total 30 0.00049 – 0.00781 0.00195 0.00391 0.00195 -

Amphotericin B N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
A. niger 15 2 – 16 8 16 6.964 14 (93%)
A. tubingensis 13 4 – 8 4 8 5.508 13 (100%)
A. piperis 1 4 - - - -
Black Aspergillus 1 4 - - - -
Total 30 2 – 16 8 8 6.063 29 (96.7%)

Voriconazole N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
A. niger 15 0.125 – 2 1 2 0.6300 2 (13.3%)
A. tubingensis 13 0.0625 – 2 0.5 2 0.4261 2 (15.4%)
A. piperis 1 0.125 - - - -
Black Aspergillus 1 0.0625 - - - -
Total 30 0.0625 – 2 0.5 2 0.4665 4 (13.3%)

Posaconazole N MIC range (μg/mL) MIC50 (μg/mL) MIC90 (μg/mL) MICGM (μg/mL) R (%)
A. niger 15 0.5 –4 2 4 1.8234 14 (93%)
A. tubingensis 13 0.125 – 4 2 4 1.1125 7 (53.8%)
A. piperis 1 0.5 - - - -
Black Aspergillus 1 0.0625 - - - -
Total 30 0.0625 – 4 2 4 1.2599 21 (70%)

Caspofungin N MEC range (μg/mL) MEC50 (μg/mL) MEC90 (μg/mL) MECGM (μg/mL) R (%)
A. niger 15 0.0078 – 0.25 0.032 0.25 0.0412 3 (20%)
A. tubingensis 13 0.0078 – 0.5 0.0625 0.5 0.0733 6 (46.2%)
A. piperis 1 0.0625 - - - -
Black Aspergillus 1 0.0078 - - - -
Total 30 0.0078 – 0.5 0.0625 0.25 0.0507 9 (30%)

N, number; MEC, Minimum effective concentration; MIC, Minimum inhibitory concentration; GM, Geometric; R, Resistant

Environmental isolates.

The results summarized in Table 3 show the in vitro susceptibilities of 30 environmental Aspergillus Nigri against several antifungals. The same as clinical isolates, the lowest MIC range was 0.00049–0.00781 μg/ml for luliconazole. Moreover, the MIC50, MIC90 and MICGM of luliconazole were 0.00195, 0.00391 and 0.00195 μg/ml, respectively. The MEC range, MEC50, MEC90 and MECGM for caspofungin were 0.0078-0.5, 0.0625, 0.25, and 0.0507 μg/ml, respectively. Furthermore, 30% of environmental strains were resistant to caspofungin. As shown in Table 3, the MIC range for amphotericin B was 2–16 μg/ml followed by, MIC50, MIC90 and MICGM were 8, 8 and 6.063 μg/ml, respectively. Moreover, 96.7% of strains were resistant to amphotericin B. Totally, the MIC range voriconazole for environmental isolates of Aspergillus was 0.0625–2 μg/ml, whereas MIC90 2 μg/ml, MIC50 0.5 and MICGM 0.4665 μg/ml). Our results indicated that only 4 (13.3%) strains were resistant to voriconazole. The tested isolates were inhibited at MIC range 0.0625–4 μg/ml by posaconazole. Furthermore, the MIC50, MIC90 and MICGM were 2, 4 and 1.2599 μg/ml, respectively. In addition, 70% of strains were resistant to posaconazole.

Caspofungin was significantly more effective against environmental than clinical strains (P = 0.048) of black Aspergillus strains. However, the inhibitory effect of amphotericin B, posaconazole and voriconazole was similar against both tested strains (clinical and environmental) (amphotericin B, P=0.147; voriconazole, P=0.109; posaconazole, P=0.178). When we compared the effect antifungals against A. niger and A. tubingensis strains, it found that caspofungin was more effective on A. niger with environmental sources than clinical strains (P=0.0482). Whereas, the effect of other antifungals against both species was not significant.

Our results showed that 32 (86.5%) of clinical strains were resistant to 2, 3 or 4 antifungals, 2 (5.4%) isolates were resistant to one antifungal and 3 (8.1%) isolates were fully susceptible to all antifungals (Table 4). Two strains of A. tubingensis, one A. niger and one black Aspergillus strains were resistant to all antifungals (except luliconazole). On the other hand, 21 (70%) of environmental strains were resistance to 2 –4 antifungals and only 30% of strains were resistance to one antifungals (Table 5). Two strains of A. niger and one A. tubingensis were resistant to all antifungals (except luliconazole).

