Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2020 Mar 2;86(6):e02487-19. doi: 10.1128/AEM.02487-19

Biodegradation of Ephedrine Isomers by Arthrobacter sp. Strain TS-15: Discovery of Novel Ephedrine and Pseudoephedrine Dehydrogenases

Tarek Shanati a, Marion B Ansorge-Schumacher a,✉
Editor: Ning-Yi Zhoub
PMCID: PMC7054094  PMID: 31900306

Arthrobacter sp. TS-15 is a newly isolated bacterium with the unique ability to degrade ephedrine isomers. The initiating steps of the novel metabolic pathway are described. Arthrobacter sp. TS-15 and its isolated ephedrine-oxidizing enzymes have potential for use in decontamination and synthetic applications.

KEYWORDS: Arthrobacter, ephedrine degradation

ABSTRACT

The Gram-positive soil bacterium Arthrobacter sp. strain TS-15 (DSM 32400), which is capable of metabolizing ephedrine as a sole source of carbon and energy, was isolated. According to 16S rRNA gene sequences and comparative genomic analysis, Arthrobacter sp. TS-15 is closely related to Arthrobacter aurescens. Distinct from all known physiological paths, ephedrine metabolism by Arthrobacter sp. TS-15 is initiated by the selective oxidation of the hydroxyl function at the α-C atom, yielding methcathinone as the primary degradation product. Rational genome mining revealed a gene cluster potentially encoding the novel pathway. Two genes from the cluster, which encoded putative short-chain dehydrogenases, were cloned and expressed in Escherichia coli. The obtained enzymes were strictly NAD+ dependent and catalyzed the oxidation of ephedrine to methcathinone. Pseudoephedrine dehydrogenase (PseDH) selectively converted (S,S)-(+)-pseudoephedrine and (S,R)-(+)-ephedrine to (S)- and (R)-methcathinone, respectively. Ephedrine dehydrogenase (EDH) exhibited strict selectivity for the oxidation of the diastereomers (R,S)-(–)-ephedrine and (R,R)-(–)-pseudoephedrine.

IMPORTANCE Arthrobacter sp. TS-15 is a newly isolated bacterium with the unique ability to degrade ephedrine isomers. The initiating steps of the novel metabolic pathway are described. Arthrobacter sp. TS-15 and its isolated ephedrine-oxidizing enzymes have potential for use in decontamination and synthetic applications.

INTRODUCTION

Both (R,S)-(–)-ephedrine and (S,S)-(+)-pseudoephedrine are constituents of various over-the-counter (OTC) drugs and are also used as decongestants and stimulants. Several studies have been published regarding the fate of these active pharmaceutical ingredients in humans (1–5). Primarily, these compounds are eliminated by the kidney and excreted with urine, leaving 70% of the (R,S)-(–)-ephedrine and 98% of the (S,S)-(+)-pseudoephedrine in a dose unprocessed (6, 7). According to the 2017 International Narcotics Control Strategy report, the top five world economies exported >1,000 tons of (S,S)-(+)-pseudoephedrine and >100 tons of (R,S)-(–)-ephedrine annually between 2013 and 2015 (8). Thus, it is not surprising that the environment has been enriched with these nonmetabolized drugs, which have a potential negative impact on some organisms, e.g., Daphnia. Furthermore, (R,S)-(–)-ephedrine and (S,S)-(+)-pseudoephedrine have been detected in aquatic samples from sewage and river sediments and even from the Antarctic region as emerging contaminants (9–12). Additionally, (S,S)-(+)-pseudoephedrine was recently reported as an emerging pollutant in leachates of 19 landfills in the United States (13). Toxicologically, (S,S)-(+)-pseudoephedrine was categorized by Guo et al. as “chronic 2,” effecting the chronic ecotoxicological properties on Daphnia in a concentration between 1 and 10 mg liter−1 (14). During wastewater treatment, (R,S)-(–)-ephedrine partially undergoes isomerization to (S,R)-(+)-ephedrine. (S,R)-(+)-Ephedrine has been detected in wastewater effluent at an even higher frequency than (R,S)-(–)-ephedrine, indicating its higher environmental persistence (15). (S,R)-(+)-Ephedrine and the fourth ephedrine isomer, (R,R)-(–)-pseudoephedrine, exert significant toxicological effects on tested model organisms, including Daphnia magna, Pseudokirchneriella subcapitata, and Tetrahymena thermophila (16).

The metabolic degradation pathways of (R,S)-(–)-ephedrine and (S,S)-(+)-pseudoephedrine in rats, humans, and two bacterial species, Arthrobacter globiformis and Pseudomonas putida, have previously been reported (5, 17–19). In mammals, ephedrine undergoes an enzymatic reaction either through a hydroxylating step, which is catalyzed by a cytochrome P450 monooxygenase and yields p-hydroxylated derivatives, or via the demethylation of the N-methyl group toward norephedrine, which releases formaldehyde (20) (Fig. 1A). The hydroxylation of the aromatic ring is a common strategy for degrading aromatic compounds (21). However, there is no further metabolic step on p-hydroxynorephedrine, which is then excreted by the kidneys.

FIG 1.

FIG 1

Catabolism of ephedrine in mammals (A) and in Arthrobacter globiformis (B). Letters associated with arrows indicate the following: O, cytochrome P450 monooxygenase; D, NADPH-dependent enzyme; E, ephedrine dehydrogenase; H, spontaneous imine hydrolyzation.

For ephedrine degradation in the soil bacterium A. globiformis, a different path has been postulated. The first degrading step is implemented through amine oxidation toward an imine metabolite (18, 19). Since imine bonds are susceptible to hydrolysis under aquatic conditions (22), the resulting imine undergoes hydrolysis, yielding the carbonyl intermediate (phenylacetylcarbinol [PAC]) and methylamine (Fig. 1B). However, the functional active enzymes involved in these catabolic processes have not yet been identified in either eukaryotic or prokaryotic cells.

In an attempt to elucidate the bacterial biodegradation of ephedrine, we isolated a new bacterial strain, Arthrobacter sp. strain TS-15 (DSM 32400), on the basis of its ability to metabolize ephedrine as a sole source of carbon and energy. According to the results of the genomic analysis, Arthrobacter sp. TS-15 is most closely related to Arthrobacter aurescens TC1. Notably, it has the unique ability to metabolize more than one ephedrine isomer. The differential biodegradation of ephedrine isomers in relation to culture growth was investigated. The enzymes catalyzing the first step of biodegradation were identified by means of traditional purification protocols, followed by rational genome mining. Based on this analysis, a novel gene cluster responsible for ephedrine metabolism was postulated. The functionality of three purified enzymes of this gene cluster was confirmed after cloning and overexpressing these genes in Escherichia coli.

RESULTS

Isolation and classification of Arthrobacter sp. TS-15.

