Pigmentiphaga sp. Strain D-2 Uses a Novel Amidase To Initiate the Catabolism of the Neonicotinoid Insecticide Acetamiprid

Acetamiprid, among the top neonicotinoid insecticides used worldwide, is one of the most important commercial insecticides. Due to its extensive use, the environmental fate of acetamiprid, especially its microbial degradation, has caused considerable concern. Although the catabolic pathways of acetamiprid in microorganisms have been extensively studied, the molecular mechanisms underlying acetamiprid biodegradation (except for a nitrile hydratase) remain largely unknown, and the enzyme responsible for the biotransformation of acetamiprid into its main intermediate, IM 1-4, have not yet been elucidated. The amidase AceAB and its encoding genes, aceA and aceB, characterized in this study, were found to be necessary and specific for the initial hydrolysis of the C-N bond of acetamiprid to generate IM 1-4 in Pigmentiphaga sp. strain D-2. The finding of the novel amidase AceAB will greatly enhance our understanding of the microbial catabolism of the widely used insecticide acetamiprid at the molecular level.

ABSTRACT

Acetamiprid, a chloronicotinyl neonicotinoid insecticide, is among the most commonly used insecticides worldwide, and its environmental fate has caused considerable concern. The compound 1-(6-chloropyridin-3-yl)-N-methylmethanamine (IM 1-4) has been reported to be the main intermediate during acetamiprid catabolism in microorganisms, honeybees, and spinach. However, the molecular mechanism underlying the hydrolysis of acetamiprid to IM 1-4 has not yet been elucidated. In this study, a novel amidase (AceAB) that initially hydrolyzes the C-N bond of acetamiprid to generate IM 1-4 was purified and characterized from the acetamiprid-degrading strain Pigmentiphaga sp. strain D-2. Based on peptide profiling of the purified AceAB and the draft genome sequence of strain D-2, aceA (372 bp) and aceB (2,295 bp), encoding the α and β subunits of AceAB, respectively, were cloned and found to be necessary for acetamiprid hydrolysis in strain D-2. The characteristics of AceAB were also systematically investigated. Though AceA and AceB showed 35% to 56% identity to the α and β subunits of the N,N-dimethylformamidase from Paracoccus aminophilus, AceAB was specific for the hydrolysis of acetamiprid and showed no activities to N,N-dimethylformamide or its structural analogs.

IMPORTANCE Acetamiprid, among the top neonicotinoid insecticides used worldwide, is one of the most important commercial insecticides. Due to its extensive use, the environmental fate of acetamiprid, especially its microbial degradation, has caused considerable concern. Although the catabolic pathways of acetamiprid in microorganisms have been extensively studied, the molecular mechanisms underlying acetamiprid biodegradation (except for a nitrile hydratase) remain largely unknown, and the enzyme responsible for the biotransformation of acetamiprid into its main intermediate, IM 1-4, have not yet been elucidated. The amidase AceAB and its encoding genes, aceA and aceB, characterized in this study, were found to be necessary and specific for the initial hydrolysis of the C-N bond of acetamiprid to generate IM 1-4 in Pigmentiphaga sp. strain D-2. The finding of the novel amidase AceAB will greatly enhance our understanding of the microbial catabolism of the widely used insecticide acetamiprid at the molecular level.

INTRODUCTION

Neonicotinoid insecticides are currently the top insecticides used worldwide. Acetamiprid, (E)-N¹-[(6-chloro-3-pyridyl)methyl]-N²-cyano-N¹-methylacetamidine, a typical neonicotinoid insecticide, is one of the most important commercial insecticides (1, 2). Due to its high efficiency, acetamiprid is extensively used on rice, vegetables, cotton, fruit trees, and tea leaves for the control of a broad range of insects, including aphids, whiteflies, leaf and plant hoppers, thrips, and microlepidoptera and coleopteran pests (3–8). Residues of acetamiprid on tea leaves and cotton have frequently been detected. In addition, due to its relatively high solubility in water, acetamiprid easily enters surface water and underground water through the soil (9, 10). Although acetamiprid is considered a low-toxicity insecticide, it has been reported to have acute toxicity toward bees (11–14).