Table 4.

Drug resistance against tested antifungals among 37 clinical strains

Clinical strains Accessions numbers Antifungal drugs

LUL POS VOR AMP CAS
Aspergillus niger LC441157 0.125 R S R R
A. niger LC456335 0.125 S S R R
A. niger LC456339 0.125 S S R R
A. niger LC441167 0.125 R S R R
A. tubingensis LC456340 0.125 R S R R
A. niger LC456341 0.01561 R S R R
A. niger LC441156 0.00781 R S R R
A. niger LC456337 0.00781 R S S S
A. tubingensis LC456338 0.00391 R R R R
Black Aspergillus ******** 0.00391 R S R S
A. tubingensis LC441168 0.00391 R R R R
A. niger LC441162 0.00391 R S R R
A. niger LC456326 0.00195 R R R S
A. tubingensis LC456298 0.00195 R R R S
A. tubingensis LC456302 0.00195 R R R S
Black Aspergillus ******** 0.00195 R R R S
A. tubingensis LC456301 0.00195 R S R R
A. niger LC441161 0.00195 R S R R
A. tubingensis LC441169 0.00195 R S R R
A. niger LC441158 0.00195 R R R S
A. tubingensis LC456303 0.00195 R S R S
A. niger LC456323 0.00195 R R R S
Black Aspergillus ******** 0.00195 R R R R
A. niger LC456336 0.00195 R S R S
A. tubingensis LC441171 0.00195 S S R R
A. niger LC441163 0.00098 R S R S
A. niger LC441159 0.00098 R S R R
A. niger LC441160 0.00098 R S S S
A. niger LC441165 0.00098 R R R R
A. tubingensis LC441170 0.00098 R S R S
A. niger LC441164 0.00098 R R R S
A. niger LC456320 0.00098 R S R R
A. luchuensis LC456304 0.00098 S S S S
Black Aspergillus ******** 0.00049 S S R R
A. tubingensis LC456297 0.00024 R S R R
A. niger LC441166 0.00024 S S S S
A. niger LC441155 0.00024 S S S S

LUL, Luliconazole; POS, Posaconazole; VOR, Voriconazole; AMP, Amphotericin B; CAS, Caspofungin; R, Resistance: S, Susceptible

Table 5.

Drug resistance against tested antifungals among 30 environmental strains

Environmental strains Accessions number Antifungal drugs

LUL POS vOR AMP CAS
Aspergillus niger LC456329 0.00781 R S R S
A. tubingensis LC456309 0.00781 R R R S
A. niger LC456331 0.00391 R S R S
A. niger LC456322 0.00391 R S R S
A. niger LC456334 0.00391 R R R R
A. tubingensis LC456316 0.00391 R R R R
A. niger LC456318 0.00391 R S R S
A. niger LC456324 0.00195 R S R S
A. tubingensis LC456315 0.00195 R S R R
A. niger LC456332 0.00195 R S R S
A. tubingensis LC456307 0.00195 S S R S
A. niger LC456325 0.00195 R S R S
A. niger LC456327 0.00195 R S S S
A. tubingensis LC456311 0.00195 S S R S
A. niger LC456328 0.00195 R S R R
A. tubingensis LC456312 0.00195 S S R S
A. tubingensis LC456306 0.00195 R S R R
A. tubingensis LC456314 0.00195 R S R R
A. tubingensis LC456300 0.00195 R S R S
A. tubingensis LC456308 0.00195 R S R R
A. niger LC456330 0.00195 R S R S
A. tubingensis LC456299 0.00195 S S R S
A. piperis LC456305 0.00195 S S R S
A. niger LC456321 0.00098 S S R S
A. niger LC456333 0.00098 R S R S
A. tubingensis LC456313 0.00098 S S R S
A. niger LC456317 0.00098 R R R R
A. niger LC456319 0.00098 R S R S
Black Aspergillus ******** 0.00049 S S R S
A. tubingensis LC456310 0.00049 S S R R

LUL, Luliconazole; POS, Posaconazole; VOR, Voriconazole; AMP, Amphotericin B; CAS, Caspofungin; R, Resistance: S, Susceptible

DISCUSSION

Aspergillus strains isolated from clinical and air borne samples were identified using classical morphological features and molecular methods. In the present study, A. tubingensis, A. luchuensis and A. piperis were identified as the cryptic species of A. niger sensu lato by the sequence analysis of β-tubulin gene. Several reports have shown that A. niger is generally as common causative agent of otomycosis and one of the most important agent for invasive aspergillosis (20, 22, 26, 39–41). However, this species cannot be reliably detected from other cryptic members of Aspergillus section Nigri using conventional morphological methods. Molecular tools with sequence-based techniques such as partial sequence of the β-tubulin gene are presented as the most valuable method for A. niger Nigri species assignment (4, 21). These molecular techniques are indicating that this species comprises 19 cryptic species (4, 16, 21) with more prevalence of A. niger sensu stricto and A. tubingensis (16, 42).