Initially, a number of bacterial strains with the potential capability to degrade ephedrine, A. globiformis (DSM 20124) (23), Arthrobacter oxydans (DSM 20119) (24), and A. aurescens (DSM 20116) (25), were selected for analysis. However, in our laboratory, none of these strains were able to metabolize ephedrine, and no growth on ephedrine was observed (unpublished data). Alternatively, a novel bacterial strain, Arthrobacter sp. TS-15, was isolated from soil based on its ability to use ephedrine as the sole source of carbon and energy. It was deposited at the German Collection of Microorganisms and Cell Cultures (DSMZ) under collection number DSM 32400. Arthrobacter sp. TS-15 is a Gram-positive and aerobic bacterium. On agar plates, it grows in round, slightly yellow colonies (data not shown). Growing cells have a dented-rod V shape (see Fig. S1A and C in the supplemental material), and after 24 h of storage at 4°C, cells exhibit a coccoid shape (Fig. S1B and D). Scanning electron microscopy (SEM) revealed cells with either a smooth or a rough surface in the pure culture (Fig. S1A). These cell types could not be separated from each other despite sequential transfers to agar plates containing ephedrine as the sole source of carbon. No growth on ephedrine as the sole source of nitrogen occurred (data not shown), indicating that Arthrobacter sp. TS-15 cannot metabolize the nitrogen in ephedrine.

Further investigation into the physiological properties of Arthrobacter sp. TS-15 uncovered antibiotic resistance toward kanamycin at a concentration of 30 μg ml−1. In the presence of kanamycin, the cells showed a tendency to aggregate, forming a pseudomycelium (Fig. S1C). This feature was used later to optimize strain purification. Notably, Arthrobacter sp. TS-15 has a kanamycin resistance gene, aph (aminoglycoside phosphotransferase), which is located near the origins of replication ColE1 from E. coli and f1 ori from bacteriophage F1 in the draft genome of Arthrobacter sp. TS-15. The combination is found as a distinct contig bearing additional resistance genes against glufosinat (phosphinothricin acetyltransferase; Basta) and ampicillin (β-lactamase; bla), respectively. Arthrobacter sp. TS-15 also harbors a lacZ gene encoding β-galactosidase, which is located close to these resistance genes (Fig. S2).

The 16S rRNA gene sequence of Arthrobacter sp. TS-15 (1,452 nucleotides [nt]) was determined and submitted to GenBank. Based on BLAST analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi), the sequence of Arthrobacter sp. TS-15 was most similar to that of Arthrobacter sp. strain M2012083 (4 nucleotide differences; 99.48% identity), A. aurescens TC1 (8 nucleotide differences; 99.28% identity), and Arthrobacter sp. strain Rue61a (8 nucleotide differences; 99.28% identity). The close relationship between the four strains was confirmed by phylogenetic analysis of 20 16S rRNA gene sequences from different Arthrobacter strains using the MEGA, version 10.0.5, program and the neighbor-joining method (Fig. S3A). Additionally, higher identities of Arthrobacter sp. TS-15 to A. aurescens TC1 than to Arthrobacter sp. Rue61a were found by comparing the draft genome sequence of Arthrobacter sp. TS-15 with the genome sequences of other Arthrobacter strains (Fig. S3B); the closest relationship (with a 0.35 DNA-DNA hybridization [DDH]) was identified between Arthrobacter sp. TS-15 and A. aurescens TC1 by calculating the distances between species derived from in silico DDH (Table S1).

Growth on ephedrine.

As illustrated in Fig. 2, Arthrobacter sp. TS-15 was capable of metabolizing all isomers of ephedrine as a sole source of carbon and energy.

FIG 2.

FIG 2

(A to D) Growth of Arthrobacter sp. TS-15 on ephedrine isomers (R,S)-(–)-ephedrine, (S,R)-(+)-ephedrine, (R,R)-(–)-pseudoephedrine, and (S,S)-(+)-pseudoephedrine, as indicated, in liquid medium at 30°C. Circle, culture growth; square, degradation of ephedrine isomer; triangle, concentration of methcathinone.

(S,S)-(+)-Pseudoephedrine was consumed within the shortest time period (half-life of approximately 6.3 h) and was accompanied by the fastest culture growth (generation time of approximately 4.4 h) (Fig. 2D). Notably, the culture growth continued after complete consumption of the isomers (S,S)-(+)-pseudoephedrine and (R,S)-(–)-ephedrine (Fig. 2A), indicating a subsequent utilization of the degradation products for cell metabolism. The half-lives of (R,S)-(–)-ephedrine and (S,R)-(+)-ephedrine in a growing culture of Arthrobacter sp. TS-15 (Fig. 2A and B) were 13.1 h and 21.4 h, respectively. Correspondingly, the generation time of cultures growing on (R,S)-(–)-ephedrine was approximately 60% shorter than that of cultures growing on (S,R)-(+)-ephedrine (generation times of approximately 6.5 and 11.1 h, respectively). The lowest consumption rate was found for (R,R)-(–)-pseudoephedrine (half-life of 39.6 h), accompanied by a generation time of 30.2 h (Fig. 2C). The very similar time course of (R,R)-(–)-pseudoephedrine consumption and culture growth might indicate the simultaneous metabolism of degradation intermediates. The physiological results of the biological half-life of ephedrine isomers in cultivation medium correlated with the generation times of Arthrobacter sp. TS-15 are summarized in Fig. S4.

Ephedrine metabolism.

After growth of Arthrobacter sp. TS-15 on (R,S)-(–)-ephedrine, gas chromatography-mass spectrometry (GC-MS) of the extracts from the cultivation medium revealed 1-phenylpropan-1,2-dione (PPD), PAC, methcathinone, and benzoic acid as metabolites (Fig. S5 and S6). Methcathinone formation was also detected during culture growth on ephedrine isomers (Fig. 2).

Cell extracts of Arthrobacter sp. TS-15 prepared from individual cultivations on the four ephedrine isomers were each able to convert any of the isomers, indicating participation in the reaction of either a promiscuous enzyme or several enzymes with complementary activity. The conversion of all ephedrine isomers required the addition of NAD+ as an oxidant. Without a surplus oxidant or in the presence of NADP+, cell lysates did not significantly convert ephedrine (data not shown). Consequently, an oxidation reaction was postulated as the general initial step of ephedrine degradation by Arthrobacter sp. TS-15, which was consistent with the ephedrine metabolism described for A. globiformis (18, 19). However, A. globiformis metabolism did not agree with the formation of methcathinone as the primary reaction product. Methcathinone is generated from ephedrine through the oxidation of a hydroxyl to a carbonyl function, leaving the amine function unreacted. However, PAC, which, according to studies on A. globiformis metabolism (18, 19), spontaneously results from the postulated amine oxidation to the corresponding imine (Fig. 1B), was not detected in the products of reactions catalyzed by the cell extracts. Thus, Arthrobacter sp. TS-15 obviously uses a novel initial path for ephedrine metabolism.