The environmental fate of acetamiprid has attracted considerable attention, and microbial degradation is the key means for the dissipation of acetamiprid from the environment (15, 16). In recent years, several microbial strains capable of degrading acetamiprid have been isolated, and the catabolic pathways of acetamiprid have been extensively studied (17–28). Four catabolic pathways of acetamiprid are illustrated in Fig. 1. In general, the compound 1-(6-chloropyridin-3-yl)-N-methylmethanamine (IM 1-4) appears to be the main intermediate during acetamiprid catabolism in microorganisms, and even in honeybees and spinach (29, 30). Although the catabolic pathways of acetamiprid have been studied in detail, the molecular mechanisms underlying its biodegradation have not been systematically investigated. Nitrile hydratase is the only enzyme reported to be involved in acetamiprid degradation (26, 27), and the enzyme responsible for the biotransformation of acetamiprid into its main intermediate, IM 1-4, has not been elucidated. In our previous study, a bacterial strain, Pigmentiphaga sp. strain D-2, that was capable of using acetamiprid as the sole carbon source for growth was isolated from a wastewater treatment pool in an acetamiprid-manufacturing factory (23). IM 1-4 was also found to be the main intermediate during acetamiprid catabolism in strain D-2 (23). In this study, a novel amidase involved in the initial biotransformation of acetamiprid into IM 1-4 and its encoding genes were further characterized.

FIG 1.

Catabolic pathways of acetamiprid in microorganisms, honeybees, and spinach showing that IM 1-4 is the major metabolite during acetamiprid biodegradation.

RESULTS

Purification of acetamiprid-hydrolyzing enzyme in strain D-2.

The enzyme capable of hydrolyzing acetamiprid to IM 1-4 was progressively purified from the cell extracts of strain D-2 by screening fractions with acetamiprid-hydrolyzing activities. The procedure for purification of the acetamiprid-hydrolyzing enzyme is summarized in Table 1. After three steps of purification, the specific activity of the purified enzyme increased from 2.0 U/mg protein to 53.0 U/mg protein, with a purification factor of 26.5-fold. The purified enzyme yielded a band of approximately 84 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

TABLE 1.

Purification of the acetamiprid-hydrolyzing enzyme from Pigmentiphaga sp. D-2

Purification step	Total protein (mg)	Total activity (U)	Sp act (U/mg protein)	Purification (fold)	Yield (%)
Cell extract	381.8	781.6	2.0		100
Ammonium sulfate precipitation	39.7	340.8	8.6	4.3	43.6
Q-Sepharose FF chromatography	6.4	232.1	36.3	18.2	29.7
Superdex 200 gel filtration	0.3	15.9	53.0	26.5	2.0

Cloning of the genes encoding the acetamiprid-hydrolyzing enzyme.

The band of the purified acetamiprid-hydrolyzing enzyme on a stained SDS-PAGE gel was excised for peptide mass fingerprint analysis. Based on the peptide fingerprint (see Fig. S1 in the supplemental material) and compared to the draft genomic sequence of strain D-2 (accession no. SJZA00000000), orf05630 (designated aceB), located in scaffold 26 in the genome, was targeted as the candidate gene encoding the acetamiprid-hydrolyzing enzyme. The aceB gene consisted of 2,295 bp and encoded a protein showing 56% identity to the β subunit of N,N-dimethylformamidase (DMFase) (31) from Paracoccus aminophilus (NCBI accession number C9DQ21.1) (see Fig. S2 and S3 in the supplemental material). orf05629 (designated aceA) was located upstream of the aceB gene in scaffold 26 (Fig. S2), and it consisted of 372 bp and encoded a protein showing 35% identity to the α subunit of DMFase (NCBI accession number C9DQ22.1) (Fig. S3). All the open reading frames (ORFs) in scaffold 26 are summarized in Table 2.

TABLE 2.