Our results showed that, although the luliconazole MIC ranges for strains were extremely low, this range for environmental strains (0.00781–0.00049 μg/ml) was lower than clinical strains (0.125 – 0.00024 μg/ml). As shown in Table 5, only five clinical strains (A. niger sensu stricto, 4 isolates and A. tubingensis, 1 isolate) have a MIC = 0.125 μg/ml. 30/30 (100%) of environmental and 83.8% of clinical strains had the lowest MICs (MICs < 0.00781 μg/ml) against luliconazole. Moreover, the MICGM for environmental and clinical strains were 0.00195 and 0.00295 μg/ml, respectively. Some studies have shown a high efficacy of luliconazole against dermatophytes and onychomycosis agents both in vivo and in vitro (1, 2, 7, 8, 43). Furthermore, recently a few studies examined the potency of luliconazole against different species of Candida, A. fumigatus, A. terreus and Fusarium species (5, 6, 44, 45). However, the potency profile of luliconazole against A. niger complex is unknown. Abastabar et al. (3) and Omran et al. (6) were tested luliconazole against A. fumigatus and A. flavus, and found that the antifungal has the lowest MICs against A. fumigatus (MIC90 0.002 μg/ml) and A. flavus (MIC90 0.032 μg/ml), respectively.

There are the limited data in in vitro efficacy of caspofungin against black Aspergillus strains from clinical and environmental sources. While, the clinical and environmental strains had the same MIC ranges for caspofungin, the resistant to antifungal showed the clear differences between clinical and environmental strains (P = 0.048), where the clinical isolates showed higher resistant rate than the environmental strains. In a report by Badali et al. only 6.1% of environmental strains of A. niger were resistant to caspofungin and all clinical isolates ranged at 0.008 – 0.063 μg/ml (21). In agree with our study Araujoa et al., revealed significantly higher MIC values to caspofungin in the case of non-fumigatus clinical than environmental strains (46).

The in vitro activities of posaconazole, voriconazole, and amphotericin B against clinical Aspergillus strains have been reported by Arikan et al. (10). They reported that voriconazole was the most active anti-fungal against A. niger. Comparable to our results, voriconazole was more potent than the other tested antifungals (with exception luliconazole) against both clinical and environmental strains. Similar to our study, Hashimoto et al., showed no remarkable differences between the MIC distribution rate of voriconazole against clinical and environmental isolates (15). Furthermore, all tested A. niger (environment and clinical isolates) were susceptible to both amphotericin B and voriconazole in Misra et al., research (47). Aspergillus tubingensis resistant strains to amphotericin B was very common both in environment and clinical settings, followed by posaconazole, caspofungin, and voriconazole. However, the resistant rate to amphotericin B was lower among environmental than clinical strains. Hashimoto et al. finding suggests that A. tubingensis is intrinsically resistant to azole antifungals (15). Antifungal susceptibility testing of our A. tubingensis strains revealed 90.9% and 53.8% of clinical and environmental isolates were resistant to posaconazole.

CONCLUSION

In conclusion, luliconazole versus amphotericin B, voriconazole, posaconazole and caspofungin is a potent antifungal for Aspergillus Nigri complex. The in vitro extremely antifungal efficacy against black Aspergillus strains of luliconazole, is different from those of other used antifungals. The MIC range, MIC50, MIC90 and MICGM of luliconazole against black Aspergillus strains were the lowest among the representative tested antifungals. These results suggest luliconazole can be a viable option for the treatment of infections due to black Aspergillus strains and should be further investigated in vivo.

ACKNOWLEDGEMENTS

This study was part of MSc thesis (Sahar Hivary) supported by Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran (Project No: OG-96148).

We would like to thank the Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences for their support. In addition, we thankful Simin Taghipour for molecular technical help.