Enrichment of the oxidizing enzymatic activity.

The NAD+-dependent enzymes catalyzing pseudoephedrine oxidation in Arthrobacter sp. TS-15 were isolated from a growing culture of the bacterium. The culture was supplemented with a small amount of (S,S)-(+)-pseudoephedrine (2 mM) to induce the oxidizing activity 1 h before harvest. Due to the previously observed efficient conversion of (S,S)-(+)-pseudoephedrine (Fig. 2D) by Arthrobacter sp. TS-15, this isomer was used for enzyme enrichment and was named pseudoephedrine dehydrogenase (PseDH). The enzyme was purified in three steps toward a specific activity of 4.7 U mg−1 protein [1 unit being defined as the NAD+-dependent oxidation of 1 μM (S,S)-(+)-pseudoephedrine per min], which corresponded to an enrichment of nearly 200% from the crude extract (Fig. S7). The molecular weight of the enriched protein was approximately 30 kDa.

Tandem MS peptide fingerprinting of the isolated protein resulted in 51 hits containing 130 peptides (Table S2). From these hits, the gene encoding the pseudoephedrine dehydrogenase was identified by rational genome mining (Fig. 3, PseDH). Specifically, DNA sequences corresponding to the 51 hits were located on the genomes of Arthrobacter sp. TS-15 and A. aurescens TC1 and compared for differences. Since A. aurescens TC1 is not able to metabolize ephedrine, locations present in Arthrobacter sp. TS-15 but not in A. aurescens TC1 indicated potential participation in ephedrine metabolism.

FIG 3.

FIG 3

Gene clusters of the β-ketoadipate pathway in the metabolism of catechol (cat). The top cluster stems from Arthrobacter aurescens TC1 cat, and the two bottom clusters belong to Arthrobacter sp. TS-15 cat1 and cat2, as indicated. The cat genes shared by all clusters are shown in orange, and the cat genes displaying high nucleic acid sequence similarity only between Arthrobacter aurescens TC1 cat and Arthrobacter sp. TS-15 cat1 are shown in blue. Red, unique genes within cluster cat2 in Arthrobacter sp. TS-15 cat2 containing PseDH and EDH. Common cat clusters include the following: catH and catG, catechol 3,4-dioxygenase subunits A/B; catB, 3-carboxy-cis, cis-muconate cycloisomerase; catD, β-ketoadipate enol-lactone hydrolase; catC, 4-carboxymuconolactone decarboxylase; catF, 3-ketoacyl-coenzyme A thiolase; catI and catJ, 3-ketoacid-coenzyme A transferase subunits A/B; and catR, cat regulon regulatory protein. The new, second cat ephedrine catabolic cluster contains the following additional genes: benK, benzoate major facilitator superfamily transporter; EDH, ephedrine dehydrogenase; catR, cat regulon regulatory protein; PseDH, pseudoephedrine dehydrogenase; AAP, amino acid permease; ACAD, acyl-coenzyme A dehydrogenase; and Fre, flavin reductase.

Further comparative genomic analysis revealed a whole new gene cluster with a possible association with ephedrine metabolism. Arthrobacter sp. TS-15 harbors two putative operons encoding homologs of enzymes active in the β-ketoadipate pathway in its genome, by which aromatic compounds are degraded by soil bacteria. These operons are commonly activated by the metabolism of catechol (cat) compounds (26). Nine genes of one putative operon, cat1, were 91% similar to the corresponding genes of A. aurescens TC1 (Fig. 3). The second operon, cat2 (Fig. 3, bottom panel) appeared to contain only five cat-homologous genes but had in its immediate vicinity a divergently oriented gene cluster possibly encoding functions for ephedrine and pseudoephedrine degradation. These putative genes encode a benzoate transporter (benK), an amino acid permease (AAP), a regulatory protein (catR), two short-chain dehydrogenases (PseDH and EDH), and two additional oxidoreductases (acyl-coenzyme A dehydrogenase [ACAD] and flavin reductase, Fre).

Short-chain dehydrogenases PseDH and EDH.

Considering the observed ability of Arthrobacter sp. TS-15 to accept all isomers of ephedrine as a carbon source, the recognition of two putative genes in the potential gene cluster for ephedrine metabolism encoding distinct short-chain dehydrogenases was highly interesting. One dehydrogenase clearly corresponded to the isolated PseDH; the amino acid sequence of the other dehydrogenase (EDH), however, had only 31.8% identity to this enzyme. Nevertheless, both encoding genes were cloned and expressed in E. coli. The resulting recombinant enzymes were purified (Fig. S8) and investigated for functionality. EDH exhibited a strict enantioselectivity for the oxidation of (R,S)-(–)-ephedrine and (R,R)-(–)-pseudoephedrine, while PseDH was strictly stereospecific for the other diastereomers, (S,S)-(+)-pseudoephedrine and (S,R)-(+)-ephedrine. The reaction product was methcathinone (Fig. 4), as confirmed via GC-MS (Fig. S5, S6D, and S9). Neither enzyme acted on (S,N)-(+)-(pseudo)ephedrine or (R,N)-(–)-(pseudo)ephedrine (data not shown). Based on a BLAST search, the enzymes most similar to PseDH and EDH were a putative glucose dehydrogenase from Vagococcus elongatus and a hypothetical protein from Modestobacter sp. strain VKM ac-2676 with identities of 47.55% and 64.26%, respectively. The BLAST results are presented in Table S3.

FIG 4.

FIG 4

Enantioselective oxidation of (–)-(R,N)-(pseudo)ephedrine and (+)-(S,N)-(pseudo)ephedrine catalyzed by PseDH and EDH, respectively. Oxidation targets the hydroxyl group, resulting in the corresponding (S/R)-methcathinone.

The kinetic parameters of PseDH and EDH were determined with NAD+ and all corresponding ephedrine isomers as substrates (Table 1). The Km values of NAD+ were 3.4 mM and 0.11 mM for PseDH and EDH, respectively. The highest maximal activity was observed with PseDH for the oxidation of (S,S)-(+)-pseudoephedrine with a kcat of 3.77 s−1 and a Km of 0.26 mM, which explains the rapid consumption of this ephedrine isomer during the growth of Arthrobacter sp. TS-15 (Fig. 2D). Its diastereomer, (S,R)-(+)-ephedrine, was oxidized at a slightly lower affinity (Km 0.33 mM) and a kcat of 1.45 s−1. Kinetic investigations of (R,S)-(–)-ephedrine and (R,R)-(–)-pseudoephedrine oxidation with EDH uncovered the inhibition of EDH at a low concentration of these compounds. (R,R)-(–)-Pseudoephedrine exhibited higher substrate inhibition with a lower inhibition constant, Ki, of 1.78 mM than (R,S)-(–)-ephedrine, with a higher Ki of 4.61 mM (Table 1).