ORFs in scaffold 26 analyzed by BLASTX in the NCBI database

ORF	No. of amino acids encoded	Similar protein	Source	Identity (%)	NCBI accession no.
orf1	282	Transposase	Alicycliphilus sp. strain B1	100	GAO20764
orf05629 (aceA)	123	N,N-Dimethylformamidase α subunit	Paracoccus aminophilus JCM 7686	35	C9DQ22.1
orf05630 (aceB)	764	N,N-Dimethylformamidase β subunit	Paracoccus aminophilus JCM 7686	56	C9DQ21.1
orf2	111	4-Hydroxybenzoate 3-monooxygenase	Microbacterium sp. strain CF335	79	WP_047543749.1
orf3	79	Dihydrolipoamide acetyltransferase	Acidovorax sp. strain JS42	92	ABM42293.1
orf4	619	Dihydrolipoamide dehydrogenase	Acidovorax sp. strain JS42	96	ABM42292.1
orf5	530	Transposase	Alicycliphilus sp. strain B1	100	GAO20764

The aceAB genes were simultaneously amplified using the primer pair aceAB-F/aceAB-R (Table 3), ligated into the appropriate sites of pET-29a(+) to produce pET-aceAB, and then transformed into Escherichia coli BL21(DE3). Hence, AceAB, comprising the N-terminally His₆-tagged AceB, was produced in recombinant E. coli BL21(DE3). A whole-cell transformation assay showed that the recombinant E. coli BL21(DE3) hydrolyzed acetamiprid. According to the tandem mass spectrometry (MS-MS) and liquid chromatography (LC)-MS results, AceAB hydrolyzed the C-N bond of acetamiprid to generate IM 1-4 (Fig. 2) and N-cyanoacetimidic acid (Fig. 3 and 4). The individual expression of AceA or AceB in E. coli BL21(DE3) did not show any acetamiprid-hydrolytic activity. In addition, the mixture of AceA and AceB, which were separately expressed in E. coli BL21(DE3), did not show acetamiprid-hydrolytic activity either. It seemed that the acetamiprid-hydrolytic activity was dependent on the cotranscription of the aceAB genes.

TABLE 3.

Primers used in this study

Primer	DNA sequence (5′ to 3′)a	Description
aceAB-F	TAAGAAGGAGATATACATATGTCGTGCCGATGCGCACGC	Forward primer to amplify aceAB with an NdeI site
aceAB-R	GTGGTGGTGGTGGTGCTCGAGGCCGATGATCTCGTCCATGG	Reverse primer to amplify aceAB with an XhoI site
RT-16SF	ATCGTTTAGGGCGTGGACT	Forward primer for quantitative real-time PCR to amplify a 128-bp fragment of 16S rRNA
RT-16SR	GAAATGCGTAGATATGTGGAGG	Reverse primer for quantitative real-time PCR to amplify a 128-bp fragment of 16S rRNA
RT-aceAF	CCGACTGGCTGGACTACTTCTA	Forward primer for quantitative real-time PCR to amplify a 105-bp fragment of aceA
RT-aceAR	CCTTGCTCTGATCGCTGTTT	Reverse primer for quantitative real-time PCR to amplify a 105-bp fragment of aceA
RT-aceBF	ACGCAGGTGATGCAGAATG	Forward primer for quantitative real-time PCR to amplify a 120-bp fragment of aceB
RT-aceBR	GTCGTAGGTGGATAGACCGTAG	Reverse primer for quantitative real-time PCR to amplify a 120-bp fragment of aceB
aceA-F	TAAGAAGGAGATATACATATGATCACTTCTCCATAC	Forward primer to amplify aceA with an NdeI site
aceA-R	GTGGTGGTGGTGGTGCTCGAGGACGGCCACGCCGATCTTC	Reverse primer to amplify aceA with an Xhol site
aceB-F	TAAGAAGGAGATATACATATGAACTATATTCCGGTCAAGG	Forward primer to amplify aceB with an NdeI site
aceB-R	GTGGTGGTGGTGGTGCTCGAGGCCGATGATCTCGTCCATGG	Reverse primer to amplify aceB with an Xhol site
aceB-DF	TATGACCATGATTACGAATTCAGGGCGCTCAGCCGAGGC	Forward primer to amplify aceB for gene deletion
aceB-DR	CAGGTCGACTCTAGAGGATCCAGAGCAGATCTTCCCCCTCG	Reverse primer to amplify aceB for gene deletion
aceB-CF	GATAAGCTTGATATCGAATTCGGCCTCTCCCGGATTCTCT	Forward primer to amplify aceB with an EcoRI site for gene complementation
aceB-CR	CGCTCTAGAACTAGTGGATCCTCAGCCGATGATCTCGTCCA	Reverse primer to amplify aceB with a BamHI site for gene complementation

^aUnderlined sequences are restriction enzyme cutting sites.