REFERENCES

  • 1.Koga H, Nanjoh Y, Makimura K, Tsuboi R. In vitro antifungal activities of luliconazole, a new topical imidazole. Med Mycol 2009;47:640–647. [DOI] [PubMed] [Google Scholar]
  • 2.Koga H, Nanjoh Y, Kaneda H, Yamaguchi H, Tsuboi R. Short-term therapy with luliconazole, a novel topical antifungal imidazole, in guinea pig models of tinea corporis and tinea pedis. Antimicrob Agents Chemother 2012;56:3138–3143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Abastabar M, Rahimi N, Meis JF, Aslani N, Khodavaisy S, Nabili M, et al. Potent activities of novel imidazoles lanoconazole and luliconazole against a collection of azole-resistant and -susceptible Aspergillus fumigatus strains. Antimicrob Agents Chemother 2016;60:6916–6919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hagiwara S, Tamura T, Satoh K, Kamewada H, Nakano M, Shinden S, et al. The molecular identification and antifungal susceptibilities of Aspergillus species causing otomycosis in Tochigi, Japan. Mycopathologia 2019; 184: 13–21. [DOI] [PubMed] [Google Scholar]
  • 5.Zargaran M, Taghipour S, Kiasat N, Aboualigalehdari E, Rezaei-Matehkolaei A, Zarei Mahmoudabadi A, et al. Luliconazole, an alternative antifungal agent against aspergillus terreus. J Mycol Med 2017;27:351–356. [DOI] [PubMed] [Google Scholar]
  • 6.Omran SM, Taghizadeh-Armaki M, Zarrinfar H, Hedayati MT, Abastabar M, Moqarabzadeh V, et al. In-vitro antifungal susceptibility testing of lanoconazole and luliconazole against aspergillus flavus as an important agent of invasive aspergillosis. J Infect Chemother 2019;25:157–160. [DOI] [PubMed] [Google Scholar]
  • 7.Khanna D, Bharti S. Luliconazole for the treatment of fungal infections: An evidence-based review. Core Evid 2014;9:113–124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Scher RK, Nakamura N, Tavakkol A. Luliconazole: A review of a new antifungal agent for the topical treatment of onychomycosis. Mycoses 2014;57:389–393. [DOI] [PubMed] [Google Scholar]
  • 9.Ellis D. Amphotericin b: Spectrum and resistance. J Antimicrob Chemother 2002;49 Suppl 1:7–10. [DOI] [PubMed] [Google Scholar]
  • 10.Arikan S, Sancak B, Alp S, Hascelik G, McNicholas P. Comparative in vitro activities of posaconazole, voriconazole, itraconazole, and amphotericin b against aspergillus and rhizopus, and synergy testing for rhizopus. Med Mycol 2008;46:567–573. [DOI] [PubMed] [Google Scholar]
  • 11.Maertens J, Raad I, Petrikkos G, Boogaerts M, Selleslag D, Petersen FB, et al. Efficacy and safety of caspofungin for treatment of invasive aspergillosis in patients refractory to or intolerant of conventional anti-fungal therapy. Clin Infect Dis 2004;39:1563–1571. [DOI] [PubMed] [Google Scholar]
  • 12.Herbrecht R, Denning DW, Patterson TF, Bennett JE, Greene RE, Oestmann J-W, et al. Voriconazole versus amphotericin b for primary therapy of invasive aspergillosis. N Engl J Med 2002;347:408–415. [DOI] [PubMed] [Google Scholar]
  • 13.Walsh TJ, Raad I, Patterson TF, Chandrasekar P, Donowitz GR, Graybill R, et al. Treatment of invasive aspergillosis with posaconazole in patients who are refractory to or intolerant of conventional therapy: An externally controlled trial. Clin Infect Dis 2007;44:2–12. [DOI] [PubMed] [Google Scholar]
  • 14.Egerer G, Reichert D, Pletz MW, Kaskel P, Krobot KJ, Maertens J. Caspofungin for treatment of invasive aspergillosis in germany: Results of a pre-planned subanalysis of an international registry. Eur J Med Res 2012;17:7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hashimoto A, Hagiwara D, Watanabe A, Yahiro M, Yikelamu A, Yaguchi T, et al. Drug sensitivity and resistance mechanism in aspergillus section nigri strains from Japan. Antimicrob Agents Chemother 2017;61(8): e02583–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gautier M, Normand AC, L’Ollivier C, Cassagne C, Reynaud-Gaubert M, Dubus JC, et al. Aspergillus tubingensis: A major filamentous fungus found in the airways of patients with lung disease. Med Mycol 2016;54:459–470. [DOI] [PubMed] [Google Scholar]
  • 17.D’Hooge E, Becker P, Stubbe D, Normand AC, Piarroux R, Hendrickx M. Black aspergilli: A remaining challenge in fungal taxonomy? Med Mycol 2019;57:773–780. [DOI] [PubMed] [Google Scholar]
  • 18.Varga J, Frisvad JC, Kocsube S, Brankovics B, Toth B, Szigeti G, et al. New and revisited species in aspergillus section nigri. Stud Mycol 2011;69:1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Castro C, Galan-Sanchez F, Linares MJ, Tejero R, Ruiz M, Serrano ML, et al. A prospective survey of Aspergillus spp. In respiratory tract samples: Species identification and susceptibility patterns. Med Mycol 2019;57:412–420. [DOI] [PubMed] [Google Scholar]
  • 20.Ali K, Hamed MA, Hassan H, Esmail A, Sheneef A. Identification of fungal pathogens in otomycosis and their drug sensitivity: Our experience. Int Arch Otorhinolaryngol 2018;22:400–403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Badali H, Fakhim H, Zarei F, Nabili M, Vaezi A, Poorzad N, et al. In vitro activities of five antifungal drugs against opportunistic agents of aspergillus nigri complex. Mycopathologia 2016;181:235–240. [DOI] [PubMed] [Google Scholar]
  • 22.Vermeulen E, Maertens J, Meersseman P, Saegeman V, Dupont L, Lagrou K. Invasive Aspergillus niger complex infections in a belgian tertiary care hospital. Clin Microbiol Infect 2014;20:O333–O335. [DOI] [PubMed] [Google Scholar]
  • 23.Koehler P, Tacke D, Cornely OA. Aspergillosis of bones and joints - a review from 2002 until today. Mycoses 2014;57:323–335. [DOI] [PubMed] [Google Scholar]
  • 24.Simmonds L, Mitchell S, White B, Crusz SA, Denning D. Aspergillus niger infection in an immunosuppressed patient confined solely to the brain. BMJ Case Rep 2017;2017: bcr2016218658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ugurlu S, Maden A, Sefi N, Sener G, Yulug N. Aspergillus niger infection of exenterated orbit. Ophthalmic Plast Reconstr Surg 2001;17:452–453. [DOI] [PubMed] [Google Scholar]
  • 26.Atchade E, Jean-Baptiste S, Houze S, Chabut C, Massias L, Castier Y, et al. Fatal invasive aspergillosis caused by Aspergillus niger after bilateral lung transplantation. Med Mycol Case Rep 2017;17:4–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Peghin M, Monforte V, Martin-Gomez MT, Ruiz-Camps I, Berastegui C, Saez B, et al. 10 years of prophylaxis with nebulized liposomal amphotericin b and the changing epidemiology of Aspergillus spp. Infection in lung transplantation. Transpl Int 2016;29:51–62. [DOI] [PubMed] [Google Scholar]
  • 28.Martin-Mazuelos E, Peman J, Valverde A, Chaves M, Serrano MC, Canton E. Comparison of the sensititre yeastone colorimetric antifungal panel and etest with the nccls m38-a method to determine the activity of amphotericin b and itraconazole against clinical isolates of Aspergillus spp. J Antimicrob Chemother 2003;52:365–370. [DOI] [PubMed] [Google Scholar]
  • 29.Van Der Linden JW, Warris A, Verweij PE. Aspergillus species intrinsically resistant to antifungal agents. Med Mycol 2011;49 Suppl 1:S82–89. [DOI] [PubMed] [Google Scholar]
  • 30.Makimura K, Tamura Y, Mochizuki T, Hasegawa A, Tajiri Y, Hanazawa R, et al. Phylogenetic classification and species identification of dermatophyte strains based on DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions. J Clin Microbiol 1999;37:920–924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Glass NL, Donaldson GC. Development of primer sets designed for use with the pcr to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 1995;61:1323–1330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Rex JH, Alexander BD, Andes D, Arthington-Skaggs B, Brown SD, Chaturveli V, Espinel-Ingroff A, Ghannoum MA, Knapp CC, Motyl MR, Ostrosky-Zeichner L, Pfaller M, Sheehan DJ, Walsh TJ. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi, 3rd Ed., 2008;28(16) [Approved standard-third, edition, M38–A2]. [Google Scholar]
  • 33.Lass-Florl C. Susceptibility testing in aspergillus species complex. Clin Microbiol Infect 2014;20 Suppl 6:49–53. [DOI] [PubMed] [Google Scholar]
  • 34.Espinel-Ingroff A, Cuenca-Estrella M, Fothergill A, Fuller J, Ghannoum M, Johnson E, et al. Wild-type mic distributions and epidemiological cutoff values for amphotericin b and Aspergillus spp. For the clsi broth microdilution method (m38-a2 document). Antimicrob Agents Chemother 2011;55:5150–5154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Espinel-Ingroff A, Diekema DJ, Fothergill A, Johnson E, Pelaez T, Pfaller MA, et al. Wild-type mic distributions and epidemiological cutoff values for the triazoles and six Aspergillus spp. For the clsi broth micro-dilution method (m38-a2 document). J Clin Microbiol 2010;48:3251–3257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Espinel-Ingroff A, Fothergill A, Fuller J, Johnson E, Pelaez T, Turnidge J. Wild-type mic distributions and epidemiological cutoff values for caspofungin and Aspergillus spp. For the clsi broth microdilution method (m38-a2 document). Antimicrob Agents Chemother 2011;55:2855–2859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Pfaller MA, Boyken L, Hollis RJ, Kroeger J, Messer SA, Tendolkar S, et al. In vitro susceptibility of clinical isolates of Aspergillus spp. To anidulafungin, caspofungin, and micafungin: A head-to-head comparison using the clsi m38-a2 broth microdilution method. J Clin Microbiol 2009;47:3323–3325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Blum G, Perkhofer S, Haas H, Schrettl M, Wurzner R, Dierich MP, et al. Potential basis for amphotericin b resistance in Aspergillus terreus. Antimicrob Agents Chemother 2008;52:1553–1555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kaya AD, Kiraz N. In vitro susceptibilities of Aspergillus spp. Causing otomycosis to amphotericin b, voriconazole and itraconazole. Mycoses 2007;50:447–450. [DOI] [PubMed] [Google Scholar]
  • 40.Baddley JW, Marr KA, Andes DR, Walsh TJ, Kauffman CA, Kontoyiannis DP, et al. Patterns of susceptibility of Aspergillus isolates recovered from patients enrolled in the transplant-associated infection surveillance network. J Clin Microbiol 2009;47:3271–3275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Szigeti G, Sedaghati E, Mahmoudabadi AZ, Naseri A, Kocsube S, Vagvolgyi C, et al. Species assignment and antifungal susceptibilities of black Aspergilli recovered from otomycosis cases in iran. Mycoses 2012;55:333–338. [DOI] [PubMed] [Google Scholar]
  • 42.Szigeti G, Kocsube S, Doczi I, Bereczki L, Vagvolgyi C, Varga J. Molecular identification and antifungal susceptibilities of black Aspergillus isolates from otomycosis cases in hungary. Mycopathologia 2012;174:143–147. [DOI] [PubMed] [Google Scholar]
  • 43.Baghi N, Shokohi T, Badali H, Makimura K, Rezaei-Matehkolaei A, Abdollahi M, et al. In vitro activity of new azoles luliconazole and lanoconazole compared with ten other antifungal drugs against clinical dermatophyte isolates. Med Mycol 2016;54:757–763. [DOI] [PubMed] [Google Scholar]
  • 44.Taghipour S, Kiasat N, Shafiei S, Halvaeezadeh M, Rezaei-Matehkolaei A, Zarei Mahmoudabadi A. Luliconazole, a new antifungal against candida species isolated from different sources. J Mycol Med 2018;28:374–378. [DOI] [PubMed] [Google Scholar]
  • 45.Vaezi A, Fakhim H, Arastehfar A, Shokohi T, Hedayati MT, Khodavaisy S, et al. In vitro antifungal activity of amphotericin b and 11 comparators against Aspergillus terreus species complex. Mycoses 2018;61:134–142. [DOI] [PubMed] [Google Scholar]
  • 46.Araujo R, Pina-Vaz C, Rodrigues AG. Susceptibility of environmental versus clinical strains of pathogenic Aspergillus. Int J Antimicrob Agents 2007;29:108–111. [DOI] [PubMed] [Google Scholar]
  • 47.Misra R, Malik A, Singhal S. Comparison of the activities of amphotericin b, itraconazole, and voriconazole against clinical and environmental isolates of Aspergillus species. Indian J Pathol Microbiol 2011;54:112–116. [DOI] [PubMed] [Google Scholar]

Articles from Iranian Journal of Microbiology are provided here courtesy of Tehran University of Medical Sciences

RESOURCES