TABLE 1.

Kinetic parameters of ephedrine oxidation catalyzed by PseDH and EDHa

Enzyme and substrate Vmax (U mg−1) Km (mM) Ki (mM) kcat (s−1)
EDH
    (R,S)-(–)-Ephedrine 5.48 ± 0.2 0.036 ± 0.00 4.61 ± 0.59 2.62 ± 0.10
    (R,R)-(–)-Pseudoephedrine 4.29 ± 0.36 0.094 ± 0.01 1.78 ± 0.32 2.06 ± 0.17
    NAD+ 11.36 ± 0.11 0.11 ± 0.00 5.44 ± 0.07
PseDH
    (S,R)-(+)-Ephedrine 2.8 ± 0.07 0.33 ± 0.03 1.45 ± 0.04
    (S,S)-(+)-Pseudoephedrine 7.3 ± 0.19 0.263 ± 0.03 3.77 ± 0.10
    NAD+ 17.88 ± 0.44 3.4 ± 0.26 9.22 ± 0.23
a

Steady-state kinetic data are given in Fig. S10 in the supplemental material.

DISCUSSION

Due to their high adaptation capacity and rapid response to environmental changes, Arthrobacter strains are ubiquitous and have been documented in many extreme environments, such as herbicide-contaminated soils, leaf surfaces, Arctic ice, and heavy metal-contaminated sites (27–30). The work presented here confirms the potential of the genus for the degradation of aromatic chiral compounds. A new strain, Arthrobacter sp. TS-15, was isolated by the cultivation of a soil sample on the aromatic amino alcohol ephedrine as a sole source of carbon and energy.

Influence of ephedrine isomerism on biodegradation.

The optical configuration of the isomers of ephedrine considerably affects the catabolism of the molecule. This was previously observed by Klamann and Lingens for ephedrine oxidation by A. globiformis (19). With cell extracts from this organism, they obtained the highest specific activity with (S,S)-(+)-pseudoephedrine (0.31 U mg−1). The oxidation activities with (R,S)-(–)-ephedrine, (S,R)-(+)-ephedrine, and (R,R)-(–)-pseudoephedrine were approximately 24%, 51%, and 10% of the specific activity on (S,S)-(+)-pseudoephedrine, respectively. Here, we confirmed the highly divergent degradation of ephedrine isomers with growing cultures of Arthrobacter sp. TS-15.

Cultures of Arthrobacter sp. TS-15 degraded the more abundant diastereomers (S,S)-(+)-pseudoephedrine and (R,S)-(–)-ephedrine faster than their less abundant diastereomers. Interestingly, these differences were directly coupled with the generation time of the cultures: the generation time of cultures growing on (S,S)-(+)-pseudoephedrine was approximately six times shorter than that of cultures growing on (R,R)-(–)-pseudoephedrine. Likewise, the generation time of cultures grown on (R,S)-(–)-ephedrine was shorter (approximately 1.6 times) than that of cultures grown on its enantiomer (S,R)-(+)-ephedrine.

The limitation in the biodegradation of the less abundant ephedrine diastereomers seems to be caused by the optical configuration of the methylamino group within the molecules. The kinetic parameters of the novel dehydrogenases PseDH and EDH in the ephedrine degradation operon are in agreement with the degradation efficiency in minimal salt medium. Thus, the substrate inhibition of (R,R)-(–)-pseudoephedrine on EDH traces back to the relatively low elimination rate of this isomer from the cultivation medium. In contrast, the rapid degradation of (S,S)-(+)-pseudoephedrine is a result of the highest catalytic efficiency of PseDH with this isomer.

Ephedrine metabolism.

Under aerobic conditions, aromatic molecules can undergo O2-dependent ring cleavage through enzyme-catalyzed hydroxylation or epoxidation of the aromatic ring (31). Eukaryotic cells or some prokaryotic microorganisms, such as A. globiformis or P. putida, catabolize aromatic ephedrine through the oxidation of either the external or internal amine bonds, respectively (Fig. 1) (19, 32). Another postulated scenario to destabilize ephedrine is the O2-independent dehydration to the enamine (Fig. 5), which subsequently yields PAC and methylamine. Such a metabolic pathway was suggested by the biodegradation of p-synephrine with Arthrobacter synephrinum (33). However, neither the enzymes involved in amine oxidation nor those catalyzing dehydration were identified.

FIG 5.

FIG 5

Degradation of synephrine by enzymatic dehydration with so-called hydrolyase (E1). The subsequent reaction step proceeds under aquatic conditions via enamine-imine tautomerism and imine hydrolysis (modified from Veeraswamy et al. [33]).

In this study, we discovered a unique initial step for the biodegradation of ephedrine via the oxidation of the hydroxyl function on the α-C atom of amino alcohol toward ketoamine N-methcathinone in Arthrobacter sp. TS-15 (Fig. 4). Methcathinone is unstable in aqueous solution and racemizes due to keto-enol tautomerism (34, 35). According to keto-enol and amino-imino tautomerism, methcathinone undergoes further oxidation, generating PPD and methylamine (36, 37). Thus far, the catalytic reactions of the further degradation of methcathinone and the responsible enzymes are unknown for Arthrobacter sp. TS-15. However, the degradation intermediates PPD, PAC, and benzoic acid were detected in the culture medium, suggesting a late hydroxylation step of the aromatic ring with benzoate dioxygenases (BenABC). EDH and PseDH overcome the stability of the conjugated molecule PPD by reducing it to α-hydroxyketone (R)- and (S)-PAC, respectively (38). PAC cannot be oxidized by these dehydrogenases and possibly undergoes a cleavage reaction to yield benzaldehyde and acetaldehyde. Both aldehyde molecules can be oxidized to benzoic acid through aldehyde dehydrogenases (ALDHs) (19). Both benzaldehyde and benzoic acid intermediates were detectable in the reaction activity assay of the cell extract and in the cultivation medium of Arthrobacter sp. TS-15, respectively. Benzoic acid can undergo ortho cleavage via the well-known catechol degradation pathway (26). The postulated active degradation pathway is encoded within the β-ketoadipate gene cluster and is demonstrated in Fig. 6.

FIG 6.

FIG 6

Postulated degradation of ephedrine in Arthrobacter sp. TS-15.

An intensive characterization might enable the utilization of Arthrobacter sp. TS-15 in water treatment processes to enhance ephedrine elimination. The elucidation of the mechanisms of ephedrine catabolism starting with the oxidation of the alcohol or the amine group is important to understand why ephedrine isomers are currently not completely eliminated in water treatment plants. The newly identified dehydrogenases have a high potential in biotechnological applications due to their activity on diverse pharmaceutical aromatic amino alcohols (39).