FIG 2.

MS-MS identification of the main metabolite (IM 1-4) produced from acetamiprid hydrolysis by AceAB. (a) Standard mass spectra of acetamiprid and IM 1-4. (b and c) Second-order MS of acetamiprid (b) and IM 1-4 (c).

FIG 3.

LC-MS identification of derivatized N-cyanoacetimidic acid produced from acetamiprid hydrolysis by AceAB. (a) LC profile of derivatized N-cyanoacetimidic acid (time in minutes). (b) MS identification of derivatized N-cyanoacetimidic acid.

FIG 4.

Reaction equation of acetamiprid and N,N-dimethylformamide catalyzed by enzymatic activity. (a) Reaction equation of acetamiprid hydrolysis catalyzed by AceAB. (b) Reaction equation of N,N-dimethylformamide hydrolysis catalyzed by DMFase (50).

The deletion of the aceB gene resulted in the complete loss of acetamiprid-hydrolytic activity in the ΔaceB mutant. Furthermore, complementation of the aceB gene in the ΔaceB mutant recovered the ability of the complemented (ΔaceB/pBBR-aceB) strain to hydrolyze acetamiprid (Fig. 5). These results showed that the aceB gene was essential for acetamiprid catabolism in Pigmentiphaga sp. D-2. A quantitative real-time PCR assay showed that the transcriptions of aceA and aceB in strain D-2 were constitutive and were not induced by acetamiprid (see Fig. S4 in the supplemental material).

FIG 5.

Degradation of acetamiprid by wild-type strain D-2, the ΔaceB mutant, and the complemented (ΔaceB/pBBR-aceB) strain in MSM supplemented with 50 mg/liter acetamiprid.

Characteristics of AceAB.

AceAB, comprising AceA and N-terminally His₆-tagged AceB, was purified using nickel-nitrilotriacetic acid (Ni²⁺-NTA) resin, and SDS-PAGE analysis showed that denatured AceAB possessed two subunits with sizes of approximately 15 and 85 kDa, respectively (see Fig. S5 in the supplemental material), which was in agreement with their theoretical molecular masses (14.5 kDa for AceA and 84.2 kDa for AceB). According to Superdex 200 gel filtration (GE Healthcare, UK), the molecular mass of AceAB was calculated to be approximately 550 kDa (see Fig. S6 in the supplemental material), indicating that AceAB is a heteromultimer in the form of α₅β₅.

The optimal enzyme activity for AceAB was observed at pH 7.5 and 37°C (see Fig. S7 in the supplemental material). AceAB retained over 80% activity for 4 h at temperatures ranging from 4 to 42°C (Fig. S7). However, under even higher temperature conditions (60 to 70°C), the activity of AceAB decreased to less than 20%. AceAB catalyzed acetamiprid with K_m and k_cat values of 0.38 mM and 137.02/s, respectively. The enzyme activity for AceAB was enhanced by 0.1 mM Li⁺, Al³⁺, Mn²⁺, and Li⁺, while it was inhibited by Fe²⁺, Cu²⁺, Hg²⁺, and Ag⁺. Additionally, 0.1 mM Ca²⁺, Fe³⁺, Mg²⁺, Mn²⁺, Ni²⁺, Zn²⁺, Cd²⁺, Cr³⁺, and Co²⁺ had no obvious effect on AceAB activity. AceAB activity was enhanced by EDTA and Triton X-100. However, it was inhibited by Tween 20, Tween 80, and SDS (see Table S1 in the supplemental material).

Although AceAB showed relative identity to DMFases (35% to 56%), it could not hydrolyze N,N-dimethylformamide. Other structural analogs and compounds containing an amido bond, such as N,N-diethylformamide, N-methylformamide, N,N-dimethylacetamide, N-methylacetamide, nicotinamide, isonicotinamide, imidacloprid, and carbendazim, also could not be hydrolyzed by AceAB (see Table S2 in the supplemental material).

DISCUSSION

Microbiological degradation plays key roles in the dissipation of acetamiprid from the environment, as well as in the detoxification of acetamiprid. Many prokaryotic and eukaryotic microorganisms have been reported to be capable of degrading acetamiprid (17–28). Strain D-2, previously isolated in our laboratory, could degrade over 99% of 0.22 mM acetamiprid in 3 days, showing that it possesses a very high degradation capability. Strain D-2 was reported to have two metabolic pathways for acetamiprid: (i) the breaking of the C-N bond of acetamiprid to generate IM 1-4 and (ii) the dechlorination and demethylation of acetamiprid to generate N′-cyano-N-methyl-N-(pyridin-3-ylmethyl)imidoformamide (23). It was found that IM 1-4 is also the main intermediate during acetamiprid catabolism in strain D-2, which is similar to those found in other microorganisms, honeybees, and spinach (29, 30). The selectivity of acetamiprid for insect nicotinic acetylcholine receptors (nAChRs) is attributed to N-cyanoimine (N-CN), and the loss of the nitrile group can completely reverse the selective toxicity of acetamiprid for insects. Hence, IM 1-4 is less toxic to mammals, bees, and silkworms than its parent compound, acetamiprid (18, 32). AceAB, characterized in this study, was capable of hydrolyzing the C-N bond of acetamiprid to generate IM 1-4, showing potential advantages in the detoxification of acetamiprid during the bioremediation process.

Presently, microbial degradation of acetamiprid mostly focuses on the isolation of acetamiprid-degrading strains and their metabolic pathways. To date, nitrile hydratase, which transforms acetamiprid to {1-[(6-chloro-pyridin-3-ylmethyl)-methyl-amino]-ethylidene}-urea (IM 1-2), is the only enzyme reported to be involved in acetamiprid degradation (26, 27). The novel amidase AceAB, which we found, provides a new enzyme that reveals a different catabolic mechanism of acetamiprid in microorganisms. AceAB contains α and β subunits showing 35% to 56% identity to the α and β subunits of DMFase, respectively. DMFase was first characterized as early as 1986 and is capable of breaking the C-N bond of N,N-dimethylformamide to generate dimethylamine (31, 33), which is similar to the reaction of breaking the C-N bond of acetamiprid to generate IM 1-4. Though AceAB showed relative identity to DMFases, it could not hydrolyze N,N-dimethylformamide or its structural analogs, indicating that AceAB is an amidase that evolved specifically for acetamiprid hydrolysis. Furthermore, transposase genes were found at both ends of scaffold 26, where the aceAB genes are located (Table 2 and Fig. S2), indicating that the aceAB genes might be horizontally transferred from other strains. The functions of orf2 to orf4, which are adjacent to the aceAB genes, are not clear, while the possibility that they are involved in the downstream catabolism of IM 1-4 is very low, because IM 1-4, as well as N-cyanoacetimidic acid, could not be further catabolized by strain D-2 (data not shown).

DMFase activity is dependent on the simultaneous expression of the α and β subunits in a host (31, 33, 34). AceAB showed the same characteristics, and its activity was also dependent on the simultaneous in-frame expression of aceAB. No activity was detected, even when extracts of E. coli cells individually expressing AceA and AceB were mixed. In addition, the DMFases from Pseudomonas sp. strain DMF 3/3 (33) and Alcaligenes strain KUFA-1 (34) are tetrameric enzymes composed of two light-chain and two heavy-chain subunits (α₂β₂ type). The molecular mass of AceAB was found to be approximately 550 kDa, and AceAB was presumed to be an α₅β₅-type enzyme composed of five light-chain and five heavy-chain subunits.

In general, AceAB, characterized in this study, is a novel amidase capable of initially hydrolyzing the C-N bond of acetamiprid to generate IM 1-4, and this finding will greatly enhance our understanding of the microbial catabolism of acetamiprid at the molecular level.

MATERIALS AND METHODS

Chemicals and media.