MATERIALS AND METHODS

Media and chemicals.

All chemicals and oligonucleotides were purchased from Merck (Darmstadt, Germany). Molecular reagents and E. coli strains were purchased from New England Biolabs (Frankfurt am Main, Germany). Cofactors and medium components were purchased from Roth (Karlsruhe, Germany).

Cultivation media and growth conditions.

The minimal medium used was modified from a recipe described by Klamann et al. (18). It contained 61.5 mM dipotassium phosphate, 38.5 mM potassium dihydrogen phosphate, 0.04 mM magnesium sulfate, 1.71 mM sodium chloride, and 15.13 mM ammonium sulfate. The trace elements were 8.08 μM boric acid, 0.01 μM copper(II) sulfate, 0.06 μM potassium iodide, 1.1 μM iron(III) chloride, 1.44 μM manganese(II) sulfate, 0.01 μM ammonium heptamolybdate, and 1.39 μM zinc sulfate. The salts were dissolved in deionized distilled water. Ephedrine (10 mM) was used as the sole source of carbon. For experiments regarding the biodegradation of ephedrine isomers, the respective compound (5 mM) was added to minimal medium. The medium was filter sterilized over membrane filters with a pore size of 0.2 μm (Fisher Scientific, Schwerte, Germany). LB was used as a complex medium. For solid growth medium, 5 g liter−1 agar was added to the cultivation medium before autoclaving. The cultivation was conducted in 30 ml of medium at 30°C with shaking at 180 rpm. The culture growth was monitored with a spectrophotometer at 600 nm. The biological half-life and the growth rate were derived from experimental data and plotted in GraphPad Prism (version 8.0).

Strain isolation and characterization.

Soil samples were collected outside the biology building of Technische Universität (TU) Dresden. A total of 200 mg of each sample was washed with 10 ml of mineral medium and subsequently sedimented at 500 × g. The supernatant was collected and kept on ice. One milliliter of the samples was diluted with 9 ml of medium containing 10 mM (R,S)-(–)-ephedrine. The samples were incubated at 30°C with shaking at 180 rpm. When microbial growth was observed (after approximately 4 days), the cultures were diluted in nine successive transfers (using various volumes for inoculation) to enrich the isolated strain(s). To obtain a pure culture, cultures were spread on agar plates containing (R,S)-(–)-ephedrine. One distinct colony was picked from the agar plate and used for further studies.

The isolated strain was examined via basic optical transmission microscopy and SEM to investigate the morphological form of the cells. To classify the type of the isolated bacterial strain, the 16S rRNA-encoding sequence was amplified by PCR using the oligonucleotides 16SV3_fwd, 16SV6_rev, 16SV1_fwd, and 16SV9_rev (Table 2). Genomic DNA (gDNA) was previously isolated with an Invisorb Spin DNA extraction kit (Stratec, Berlin, Germany) as a template. Sequencing of the PCR products was carried out by Eurofins Genomics (Ebersberg, Germany). Sequences were analyzed by homology alignment using the BLASTn search program (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

TABLE 2.

PCR primers used for 16S rRNA gene amplification

Primer type and name Sequencea
16S rRNA primer
    16SV3_fwd CCAGACTCCTACGGGAGGCAG
    16SV6_rev ACATTTCACAACACGAGCTGACGA
    16SV1_fwd CAACGGAGAGTTTGATCCTGGC
    16SV9_rev AGGAGGTGATCCAGCCGCA
Cloning primer
    PseDH_fwd AATTCCATATGATCAATATGCGAAACAG (NdeI)
    PseDH_rev AATATCTCGAGTTAGTTGACGAGAGCGG (XhoI)
    EDH_fwd AATTCCATATGCTGGTTGAAGGAAAAAACG (NdeI)
    EDH_rev AATATCTCGAGTCAGAAAGCCGAGTATCC (XhoI)
a

Restriction enzymes are given in parentheses and sites are underlined.

Genome isolation, sequencing, and analysis.

Genomic DNA (gDNA) was isolated from Arthrobacter sp. TS-15 grown on minimal salt medium with pseudoephedrine as a sole source of carbon according to a modified protocol of phenol-chloroform extraction described by Marmur (40), excluding isoamyl alcohol. Genome sequencing was carried out by the Genomics Service Unit of the Ludwig Maximilians University, Munich (Germany). The sequencing library was constructed from 1 ng of gDNA with a Nextera XT DNA sample preparation kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol. The library was quality controlled by analysis on an Agilent 2000 Bioanalyzer with a High Sensitivity DNA kit (Agilent Technologies, Santa Clara, CA, USA) for fragment sizes of approximately 200 to 500 bp. Sequencing on a MiSeq sequencer (2 by 250 bp paired-end sequencing, version 3 chemistry; Illumina) generated 2.9 million reads, which were quality trimmed (>Q20) and de novo assembled using the CLC Genomics Server, version 7.5 (Qiagen, Hilden, Germany), with the following parameters: word size, 21; bubble size, 172; mismatch cost, 2; insertion cost, 3; deletion cost, 3; length fraction, 0.5; similarity fraction, 0.8; and minimum contig length, 1,000. The resulting assembly of 151 contigs (N50: 136,320 bp) had a 96-fold mean coverage. The genome size is 4.9 Mbp.

Determination of strain relationships.

The evolutionary history of Arthrobacter sp. TS-15 was inferred using the neighbor-joining method (41) with sequence alignments generated with Clustal X2 software (version 2.1) (42) with 20 16S rRNA gene sequences. The evolutionary distances were computed using the Jukes-Cantor method (43). All positions containing gaps and missing data were eliminated (complete deletion option). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) are shown next to the branches (44). The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. There were a total of 1,427 positions in the final data set. Phylogenetic and molecular evolutionary analyses were conducted using MEGA, version 10.0.5 (45). To perform genome rearrangements, a multiple nucleotide-based genome alignment of the draft genome of Arthrobacter sp. TS-15 and the reference sequence of A. aurescens TC1 was constructed using an automated reordering algorithm in MAUVE genome alignment software (version 2.3.1) (46). The genomic differences between Arthrobacter sp. TS-15 and five Arthrobacter strains were visualized on circular genome comparisons using the BLAST Ring Image Generator (BRIG; version 0.95) (47). In silico DDH between the genome of Arthrobacter sp. TS-15 and five Arthrobacter-related strains was performed using the Genome-to-Genome Distance Calculator (GGDC) (48). The distances were determined as the sum of all identities found in high-scoring segment pairs (HSPs) divided by overall HSP length.

Enzyme purification from Arthrobacter sp. TS-15.

All steps of enzyme purification were carried out at 4°C. The protein concentration of the crude cell extract and during the purification process was determined using the Bradford assay (49). The activity of the fractions was measured with a spectrophotometer at 340 nm. The assay contained 0.3 μM (S,S)-(+)-pseudoephedrine and 0.5 μM NAD+ in 1 ml of potassium phosphate buffer (100 mM, pH 7.8). The reaction was started by the addition of 30 μl of cell extract or enriched protein fraction. Cells from a 1-liter overnight culture of Arthrobacter sp. TS-15 from a 2-liter bioreactor containing 10 mM (S,S)-(+)-pseudoephedrine (Sartorius, Göttingen, Germany) were harvested in 35 ml of potassium phosphate buffer (100 mM, pH 7.8). Cell disruption was carried out with a French pressure cell, model FA-078 w (SLM-Aminco, Urbana, IL, USA), at 1 MPa. After centrifugation of crude cell extract (15,000 × g, 30 min), the proteins in the supernatant were precipitated with ammonium sulfate between 10 and 100% saturation over 10 fractions. The fractions with the highest (S,S)-(+)-pseudoephedrine-oxidizing activity were pooled and immediately loaded onto a 1-ml Resource Phe column (GE Healthcare Life Sciences, Pittsburgh, PA, USA) on an ÄKTA protein purification system (GE Healthcare Life Sciences, Pittsburgh, PA, USA). The most active fractions were pooled and applied to a 1-ml Resource Q column (GE Healthcare Life Sciences, Pittsburgh, PA, USA). Sample aliquots were analyzed via SDS-PAGE. An enriched protein with a molecular mass of approximately 30 kDa was excised from the gel (see Fig. S7 in the supplemental material) and identified via mass spectrometry fingerprinting (conducted by the Proteome Factory AG, Berlin, Germany).

Analysis of metabolites.

The metabolites of the medium and from the cell lysate activity assay were extracted after 16 h of Arthrobacter sp. TS-15 cultivation and 4 h of incubation of the substrate ephedrine with the cell lysate, respectively. The extraction of substrates and products from the culture medium or after the activity assay was performed under basic conditions with 100 mM sodium hydroxide and an equal volume of ethyl acetate. Analysis of ephedrine isomers and their degradation was performed by gas chromatography (GC) (GC-2010; Shimadzu, Kyto, Japan) with flame ionization detection using nitrogen as the carrier gas. The separation of substrates was performed on a chiral column CycloSil-B 30 m in length, inside diameter (i.d.) of 0.25 mm, and film thickness of 0.25 μm (Agilent Technologies, Santa Clara, CA, USA), applying a temperature gradient for 15 min from 130 to 185°C with a ramp of 4°C min−1. Retention times for (R,S)-(–)-ephedrine, (R,R)-(–)-pseudoephedrine, (S,R)-(+)-ephedrine, and (S,S)-(+)-pseudoephedrine were detected at 11.78 min, 11.86 min, 11.67 min, and 11.95 min, respectively (Fig. S9). The identification of the intermediates from the enzymatic assays and culture supernatant was performed with GC-MS using an Agilent 6890N GC/HP 5973N mass selective detector (MSD) equipped with an Optima 35 MS column. A constant temperature program at 130°C for 30 min was applied. The intermediates extracted from the culture medium, benzaldehyde and methcathinone, were detected at 10.11 min and 12.43 min, respectively (Fig. S5).

Gene cloning.

For gene amplification from gDNA, PCR was conducted with the appropriate oligonucleotides (Table 2). After restriction enzyme (NdeI and XhoI) digestion, the inserts were ligated separately into pET19, thereby creating gene variants encoding N-terminal 10-histidine tag. After transfer of the plasmids into E. coli DH5a cells, the nucleotide sequences were verified by sequencing at Eurofins Genomics (Ebersberg, Germany). The plasmids pET-EDH and pET-PseDH were subsequently transferred into E. coli T7 SHuffle(DE3) cells.

Heterologous production, purification, and characterization of dehydrogenases.

A 5-ml overnight culture (in LB medium at 30°C with shaking at 180 rpm) of E. coli T7 SHuffle(DE3) harboring the EDH- or PseDH-encoding gene was used to inoculate 50 ml of the same LB medium to an optical density at 600 nm (OD600) of 0.05. At an OD600 of 0.8 (culture incubated under the same conditions), 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added, and incubation continued for 3 h. The produced enzymes were purified via immobilized metal ion affinity chromatography using a 5-ml HisTrap FF column (GE Healthcare Life Sciences, Pittsburgh, PA) charged with nickel. Equilibration, elution, etc., were performed according to the manufacturer’s instructions. The protein concentration of purified enzymes was determined using a NanoDrop ND-1000 spectrophotometer (ThermoFisher Scientific, Bremen, Germany) with the specific extinction coefficients at 280 nm of 20.97 and 19.18 for EDH and PseDH, respectively. Kinetic parameters of the purified enzymes were determined photometrically by following the reduction of NAD+ at 340 nm and 25°C after the addition of variable amounts of (R,N)-(–)-(pseudo)ephedrine or (S,N)-(+)-(pseudo)ephedrine. The assay contained 1 μM NAD+ in 1 ml of potassium phosphate buffer (100 mM, pH 7.8). The reaction was started by the addition of 0.03 mg ml−1 EDH or 0.13 mg ml−1 PseDH. Kinetic parameters for NAD+ were determined at fixed concentrations of (R,S)-(–)-ephedrine (0.5 mM) and (S,S)-(+)-pseudoephedrine (3 mM) for EDH and PseDH, respectively. The Michaelis-Menten equation was used to calculate the initial rates (NADH ε340 of 0.00622 liter μM−1 cm−1). Kinetic parameters (Km and Vmax) were calculated by fitting values to experimental data using nonlinear regression in GraphPad Prism, version 8.

Data availability.

Genomic data of Arthrobacter sp. TS-15 is available in the GenBank database of NCBI. The whole-genome shotgun sequence has been deposited under accession number SDXQ01000000 and consists of sequences SDXQ01000001 to SDXQ01000151. The amino acid sequences of PseDH and EDH have been deposited under GenBank accession numbers TQS88919 and TQS88917, respectively, and the 16S rRNA gene sequence has been deposited under accession number MK459547.

Supplementary Material

Supplemental file 1
AEM.02487-19-s0001.pdf (715.1KB, pdf)

ACKNOWLEDGMENTS

We thank Friedrich Ebert Stiftung e.V., Bonn, Germany, for generous personal support of T.S.

We also thank Michael Rother (Technische Universität Dresden, Germany) and Gideon Grogan (University of York, UK) for critically reading the manuscript.

Arthrobacter sp. TS-15 and its ephedrine-degrading enzymes are protected for commercial applications with the patents WO2019002459A1 and DE102017210944B4 (38, 50).