Acetamiprid (>98.3% purity) was obtained from Anhui Huaxing Chemical Industry Co., Ltd. (Anhui, China). All the other reagents used in this study were of the highest analytical purity. Luria-Bertani (LB) medium (10.0 g tryptone, 5.0 g yeast extract, 10.0 g NaCl per liter water) and mineral salts medium (MSM) [1.5 g K₂HPO₄, 0.5 g KH₂PO₄, 1.0 g NaCl, 1.0 g (NH₄)₂SO₄, 0.2 g MgSO₄·7H₂O per liter water] were used in this study.

Strains, plasmids, and culture conditions.

Pigmentiphaga sp. strain D-2, which can use acetamiprid as a sole carbon source for growth, was grown aerobically in LB broth or MSM supplemented with 0.22 mM acetamiprid at 30°C unless otherwise stated (23). The pET-29a(+) plasmid (Novagen, Germany) was used for functional gene expression. Escherichia coli BL21(DE3) (Sangon Biotech Co. Ltd., Shanghai, China) was incubated aerobically at 37°C in LB broth.

Sequencing, assembly, and annotation.

The genomic DNA (gDNA) of strain D-2 was extracted by the high-salt precipitation method (35), and the draft genome of strain D-2 was sequenced by Shanghai Majorbio Bio-pharm Technology Co. Ltd. (Shanghai, China) using the Illumina MiSeq sequencing system (36–38). Shotgun libraries consisting of 500-bp paired-read fragments were sequenced and assembled using SOAPdenovo software (version 2.04) (http://soapdenovo2.sourceforge.net/). Gene prediction and functional annotation were performed using Glimmer 3.02 (39), tRNAscan-SE version 1.3.1 (40), and Barrnap version 0.4.2 (41).

Purification of the amidase capable of transforming acetamiprid to IM 1-4.

Strain D-2 cells were first grown in LB broth, harvested by centrifugation at 6,000 × g for 10 min, washed twice with 20 mM Tris-HCl buffer (pH 7.5), and lysed by sonication for 10 min. The unbroken cells were removed by centrifugation at 12,000 × g for 30 min, and then the supernatants (cell extracts) were precipitated with different concentrations of ammonium sulfate. The 50 to 60% fractions (exhibiting acetamiprid-hydrolytic activity) were dissolved in 20 ml of 20 mM Tris-HCl buffer (pH 7.5) and then desalted overnight in a dialysis membrane (10 kDa; Sangon Biotech Co. Ltd., Shanghai, China) against 20 mM Tris-HCl buffer (pH 7.5). Acetamiprid-hydrolytic activity was determined in 3 ml of 20 mM Tris-HCl buffer (pH 7.0) containing 0.09 mM acetamiprid and a suitable amount of cell extracts from different fractions. The reaction system was incubated at 37°C for 30 min, and then the residue of acetamiprid was analyzed by high-performance liquid chromatography (HPLC).

After dialysis, the resulting mixture was subjected to Q-Sepharose fast-flow (FF) chromatography, and proteins were eluted with a 0 to 1 M linear gradient of NaCl in 20 mM Tris-HCl buffer (pH 7.5). The fraction eluted with 0.6 M NaCl (exhibiting acetamiprid-hydrolytic activity) was redialyzed as described above. Pooled active fractions were collected, concentrated using Microcon centrifugal filters (10-kDa cutoff), subjected to Superdex 200 gel filtration, and eluted with 0.1 M NaCl in 20 mM Tris-HCl buffer (pH 7.5). All purification steps were performed at 4°C. SDS-PAGE was used to detect the purified protein (42), and the Bradford method (43) was used to quantify the protein concentration.

Peptide mass fingerprint analysis and cloning of the amidase gene.

Purified proteins with acetamiprid-hydrolytic activity were analyzed by SDS-PAGE. Each stained gel band was excised and submitted to Bo-Yuan Biological Technology Co. Ltd. (Shanghai, China) for peptide mass fingerprint analysis. The peptide fragments obtained were compared with the draft genome of strain D-2 to identify their encoding gene sequences based on similarities. Phylogenetic analysis of acetamiprid amidase (AceAB) was performed as described previously (44–47).

Gene expression and recombinant protein purification.

The aceA, aceB, and aceAB genes were amplified from the genomic DNA of strain D-2 with primers aceA-F/aceA-R, aceB-F/aceB-R, and aceAB-F/aceAB-R, respectively (Table 3). The amplified products were introduced into the corresponding sites of pET-29a(+) by homologous recombination using a ClonExpress II one-step cloning kit (Vazyme Biotech Co., Ltd., Nanjing, China), yielding pETaceA, pETaceB, and pETaceAB, respectively. The recombinant plasmids were transformed into E. coli BL21(DE3) and sequenced for validation. E. coli BL21(DE3) cells harboring recombinant plasmids were incubated in 100 ml of LB broth at 37°C to an optical density at 600 nm (OD₆₀₀) of 0.6 to 0.8, and then 0.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added. After incubation at 16°C for 10 h, cells were harvested by centrifugation and subjected to ultrasonic disruption as described above. A gradient concentration of imidazole in 20 mM Tris-HCl buffer (pH 7.5) was used to elute the N-terminal His₆-tagged AceA; the N-terminal His₆-tagged AceB; or AceAB, comprising AceA and the N-terminally His₆-tagged AceB, from Ni²⁺-NTA resin (48). To investigate the molecular mass of AceAB, purified AceAB was subjected to Superdex 200 gel filtration and eluted with 0.1 M NaCl in 20 mM Tris-HCl buffer (pH 7.5). The GE protein mixture (GE Healthcare, United Kingdom) was used as the standard marker.

Enzyme activity assay.

Enzymatic reactions were performed at 37°C for 30 min in 3 ml of 20 mM Tris-HCl buffer (pH 7.0) containing 0.09 mM acetamiprid and an appropriate amount of purified AceAB. One unit of enzyme activity of AceAB was defined as the amount of AceAB required to catalyze 1 μmol acetamiprid/min at 37°C. The kinetic parameters K_m and V_max of AceAB were calculated using the Lineweaver-Burk plot method (49).

Gene deletion and complementation.

Standard DNA manipulation techniques were performed as described previously (50, 51). The homologous-recombination-directing sequences of aceB were amplified from the genomic DNA of strain D-2 with the primers aceB-DF/aceB-DR. The PCR fragments were then cloned into EcoRI/BamHI-digested pEX18GM using a ClonExpress II one-step cloning kit. The resulting plasmid, pEX-ΔaceB, was then introduced into strain D-2 cells. Single-crossover mutants were screened on LB plates containing gentamicin and chloramphenicol (50 mg/liter each).

For gene complementation of the ΔaceB mutant, aceB was amplified using the primers aceB-CF/aceB-CR and then ligated to EcoRI/BamHI-digested pBBR1-MCS2 to generate pBBR-aceB. The pBBR-aceB plasmid was then transferred into the ΔaceB mutant via biparental mating to generate the complemented (ΔaceB/pBBR-aceB) strain.

RNA isolation and quantitative real-time PCR.

Strain D-2 cells were inoculated at 2% (vol/vol) into 20 ml of MSM supplemented with 0.22 mM acetamiprid or 0.28 mM glucose. The cultures were incubated at 30°C for 12 h, and then the cells from each treatment were harvested by centrifugation (4,000 × g; 10 min at 4°C). Total RNA was extracted using a MiniBest universal RNA extraction kit (TaKaRa, China) and treated with gDNA eraser (TaKaRa) according to the manufacturer’s instructions. A reverse transcription reaction was performed using the PrimeScript RT reagent kit (TaKaRa). The transcription levels of aceA and aceB in strain D-2 were analyzed by quantitative real-time PCR in an Applied Biosystems 7300 real-time PCR system using a SYBR Premix Ex Taq RT-PCR kit (TaKaRa). The gene-specific primers RT-16SF/RT-16SR, RT-aceAF/RT-aceAR, and RT-aceBF/RT-aceBR were used for quantitative real-time PCR (Table 2). The 16S rRNA gene was set as an internal reference to evaluate the relative differences in integrity between individual RNA samples. These experiments were performed in two independent biological replicates. The 2^−ΔΔCT method was used to calculate relative transcription levels (52).

Enzyme characteristics of AceAB.

The optimal pH range for AceAB was determined by incubating the enzyme with 0.09 mM acetamiprid at pH values between 3.0 and 10.0 at 37°C for 30 min. Four different buffering systems were used: 20 mM citric acid buffer (pH 3.0 to 6.0), 20 mM phosphate-buffered saline (PBS) (pH 6.0 to 8.0), 20 mM Tris-HCl buffer (pH 7.5 to 8.8), and 20 mM barbital sodium-HCl buffer (pH 8.8 to 10.6). The relative enzyme activity was calculated by assuming that the enzyme activity observed at pH 7.5 was 100%. To determine the optimal temperature for AceAB, AceAB was incubated in 20 mM Tris-HCl buffer (pH 7.5) containing 0.09 mM acetamiprid at different temperatures from 4°C to 70°C for 30 min. The AceAB activity observed at 37°C was defined as 100%, and the relative activities at different temperatures were calculated. To evaluate thermal stability, AceAB was preincubated at different temperatures (4°C to 70°C) for 4 h, and then the residual enzyme activity was assayed.

The effects of potential activators or inhibitors on AceAB activity were determined by the addition of 0.1 mM and 1 mM different metal cations and chemical agents (Ca²⁺, Cu²⁺, Fe²⁺, Fe³⁺, Hg²⁺, Mg²⁺, Mn²⁺, Ni²⁺, Li⁺, Zn²⁺, Al³⁺, Cd²⁺, Cr³⁺, Co²⁺, Ag⁺, EDTA, and 1,10-phenanthroline monohydrate) to the AceAB reaction mixture at pH 7.5. The effects of 0.5% and 5% different chemical agents (Tween 20, Tween 80, SDS, and Triton X-100) on AceAB activity were also determined. The AceAB reaction mixture without any additives was considered the blank control, and the enzyme activity was defined as 100%. To investigate the substrate range of AceAB, N,N-dimethylformamide (99.8%; Macklin, Shanghai, China), N,N-diethylformamide (99%; Macklin, Shanghai, China), N-methylformamide (99%; Macklin, Shanghai, China), N,N-dimethylacetamide (99.8%; Macklin, Shanghai, China), N-methylacetamide (99%; Macklin, Shanghai, China), nicotinamide (99%; Macklin, Shanghai, China), isonicotinamide (98%; J&K Chemicals, China), imidacloprid (>97%; J&K Chemicals, China), and carbendazim (98%; J&K Chemicals, China) were tested to determine whether they could be hydrolyzed by AceAB.

Acetamiprid analysis and metabolite identification.

Samples were extracted with an equal volume of dichloromethane, and the organic phase was dehydrated with anhydrous sodium sulfate, concentrated in 1 ml of methanol, and then filtered through a 0.22-μm-pore-size Millipore membrane to remove particles. Acetamiprid was analyzed by HPLC using a C₁₈ separation column (inside diameter, 4.6 mm; length, 25 cm) filled with Kromasil 100-5C₁₈ (Nouryon, Sweden). The mobile phase was a mixture of methanol and water at 60:40 (vol/vol), and the flow rate was 0.8 ml/min. The injection volume was 20 μl, and the column elution was monitored by measuring at 254 nm with a UV-900 wavelength absorbance detector.

To further confirm that the metabolite produced from acetamiprid hydrolysis by AceAB was IM 1-4, MS-MS Finnigan TSQ Quantum Ultra AM (Thermo Fisher Scientific, Waltham, MA, USA) was used. The metabolite was separated and confirmed by standard MS, ionized by electrospray with positive polarity, and scanned in the normal mass range from 30 m/z (mass-to-charge ratio) to 300 m/z. Characteristic fragment ions were detected with second-order MS.

To identify the low-molecular-mass metabolite coproduced from acetamiprid hydrolysis by AceAB, derivatization was first applied as described previously (53). Mass spectrometry was performed using electrospray ionization in positive- or negative-ion mode with MS^e acquisition mode, with a selected mass range of 50 to 1,200 m/z. The lock mass option was enabled using leucine-enkephalin (m/z 556.2771 in positive-ion mode; m/z 554.2615 in negative-ion mode) for recalibration. The ionization parameters were as follows: the capillary voltage was 3.0 kV, the cone voltage was 40 V, the source temperature was 120°C, and the desolvation gas temperature was 400°C.

Data availability.

The GenBank accession numbers for the draft genome of strain D-2 and the aceAB genes are SJZA00000000 and MK424478, respectively.