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.Wilkinson GR, Beckett AH. 1968. Absorption metabolism and excretion of the ephedrines in man. I. The influence of urinary pH and urine volume output. J Pharmacol Exp Ther 162:139–147. [PubMed] [Google Scholar]
  • 2.Welling PG, Lee KP, Patel JA, Walker JE, Wagner JG. 1971. Urinary excretion of ephedrine in man without pH control following oral administration of three commercial ephedrine sulfate preparations. J Pharm Sci 60:1629–1634. doi: 10.1002/jps.2600601107. [DOI] [PubMed] [Google Scholar]
  • 3.Sever PS, Dring LG, Williams RT. 1975. The metabolism of (–)-ephedrine in man. Eur J Clin Pharmacol 9:193–198. doi: 10.1007/bf00614017. [DOI] [PubMed] [Google Scholar]
  • 4.Brater DC, Kaojarern S, Benet LZ, Lin ET, Lockwood T, Morris RC, McSherry EJ, Melmon KL. 1980. Renal excretion of pseudoephedrine. Clin Pharmacol Ther 28:690–694. doi: 10.1038/clpt.1980.222. [DOI] [PubMed] [Google Scholar]
  • 5.Inoue T, Suzuki S. 1990. The metabolism of (±)-methylephedrine in rat and man. Xenobiotica 20:99–106. doi: 10.3109/00498259009046816. [DOI] [PubMed] [Google Scholar]
  • 6.Beckett AH, Wilkinson GR. 1965. Urinary excretion of (–)‐methylephedrine, (–)‐ephedrine and (–)‐norephedrine in man. J Pharm Pharmacol 17:107–108. [Google Scholar]
  • 7.Lai CM, Stoll RG, Look ZM, Yacobi A. 1979. Urinary excretion of chlorpheniramine and pseudoephedrine in humans. J Pharm Sci 68:1243–1246. doi: 10.1002/jps.2600681012. [DOI] [PubMed] [Google Scholar]
  • 8.U.S. Department of State. 2017. 2017 INCSR—volume I: drug and chemical control (as submitted to Congress). https://www.state.gov/2017-incsr-volume-i-drug-and-chemical-control-as-submitted-to-congress/.
  • 9.Petrie B, Barden R, Kasprzyk-Hordern B. 2015. Review on emerging contaminants in wastewaters and the environment: current knowledge, understudied areas and recommendations for future monitoring. Water Res 72:3–27. doi: 10.1016/j.watres.2014.08.053. [DOI] [PubMed] [Google Scholar]
  • 10.Yang YY, Toor GS, Williams CF. 2015. Pharmaceuticals and organochlorine pesticides in sediments of an urban river in Florida, USA. J Soils Sediments 15:993–1004. doi: 10.1007/s11368-015-1077-7. [DOI] [Google Scholar]
  • 11.González-Alonso S, Merino LM, Esteban S, López de Alda M, Barceló D, Durán JJ, López-Martínez J, Aceña J, Pérez S, Mastroianni N, Silva A, Catalá M, Valcárcel Y. 2017. Occurrence of pharmaceutical, recreational and psychotropic drug residues in surface water on the northern Antarctic Peninsula region. Environ Pollut 229:241–254. doi: 10.1016/j.envpol.2017.05.060. [DOI] [PubMed] [Google Scholar]
  • 12.Archer E, Petrie B, Kasprzyk-Hordern B, Wolfaardt GM. 2017. The fate of pharmaceuticals and personal care products (PPCPs), endocrine disrupting contaminants (EDCs), metabolites and illicit drugs in a WWTW and environmental waters. Chemosphere 174:437–446. doi: 10.1016/j.chemosphere.2017.01.101. [DOI] [PubMed] [Google Scholar]
  • 13.Masoner JR, Kolpin DW, Furlong ET, Cozzarelli IM, Gray JL, Schwab EA. 2014. Contaminants of emerging concern in fresh leachate from landfills in the conterminous United States. Environ Sci Process Impacts 16:2335–2354. doi: 10.1039/c4em00124a. [DOI] [PubMed] [Google Scholar]
  • 14.Guo J, Sinclair CJ, Selby K, Boxall AB. 2016. Toxicological and ecotoxicological risk-based prioritization of pharmaceuticals in the natural environment. Environ Toxicol Chem 35:1550–1559. doi: 10.1002/etc.3319. [DOI] [PubMed] [Google Scholar]
  • 15.Kasprzyk-Horder B, Baker DR. 2012. Enantiomeric profiling of chiral drugs in wastewater and receiving waters. Environ Sci Technol 46:1681–1691. doi: 10.1021/es203113y. [DOI] [PubMed] [Google Scholar]
  • 16.Rice J, Proctor K, Lopardo L, Evans S, Kasprzyk-Hordern B. 2018. Stereochemistry of ephedrine and its environmental significance: exposure and effects directed approach. J Hazard Mater 348:39–46. doi: 10.1016/j.jhazmat.2018.01.020. [DOI] [PubMed] [Google Scholar]
  • 17.Axelrod J. 1959. Metabolism of epinephrine and other sympathomimetic amines. Physiol Rev 39:751–776. doi: 10.1152/physrev.1959.39.4.751. [DOI] [PubMed] [Google Scholar]
  • 18.Klamann E, Schroppel E, Blecher R, Lingens F. 1976. Degradation of (–)-ephedrine by Arthrobacter globiformis. Eur J Appl Microbiol 2:257–265. doi: 10.1007/BF01278609. [DOI] [Google Scholar]
  • 19.Klamann E, Lingens F. 1980. Degradation of (–)-ephedrine by Pseudomonas putida. Detection of (–)-ephedrine: NAD+-oxidoreductase from Arthrobacter globiformis. Z Naturforsch C Biosci 35:80–87. doi: 10.1515/znc-1980-1-216. [DOI] [PubMed] [Google Scholar]
  • 20.Axelrod J. 1955. The enzymatic demethylation of ephedrine. J Pharmacol Exp Ther 114:430–438. [PubMed] [Google Scholar]
  • 21.Ullrich R, Hofrichter M. 2007. Enzymatic hydroxylation of aromatic compounds. Cell Mol Life Sci 64:271–293. doi: 10.1007/s00018-007-6362-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Layer RW. 1963. The chemistry of imines. Chem Rev 63:489–510. doi: 10.1021/cr60225a003. [DOI] [Google Scholar]
  • 23.Conn HJ, Dimmick I. 1947. Soil bacteria similar in morphology to mycobacterium and corynebacterium. J Bacteriol 54:291–303. doi: 10.1128/JB.54.3.291-303.1947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Knackmuss HJ, Beckmann W. 1973. The structure of nicotine blue from Arthrobacter oxydans. Arch Mikrobiol 90:167–169. doi: 10.1007/bf00414521. [DOI] [PubMed] [Google Scholar]
  • 25.Busse HJ. 2016. Review of the taxonomy of the genus Arthrobacter, emendation of the genus Arthrobacter sensu lato, proposal to reclassify selected species of the genus Arthrobacter in the novel genera Glutamicibacter gen. nov., Paeniglutamicibacter gen. nov., Pseudoglutamicibacter gen. nov., Paenarthrobacter gen. nov. and Pseudarthrobacter gen. nov., and emended description of Arthrobacter roseus. Int J Syst Evol Microbiol 66:9–37. doi: 10.1099/ijsem.0.000702. [DOI] [PubMed] [Google Scholar]
  • 26.Harwood CS, Parales RE. 1996. The beta-ketoadipate pathway and the biology of self-identity. Annu Rev Microbiol 50:553–590. doi: 10.1146/annurev.micro.50.1.553. [DOI] [PubMed] [Google Scholar]
  • 27.Turnbull GA, Ousley M, Walker A, Shaw E, Morgan JA. 2001. Degradation of substituted phenylurea herbicides by Arthrobacter globiformis strain D47 and characterization of a plasmid-associated hydrolase gene, puhA. Appl Environ Microbiol 67:2270–2275. doi: 10.1128/AEM.67.5.2270-2275.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Suzuki Y, Banfield JF. 2004. Resistance to, and accumulation of, uranium by bacteria from a uranium-contaminated site. Geomicrobiol J 21:113–121. doi: 10.1080/01490450490266361. [DOI] [Google Scholar]
  • 29.Scheublin TR, Leveau JH. 2013. Isolation of Arthrobacter species from the phyllosphere and demonstration of their epiphytic fitness. Microbiologyopen 2:205–213. doi: 10.1002/mbo3.59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Swer PB, Joshi SR, Acharya C. 2016. Cesium and strontium tolerant Arthrobacter sp. strain KMSZP6 isolated from a pristine uranium ore deposit. AMB Express 6:69. doi: 10.1186/s13568-016-0247-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Fuchs G, Boll M, Heider J. 2011. Microbial degradation of aromatic compounds - from one strategy to four. Nat Rev Microbiol 9:803–816. doi: 10.1038/nrmicro2652. [DOI] [PubMed] [Google Scholar]
  • 32.Axelrod J. 1953. Studies on sympathomimetic amines. I. Biotransformation and physiological disposition of l-ephedrine and I-norephedrine. J Pharmacol Exp Ther 109:62–73. [PubMed] [Google Scholar]
  • 33.Veeraswamy M, Devi NA, Kutty RK, Rao PV. 1976. Conversion of (+/-)-synephrine into p-hydroxyphenylacetaldehyde by Arthrobacter synephrinum. A novel enzymic reaction. Biochem J 159:807–809. doi: 10.1042/bj1590807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.DeRuiter J, Hayes L, Valaer A, Clark CR, Noggle FT. 1994. Methcathinone and designer analogues: synthesis, stereochemical analysis, and analytical properties. J Chromatogr Sci 32:552–564. doi: 10.1093/chromsci/32.12.552. [DOI] [Google Scholar]
  • 35.Kerrigan S, Savage M, Cavazos C, Bella P. 2016. Thermal degradation of synthetic cathinones: implications for forensic toxicology. J Anal Toxicol 40:1–11. doi: 10.1093/jat/bkv099. [DOI] [PubMed] [Google Scholar]
  • 36.O'Byrne PM, Williams R, Walsh JJ, Gilmer JF. 2010. The aqueous stability of bupropion. J Pharm Biomed Anal 53:376–381. doi: 10.1016/j.jpba.2010.04.024. [DOI] [PubMed] [Google Scholar]
  • 37.Tsujikawa K, Mikuma T, Kuwayama K, Miyaguchi H, Kanamori T, Iwata YT, Inoue H. 2012. Degradation pathways of 4-methylmethcathinone in alkaline solution and stability of methcathinone analogs in various pH solutions. Forensic Sci Int 220:103–110. doi: 10.1016/j.forsciint.2012.02.005. [DOI] [PubMed] [Google Scholar]
  • 38. Shanati T, Ansorge-Schumacher M. 3 January 2019. Enzymes and methods for the stereoselective reduction of carbonyl compounds, oxidation and stereoselective reductive amination for the enantioselective preparation of alcohol amine compounds. International patent WO2019002459A1.
  • 39.Shanati T, Lockie C, Beloti L, Grogan G, Ansorge-Schumacher M. 2019. Two enantiocomplementary ephedrine dehydrogenases from Arthrobacter sp. TS-15 with broad substrate specificity. ACS Catal 9:6202–6211. doi: 10.1021/acscatal.9b00621. [DOI] [Google Scholar]
  • 40.Marmur JA. 1961. Procedure for the isolation of deoxyribonucleic acid from microorganisms. J Mol Biol 3:208–218. doi: 10.1016/S0022-2836(61)80047-8. [DOI] [Google Scholar]
  • 41.Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
  • 42.Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  • 43.Jukes TH, Cantor CR. 1969. Evolution of protein molecules, p 21–132. In Munro HN. (ed), Mammalian protein metabolism. Academic Press, New York, NY. [Google Scholar]
  • 44.Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x. [DOI] [PubMed] [Google Scholar]
  • 45.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 35:1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Rissman AI, Mau B, Biehl BS, Darling AE, Glasner JD, Perna NT. 2009. Reordering contigs of draft genomes using the Mauve aligner. Bioinformatics 25:2071–2073. doi: 10.1093/bioinformatics/btp356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Alikhan NF, Petty NK, Zakour BNL, Beatson SA. 2011. BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 12:402. doi: 10.1186/1471-2164-12-402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Meier-Kolthoff JP, Auch AF, Klenk HP, Göker M. 2013. Genome sequence-based species delimitation with confidence intervals and improved distance functions. BMC Bioinformatics 14:60. doi: 10.1186/1471-2105-14-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bradford MM. 1976. Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein-dye binding. Anal Biochem 72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 50.Shanati T, Ansorge-Schumacher M. 3 January 2019. Alcohol dehydrogenases and methods for the stereoselective reduction of carbonyl compounds. German patent DE102017210944B4.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AEM.02487-19-s0001.pdf (715.1KB, pdf)

Data Availability Statement

Genomic data of Arthrobacter sp. TS-15 is available in the GenBank database of NCBI. The whole-genome shotgun sequence has been deposited under accession number SDXQ01000000 and consists of sequences SDXQ01000001 to SDXQ01000151. The amino acid sequences of PseDH and EDH have been deposited under GenBank accession numbers TQS88919 and TQS88917, respectively, and the 16S rRNA gene sequence has been deposited under accession number MK459547.


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES