Skip to main content
PLOS Genetics logoLink to PLOS Genetics
. 2020 Mar 4;16(3):e1008617. doi: 10.1371/journal.pgen.1008617

Inhibition of the oligosaccharyl transferase in Caenorhabditis elegans that compromises ER proteostasis suppresses p38-dependent protection against pathogenic bacteria

Dae-Eun Jeong 1,¤a,#, Yujin Lee 2,#, Seokjin Ham 2,#, Dongyeop Lee 1,¤b, Sujeong Kwon 2, Hae-Eun H Park 2, Sun-Young Hwang 1,¤c, Joo-Yeon Yoo 1, Tae-Young Roh 1, Seung-Jae V Lee 2,*
Editor: Danielle A Garsin3
PMCID: PMC7055741  PMID: 32130226

Abstract

The oligosaccharyl transferase (OST) protein complex mediates the N-linked glycosylation of substrate proteins in the endoplasmic reticulum (ER), which regulates stability, activity, and localization of its substrates. Although many OST substrate proteins have been identified, the physiological role of the OST complex remains incompletely understood. Here we show that the OST complex in C. elegans is crucial for ER protein homeostasis and defense against infection with pathogenic bacteria Pseudomonas aeruginosa (PA14), via immune-regulatory PMK-1/p38 MAP kinase. We found that genetic inhibition of the OST complex impaired protein processing in the ER, which in turn up-regulated ER unfolded protein response (UPRER). We identified vitellogenin VIT-6 as an OST-dependent glycosylated protein, critical for maintaining survival on PA14. We also showed that the OST complex was required for up-regulation of PMK-1 signaling upon infection with PA14. Our study demonstrates that an evolutionarily conserved OST complex, crucial for ER homeostasis, regulates host defense mechanisms against pathogenic bacteria.

Author summary

N-linked glycosylation is essential for the function of various proteins, but its effects on physiology at an organism level remain poorly understood. Using the roundworm Caenorhabditis elegans, we show that the oligosaccharyl transferase (OST) complex, which mediates the N-glycosylation of substrate proteins in the ER, reduces susceptibility to pathogenic bacteria, Pseudomonas aeruginosa. We find that OST enhances defense against P. aeruginosa via maintenance of ER unfolded protein response (UPRER) and up-regulation of cytosolic p38 MAP kinase signaling. Our findings propose an intriguing model for the organellar crosstalk between the ER and the cytosol in host defense mechanisms. Because the OST complex components are highly conserved among eukaryotes, our study on the regulation of cellular signaling and C. elegans physiology by the OST complex will provide an insight into the function of its mammalian counterpart.

Introduction

N-linked protein glycosylation is an abundant posttranslational modification that regulates protein stability, localization, and activity [13]. Defects in the protein N-glycosylation process lead to various pathophysiological consequences, such as abnormal development and metabolic disorders [4]. Protein N-glycosylation is also implicated in immunity. For example, mutations in genes that act in the N-glycosylation pathway cause defects in both the innate and adaptive immune systems [57]. Nevertheless, the contribution of protein N-glycosylation to immunity at the organism level remains incompletely understood.

Protein N-glycosylation is mediated by enzymatic processes that transfer mono- or poly-saccharides to asparagine residues in a consensus motif (N-X-S/T; X stands for any amino acid except proline) of substrate proteins [8]. At the ER membrane, the oligosaccharyl transferase (OST) complex mediates N-linked glycosylation by transferring the glycans from glycan precursors to asparagine residues in peptides [9, 10]. The eukaryotic OST complex consists of highly conserved subunits, ribophorin I, ribophorin II, OST48, OST4, STT3 (staurosporine and temperature sensitive 3), N33/Tusc3 (tumor suppressor candidate 3) or IAP (implantation-associated protein), and DAD1 (defender against apoptotic death 1) [9, 11]. Although various N-glycosylated proteins have been identified in many metazoans such as the roundworm Caenorhabditis elegans [12, 13], the physiological roles of the OST complex remain largely unexplored.

C. elegans is an excellent model to study genetic mechanisms underlying the regulation of anti-bacterial host immunity [1419]. In nature, C. elegans live in soil and/or rotten fruits rich in microbes, and contain many pathogenic bacteria in the gut [20, 21]. Various genetic factors that regulate the immune responses of C. elegans against pathogenic bacteria, including Pseudomonas aeruginosa (PA14) have been identified [18]. In particular, PMK-1/p38 MAP kinase is activated upon infection with PA14, leading to up-regulation of transcription factors, including ATF-7, ELT-2, and SKN-1 [2228]. In addition, ER unfolded protein response (UPRER) regulators, including IRE-1 (a transmembrane serine/threonine protein kinase) and XBP-1 transcription factor, are critical for development under PA14 infection and protection of adult worms against PA14 [2931].

In the current study, we show that the OST complex that mediates protein N-linked glycosylation is critical for the innate immunity of C. elegans against PA14 infection. Genetic inhibition of the OST complex caused ER stress, possibly through the accumulation of unprocessed proteins in the ER, which in turn increased UPRER. In addition, OST complex was required for the induction of various PMK-1/p38 MAP kinase-regulated genes under PA14-infected conditions. We also identified vitellogenin-6 (VIT-6) as an OST-dependent glycosylated protein, crucial for protection against PA14. Furthermore, we showed that inhibiting the OST complex substantially increased susceptibility to PA14 through down-regulating PMK-1. Our study suggests that the OST complex maintains ER protein homeostasis and enhances defense against pathogenic bacteria through activation of PMK-1 signaling.

Results

The oligosaccharyl transferase (OST) complex is required for the maintenance of C. elegans survival upon infection with Pseudomonas aeruginosa

Our previous RNAi screen for anti-bacterial immunity-modulatory genes encoding mitochondrial factors [32] tested many non-mitochondrial genes which were not included in the paper due to lack of relevance (S1 Table). Among them, RNAi targeting ZK686.3/N33/Tusc3, an OST complex component, substantially decreased the survival of C. elegans to PA14 (Fig 1A, slow killing, small lawn where worms effectively avoid pathogenic PA14). We then found that RNAi targeting each of four other OST complex components, ribo-1/ribophorin I, stt-3/STT3, ostb-1/OST48 and ostd-1/ribophorin II [11], substantially reduced worm survival under PA14 infection (Fig 1A, S1A and S1B Fig). Furthermore, a reduction-of-function mutation of stt-3, which altered tyrosine 550 to alanine in a catalytic subunit of OST ([33], see Fig 1B legend and S1C Fig) by using CRISPR/Cas9-based genome editing drastically increased susceptibility to PA14 (Fig 1B). We found that RNAi targeting each of the OST components enhanced the accumulation of GFP-labeled PA14 in the intestinal lumen (Fig 1C and 1D). Additionally, RNAi targeting stt-3 reduced worm survival on the big lawn of PA14 where worms do not have space for an avoidance behavior (Fig 1E). In addition to slow killing conditions, in which PA14 kill hosts by colonization at the intestinal lumen, in fast killing conditions PA14 secretes toxic factors that compromise host health [3436]. We found that genetic inhibition of stt-3 increased sensitivity to PA14 under fast killing conditions as well (Fig 1F). These data suggest that OST components are required for the protection of C. elegans against pathogenic PA14 and that reduced survival by inhibition of OST is not due to defects in PA14 avoidance behavior. In contrast, RNAi targeting each OST component had small effects on the lifespan of C. elegans fed with standard E. coli foods (Fig 1G; ribo-1 RNAi data are consistent with [37]), or survival upon infection with pathogenic E. coli (Fig 1H) or E. faecalis (Fig 1I). These data indicate that enhanced sensitivity of worms to PA14 by genetic inhibition of OST complex is not simply caused by potential lethality or sickness. Together, the OST complex appears to specifically modulate susceptibility to PA14 infection rather than generally affecting worm survival.

Fig 1. C. elegans OST complex is required for protection against and clearance of PA14.

Fig 1

(A-B) Genetic inhibition of OST complex by RNAi targeting each component (ZK686.3, ribo-1, stt-3, ostb-1, or ostd-1) (A) or by a mutation in stt-3(syb458) [stt-3(-)] (B) reduced the survival of C. elegans under PA14-infected conditions. WT: wild-type (N2), stt-3(-)/hT2(+): a balanced heterozygote. We replaced 550th tyrosine residue in STT-3 with alanine for generating a reduction of function allele (S1C Fig), because the orthologous change (Y519A) in yeast STT3 caused mild growth defects without causing lethality [33]. stt-3(syb458) homozygotes were able to develop to L4/young adult stage but were sterile. These phenotypic observations suggest that stt-3(syb458) is a reduction of function allele. (C) Shown are representative images of worms that were pre-treated with control RNAi and RNAi targeting each indicated OST component, after PA14-GFP exposure for 72 hrs. pmk-1 RNAi was used as a positive control. Scale bar indicates 100 μm. (D) Semi-quantification of GFP-labeled PA14 levels in the intestinal lumen of worms in panel C (n ≥ 20 from two independent experiments). p values were calculated by using Chi-squared test (***p < 0.001). We also found that stt-3 RNAi slightly reduced pumping rates of worms (S1D Fig). Thus, the increased accumulation of PA14 by inhibition of OST seems unlikely due to increased PA14 uptake. (E-F) Inhibition of OST complex by stt-3 RNAi reduced the survival of worms both under slow (E) and fast killing (F) conditions of which the whole surface of plates was covered by PA14 (big lawn of PA14). (G) Perturbation of OST complex by RNAi targeting each of OST components had small effects on lifespan fed with normal dietary E. coli diets. RNAi targeting cco-1 (cytochrome c oxidase-1 subunit) that increases lifespan [83] was used as a positive control. (H) Knockdown of each of three components (ZK686.3, ribo-1, and ostb-1) of the OST complex did not alter the survival of worms upon infection with pathogenic E. coli. RNAi targeting stt-3 or ostd-1 slightly reduced the survival on pathogenic E. coli. (I) The survival time of worms treated with each of four OST components (ZK686.3, ribo-1, stt-3, and ostd-1) was variable under E. faecalis-infected conditions. See S3 Table for additional repeats and statistical analysis for survival assay results in this figure.

The OST complex regulates the proper localization of vitellogenin-6, crucial for survival on PA14

We then sought to identify OST substrates that were crucial for immunity against PA14, using a small-scale two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) followed by glycoprotein staining and peptide mass fingerprinting (See Materials and Methods for details). Vitellogenin-6 (VIT-6) was one of three recovered stt-3-dependent N-glycosylated proteins (S2 Table), consistent with a previous N-glycoproteomic study in C. elegans [12]. vit-6 is expressed in the intestinal cells of C. elegans ([38], WormBase database), and subsequently secreted and imported into the eggs. We showed that stt-3 RNAi impaired the strong localization of VIT-6::mCherry in the eggs (Fig 2A). These data suggest that N-glycosylation of VIT-6 is critical for its proper secretion, and that VIT-6 is an OST substrate that affects physiological responses. A previous report showed that mutations that cause abnormal accumulation of vitellogenins, including VIT-6, impair protection against PA14 [39]. Here we found that RNAi knockdown of vit-6 substantially decreased the survival of wild-type worms on PA14 (Fig 2B), without affecting normal lifespan on an E. coli diet (Fig 2C). In addition, vit-6 RNAi and stt-3 RNAi did not have an additive effect on the susceptibility of worms to PA14 (Fig 2D). Although genetic interaction analysis with double RNAi knockdown has limitations for interpretation, this result is consistent with the possibility that VIT-6 and OST regulate the survival of animals on PA14 by acting in the same genetic pathway. Together, these results suggest that the OST complex promotes the adequate N-glycosylation of proteins such as VIT-6, which contributes to the protection of worms against PA14.

Fig 2. PA14 infection promotes OST-dependent N-glycosylation of VIT-6 that is responsible for ER homeostasis.

Fig 2

(A) Fluorescence images of vit-6::mCherry transgenic animals treated with control or stt-3 RNAi. Dashed lines indicate embryos in the day 2 adult worms. Scale bar indicates 100 μm. (B-C) RNAi targeting vit-6 reduced the survival of wild-type (N2) worms on PA14 (B) without decreasing lifespan on E. coli diets (C). (D) RNAi targeting vit-6 did not affect the survival of worms treated with stt-3 RNAi. See S3 Table for additional repeats and statistical analysis for survival assay results in this figure.

Inhibition of the OST complex induces UPRER

In C. elegans, PA14 infection induces substantial transcriptional changes in immunity-regulating genes [23, 24]. Because the OST complex was required for immunity against PA14, we asked whether the OST complex altered transcriptional responses upon PA14 infection. We specifically determined the transcriptomic changes caused by knockdown of stt-3 with or without PA14 infection. By performing mRNA sequencing (RNA-seq) analysis, we first noticed that stt-3 RNAi substantially altered transcriptome profile on normal E. coli diets without PA14 infection (Fig 3A). Notably, gene ontology (GO) terms related to UPRER as well as immune responses were over-represented among the 208 genes up-regulated by stt-3 RNAi (Fig 3B, S4 Table, fold change > 2, Benjamini and Hochberg (BH)-adjusted p value < 0.05 with 17,430 genes), whereas 128 down-regulated genes were enriched in GO terms of metabolic processes (S2A Fig, S4 Table). Consistently, stt-3 RNAi increased the levels of hsp-3, hsp-4, and enpl-1, which encode major ER chaperones induced by UPRER (Fig 3A). We confirmed the induction of hsp-4 by stt-3 RNAi using an hsp-4p::GFP reporter (Fig 3C and 3D) and qRT-PCR (Fig 3E). The induction of hsp-4p::GFP by stt-3 RNAi was completely suppressed by mutations in xbp-1 or ire-1, which encode key UPRER regulators (Fig 3C and 3D). We obtained consistent qRT-PCR results for the mRNA levels of hsp-3 and hsp-4 (S2C and S2D Fig). In addition, the ratio of spliced (active) to unspliced (inactive) xbp-1 mRNA forms was increased by stt-3 RNAi (Fig 3F–3H and S2E Fig). These results indicate that inhibition of the OST induces UPRER through the IRE-1/XBP-1 signaling axis.

Fig 3. OST complex maintains ER protein homeostasis.

Fig 3

(A) A scatter plot showing the effects of RNAi targeting stt-3 on the expression levels of mRNAs. Red dots and blue dots indicate 208 up- and 128 down-regulated genes, respectively (fold change > 2, Benjamini and Hochberg (BH)-adjusted p value < 0.05). (B) Overrepresented GO terms of genes induced by stt-3 RNAi. UPRER: ER unfolded protein response. The numbers of genes for individual terms are indicated in parentheses. (C) RNAi targeting each OST component (ZK686.3, ribo-1, stt-3, ostb-1, or ostd-1) increased the expression of hsp-4p::GFP in wild-type animals but not in xbp-1(zc12) [xbp-1(-)] or in ire-1(zc14) [ire-1(-)] mutants. Scale bar indicates 250 μm. (D) Quantification of data in panel C (n ≥ 24 from two independent experiments). (E-F) qRT-PCR analysis data showing mRNA levels of hsp-4 (E) and the ratio of spliced/total xbp-1 mRNAs (F) in worms treated with control or stt-3 RNAi (n ≥ 3). Error bars indicate SEM. p values were calculated by two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001). (G) An intron retention of xbp-1 transcripts in a representative RNA-seq sample. A grey box with a dotted line indicates the location of alternative splicing. (H) The ratio of spliced/total xbp-1 mRNAs in triplicate RNA-seq samples. Error bars indicate SEM.

The OST complex contributes to PMK-1-dependent transcriptional changes upon infection with PA14

We then analyzed the role of the OST complex in transcriptomic changes caused by infection with PA14 (Fig 4A and S3A Fig). In animals infected with PA14, 1,440 genes were up-regulated and 2,309 genes were down-regulated (Fig 4A, fold change > 2, BH-adjusted p value < 0.05 with 17,430 genes), indicating a broad transcriptional remodeling. We noticed that stt-3 RNAi reduced (fold change > 2) the expression of 569 genes up-regulated by PA14 (Fig 4A and S5 Table), among which immune defense-associated GO terms were substantially enriched (Fig 4B). In contrast, 569 stt-3-dependent PA14-repressed genes were not enriched with immune responses (S3B Fig and S5 Table). We then examined which genetic pathways acted together with the OST complex for the defense against PA14, by comparing our RNA-seq data with previously published C. elegans transcriptome data (Fig 4C) [24, 28, 4048]. We found that genes whose induction is dependent on ELT-2, PMK-1, and ATF-7 were substantially up-regulated by PA14 in an stt-3-dependent manner (Fig 4D and 4E). These data are consistent with the previous report showing that ELT-2 and ATF-7 cooperate to induce a subset of PMK-1-regulated immune genes [27]. In addition, genes whose expression was increased by the inhibition of vhp-1/MAP kinase phosphatase, which leads to PMK-1 activation [49], were significantly enriched with genes up-regulated by PA14 in an stt-3-dependent manner (Fig 4D). We found that stt-3-independent PA14-induced genes had substantially smaller overlaps with genes up-regulated by SEK-1 (PMK-1 upstream kinase), PMK-1 or ELT-2, or by inhibition of VHP-1 than stt-3-dependent PA14-induced genes did (Fig 4F). In contrast, genes whose expression levels are changed by the genetic modulation of each of the other immune-regulating transcription factors, ZIP-2/bZIP [45], SKN-1/NRF2 [26], HSF-1/heat shock factor 1 [50] and DAF-16/FOXO [24], were independent of stt-3 (S4 Fig). Our analysis of chromatin-immunoprecipitation sequencing (ChIP-seq) data [51] also suggests the binding of ELT-2, a GATA transcription factor, to the promoters and bodies of stt-3-dependent PA14-induced genes (Fig 4G). Moreover, a GATA transcription factor-binding motif (TTATCA) was predominantly located in the promoter regions (-1 kb to +100 bp) of stt-3-dependent PA14-induced genes (Fig 4H). These results suggest that transcriptional responses triggered by the PMK-1/p38 MAP kinase signaling upon PA14 infection require the functional OST complex.

Fig 4. OST complex mediates PMK-1-dependent induction of a subset of PA14-responsive genes.

Fig 4

(A) A scatter plot showing the effects of RNAi targeting stt-3 on the expression levels of mRNAs that were significantly changed by PA14 infection (fold change > 2, BH-adjusted p value < 0.05). Red dots and blue dots indicate stt-3-dependent 569 up- and 569 down-regulated genes, respectively (fold change > 2 and BH-adjusted p value < 0.05 by PA14 in control RNAi, but the changes were reduced by fold > 2 by stt-3 RNAi). (B) Overrepresented GO terms of genes induced by PA14 in an stt-3-dependent manner. The numbers of genes for individual terms are indicated in parentheses. (C) Twenty-nine gene sets whose expression was significantly increased by PA14 (q value < 0.25). The relative enrichment (NES(ctrl RNAi + PA14)/ctrl RNAi−NES(stt-3 RNAi + PA14)/stt-3 RNAi) indicates the extent of expression changes of a gene set by PA14 with or without stt-3 RNAi. Red bars represent 10 stt-3-dependent PA14-induced sets. Grey bars represent stt-3-independent PA14-induced sets, some of which are shown in S4 Fig. (D) stt-3-dependent PA14-enhanced gene sets. In addition to PMK-1 signaling component genes, we noticed that genes whose activation was dependent on NIPI-3, another regulator of immunity against PA14 [42], were associated with genes up-regulated by PA14 in an stt-3-dependent manner. PA: PA14. SA: Staphylococcus aureus. Superscript numbers indicate references that include corresponding transcriptomic data. a data (GSE82238) in GEO. The numbers of genes for individual categories are indicated in parentheses. (E) Genes up-regulated in an ELT-2-dependent manner [43] were induced by PA14 in an stt-3-dependent manner. NES: normalized enriched score. q values were obtained by calculating the false discovery rate (FDR) corresponding to each NES. (F) Representation factors for overlaps between stt-3-dependent or stt-3-independent PA14-induced genes and PMK-1 signaling component-encoding genes. a data (GSE92902) and b data (GSE82238) in GEO. The numbers of genes for individual categories are indicated in parentheses. (G) Targets of transcription factors specifically associated with stt-3-dependent PA14-induced genes. The numbers of genes for individual categories are indicated in parentheses. (H) A GATA binding motif (MA0542.1) in JASPAR CORE [81] enriched in promoter regions (-1 kb to +100 bp) of stt-3-dependent PA14-induced genes compared to corresponding positions of stt-3-independent PA14-induced genes.

Next, we confirmed our RNA-seq. data by showing that RNAi targeting ZK686.3, ribo-1, stt-3, ostb-1, or ostd-1 substantially decreased the induction of T24B8.5p::GFP, a target reporter of PMK-1, upon PA14 infection (Fig 5A and 5B). We also obtained consistent qRT-PCR results by measuring the mRNA levels of three selected PMK-1-regulated ATF-7 targets, T24B8.5, C17H12.8, and K08D8.5 (Fig 5C and 5E) [25]. In contrast, RNAi against each of the OST complex components did not affect the induction of irg-1 or irg-2 (Fig 5F and 5G), targets of another immune-regulatory transcription factor ZIP-2 [45]. These data suggest that the OST complex is required for the transcriptional responses caused by PA14 infection and subsequent PMK-1/p38 MAP kinase signaling.

Fig 5. OST complex increases the expression of several PMK-1-regulated genes under PA14-infected conditions.

Fig 5

(A) RNAi targeting each OST component (ZK686.3, ribo-1, stt-3, ostb-1, or ostd-1) reduced the induction of T24B8.5p::GFP by PA14 infection. pmk-1 RNAi was used as a positive control. Scale bar indicates 500 μm. Different from the genetic inhibition of the OST complex, treatment with tunicamycin (5 μg/ml) did not alter the level of T24B8.5p::GFP with or without PA14 infection (S5C Fig). (B) Quantification of data in panel A (n ≥ 20 from three independent experiments). (C-E) qRT-PCR analysis data showing the mRNA levels of three selected PMK-1-regulated genes, T24B8.5 (C), C17H12.8 (D), and K08D8.5 (E), upon knocking down indicated OST components with or without PA14 infection (n ≥ 3). pmk-1 RNAi was used as a positive control. (F-G) qRT-PCR analysis data showing the mRNA levels of two selected ZIP-2-regulated genes, irg-1 (F) and irg-2 (G), upon knocking down indicated OST components with or without PA14 infection (n = 4). Error bars indicate SEM. p values were calculated by using two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001).

OST inhibition increases susceptibility to PA14 in a PMK-1-dependent manner

Next, we investigated the functional relevance of the link between the OST complex and UPRER or PMK-1 signaling for immunity against PA14. We first measured the susceptibility of UPRER-impaired xbp-1(-) mutants treated with stt-3 RNAi to PA14. We found that stt-3 RNAi further reduced the survival of xbp-1 mutants on PA14 (Fig 6A), suggesting that inhibition of the OST complex decreases the survival of worms on PA14, at least partially independently of UPRER. In addition, we found that PA14 infection slightly increased the level of hsp-4p::GFP in control worms but substantially decreased that in worms treated with stt-3 RNAi (S5A Fig). Moreover, the induction of ER stress by tunicamycin significantly increased the survival of worms on PA14 (S5B Fig). These data suggest that elevated ER stress is not a major cause for the increased susceptibility to PA14 by the genetic inhibition of OST.

Fig 6. OST complex reduces susceptibility to PA14 through PMK-1 signaling.

Fig 6

(A) Genetic inhibition of OST complex by stt-3 RNAi further decreased the survival of xbp-1(zc12) [xbp-1(-)] animals on PA14. (B-C) stt-3 RNAi suppressed the enhanced PA14 resistance of hsp-60-trangenic worms (hsp-60 Tg) (B), but did not reduce the survival of pmk-1(km25) [pmk-1(-)] mutants (C) upon PA14 infection. (D) stt-3 RNAi did not affect the PA14 susceptibility of xbp-1(-); pmk-1(-) animals. We also obtained data suggesting that VIT-6 affects sensitivity to PA14 independently of HSP-60 and PMK-1 pathway (See S7 Fig. legends for details). (E) Schematic model. OST contributes to the maintenance of worm survival on PA14 infection by decreasing stress in the ER and by up-regulating PMK-1-mediated immunity in the cytosol. See S3 Table for additional repeats and statistical analysis for survival assay results in this figure.

Next, we showed that stt-3 RNAi completely suppressed the PA14 resistance conferred by the transgenic expression of hsp-60 (Fig 6B), which we previously showed to up-regulate PMK-1 signaling [32]. Conversely, we found that decreased survival of worms on PA14 by stt-3 RNAi was not additive to that by pmk-1(-) mutations (Fig 6C). Although RNAi knockdown has a limitation for genetic interaction analysis, these data are consistent with the possibility that OST and PMK-1 act in the same pathway to decrease the susceptibility of worms on PA14. These results are also consistent with our transcriptomic data showing that inhibition of the OST complex decreases PMK-1 signaling on PA14 infection.

We then determined the genetic interaction among stt-3 RNAi, UPRER, and PMK-1 for defense against PA14. We first established that xbp-1(-) mutation does not further enhance PA14 susceptibility caused by a pmk-1(-) mutation (S6 Fig), consistent with a previous report [31]. Importantly, stt-3 RNAi did not decrease the shortened survival of xbp-1(-); pmk-1(-) mutants upon PA14 infection (Fig 6D). Altogether, our data indicate that inhibition of the OST complex, which perturbs UPRER, increases susceptibility to PA14 through down-regulating PMK-1 signaling.

Discussion

The OST complex contributes to defense against pathogenic P. aeruginosa through affecting transcriptional responses to infection

In this study, we showed that the OST complex was required for the protection of C. elegans against pathogenic P. aeruginosa, PA14. We found that the OST complex mediated ER protein homeostasis through maintaining UPRER. Defects in the N-glycosylation process likely disrupt the maturation and the proper localization of ER proteins, thereby causing ER stress via the accumulation of abnormal proteins in the ER. Our transcriptomic analysis revealed that the OST complex contributed to transcriptional responses to PA14 infection. In particular, the OST complex was required for PMK-1-dependent gene induction in response to PA14 infection. We also showed that PMK-1 was required for OST-mediated defense against PA14. Overall, our work suggests that an evolutionarily conserved OST complex contributes to protection against pathogenic bacteria by maintaining ER homeostasis and by up-regulating PMK-1 signaling (Fig 6E).

Substrate proteins of the OST complex may contribute to systemic immune response

Many secreted and membrane-localized proteins constitute the substrates of the OST complex whose stability, maturation, or localization is regulated by N-linked glycosylation. C. elegans possesses many anti-microbial effector proteins that are secreted from cells upon exposure to various pathogenic microbes [52, 53]. Thus, the OST complex may modulate immune responses by regulating the post-translational modification, intracellular trafficking, and/or secretion of immune effector proteins such as anti-microbial peptides, cytokines, and receptor proteins. VIT-6 is secreted by intestinal cells and transported into oocytes for lipid transfer from parents to offspring [38, 39, 5456]. Our data suggest that OST mediates N-glycosylation of VIT-6 to maintain defense against PA14 infection. It remains undetermined how VIT-6 contributes to protection against PA14 infection. One possibility is that the transport of lipids from intestinal cells to oocytes may play a role in preventing PA14 pathogenicity. Alternatively, VIT-6 may function as a secreted factor in signal transduction for improving anti-bacterial immunity, in addition to or instead of its potential role in lipid transport. It will be interesting to test these possibilities in future studies.

OST may contribute to PMK-1-dependent immunity via maintaining glycoprotein quality control in the ER

Previous studies with C. elegans have provided evidence for the crucial role of ER protein homeostasis in PMK-1-dependent immunity [29, 31]. Under PA14 infection conditions, PMK-1 up-regulates many ER protein-coding genes, eventually increasing the protein load and the ER stress [29]. XBP-1-mediated UPRER is a critical factor for immunity against PA14 (Fig 6A) [29, 31, 39]. Similar to XBP-1 and UPRER, OST-regulated N-glycosylation is crucial for ER protein homeostasis (Fig 3A–3H) [3, 57], and we showed that the OST contributes to protection against PA14 infection. Interestingly, our transcriptomic data indicate that PA14 infection down-regulated many abu genes (abu-1, 6, 7, 9, 10, and 15) and pqn genes (pqn-2, 37, 57, 60, 63, and 74), which were suppressed by the inhibition of OST (S5 Table). abu and pqn genes regulate non-canonical UPRER [58] and also contribute to the protection of worms against pathogenic bacteria [59, 60]. Research that determines how OST regulates canonical and non-canonical UPRER processes for influencing PMK-1 signaling will be crucial for elucidating N-glycosylation-mediated defense mechanisms against pathogens.

Potential role of N-glycosylation and OST complex in mammalian immunity

Recent studies suggest that the mammalian OST complex regulates the N-glycosylation of immune regulators to influence immunity. A previous study using a CRISPR/Cas9 knockout screen identified multiple OST complex components as regulators of cytokine production and inflammatory responses in primary dendritic cells [61]. In addition, N-glycosylation of mammalian toll-like receptors appears to be critical for their function as immune regulators [62, 63]. Many cytokines are also N-glycosylated for proper secretion and/or activity [64]. Our current study using C. elegans suggests novel mechanisms for immune regulation by the OST, through N-glycosylation of defense factors, which transmit infection signals from the ER to the PMK-1 pathway in cytosol. It will be interesting to perform further studies investigating whether similar processes are conserved in mammals.

Materials and methods

C. elegans strains

All strains were maintained as previously described [65]. Some strains were obtained from Caenorhabditis Genetics Center, which is funded by the NIH National Center for Resources (p40 OD010440). Strains used in this study were described below: N2 wild-type, PHX458 stt-3(syb458)/hT2, SJ4005 zcIs4[hsp-4p::GFP], AU78 agIs219[T24B8.5p::GFP] a gift from D.H. Kim lab, IJ939 yhIs62[hsp-60p::hsp-60::GFP; odr-1p::RFP], IJ940 yhIs63[hsp-60p::hsp-60::GFP; odr-1p::RFP], IJ1918 xbp-1(zc12) obtained by outcrossing SJ17 four times to Lee-lab N2, IJ130 pmk-1(km25) obtained by outcrossing KU25 four times to Lee-lab N2, IJ1935 xbp-1(zc12); pmk-1(km25), GA2100 bIs1[vit-2p::vit-2::GFP + rol-6]; wuEx277[vit-6p::vit-6::mCherry + rol-6] a gift from D. Gems lab. PHX458, STT-3 catalytic residue mutant (Y550A) strain was designed based on a report characterzing the yeast STT3 [33], and generated using CRISPR/Cas9 by SunyBiotech (http://www.sunybiotech.com/).

Pathogen killing assays

PA14 standard (small lawn) slow killing assay was performed as previously described [32, 66]. Briefly, PA14 was cultured in LB media at 37°C overnight, and 5 μl of the liquid culture was then seeded on the center of high peptone NGM plates (0.35% bactopeptone). The plates were incubated at 37°C for 24 hrs and kept at 25°C before use. Wild-type (N2) or mutant worms were grown on plates where RNAi bacteria were seeded with 1 mM IPTG (Isopropyl β-D-1-thiogalactopyranoside). L4 or young adult stage worms were transferred to the PA14-seeded plates with 50 μM FUdR (5-fluoro-20-deoxyuridine) that prevents progeny from hatching. The worms were maintained at 25°C, scored twice a day and counted as dead if the worms did not respond to prodding. For PA14 big lawn killing assays, 15 μl of PA14 liquid culture was seeded onto each high peptone NGM plate and subsequently spread out through entire surface of the plate. PA14 fast killing assay was performed as previously described with minor modifications [67]. Briefly, 15 μl of PA14 liquid culture was spread on PGS (peptone-glucose-sorbitol) plates, incubated for 24 hrs at 37°C, and kept at 25°C for 2 hrs before use. L4 stage larval wild-type worms that were pre-treated with control or stt-3 RNAi were transferred to PA14 on PGS for survival assays. Pathogen killing assays against E. faecalis or pathogenic E. coli were performed as previously described [17, 68]. Statistical analysis of survival data was performed by using OASIS (http://sbi.postech.ac.kr/oasis) and OASIS2 (https://sbi.postech.ac.kr/oasis2), which calculate p values using log-rank (Mantel-Cox method) test [69, 70].

Measurement of pharyngeal pumping rate

Wild-type N2 worms were grown on control or stt-3 RNAi plates. The pumping rate of young adult stage worms was counted under a dissecting microscope for 15 sec and then re-scaled to pumping/1 min.

Intestinal PA14-GFP accumulation assays

Intestinal PA14-GFP accumulation assays were performed as previously described [22, 32], with minor modifications. L4 stage larval worms that were pre-treated with control RNAi or RNAi targeting each OST component were infected with PA14 that expresses GFP (PA14-GFP) under slow killing and small lawn conditions for 72 hrs and subsequently imaged using a microscope.

Microscopy

Transgenic animals that expressed fluorescent proteins or wild-type animals infected with PA14-GFP were imaged by using AxioCam HRc (Zeiss Corporation, Jena, Germany) camera mounted on a Zeiss Axioscope A.1 microscope (Zeiss Corporation, Jena, Germany) upon treating with 100 mM sodium azide (DAEJUNG, Siheung, South Korea) for anesthesia. The fluorescence intensity of the animals was quantified by using ImageJ software (Rasband, W.S., ImageJ, U.S. National Institute of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/). The quantification of the data was displayed by using Graphpad Prism 7 software (http://www.graphpad.com/scientific-software/prism/).

Identification of PA14 infection-dependent glycoproteins

Eggs of wild-type N2 worms were placed on control RNAi or stt-3 RNAi bacteria-seeded plates and grown to L4 stage. L4 stage worms were then transferred to corresponding RNAi bacteria- or PA14-seeded plates after washing with M9 buffer 3–4 times. After 12 hrs, worms were harvested after washing with M9 buffer 3–4 times to remove residual bacteria and immediately frozen with liquid nitrogen. The worm samples were ground to form frozen powders with a cold mortar and pestle using liquid nitrogen. The powders dissolved in IPG dry strips (4–10 NL IPG, 24 cm, Genomine, Korea) were equilibrated for 12–16 hrs with 7 M urea, 2 M thiourea containing 2% 3-[(3-cholamidopropy)dimethyammonio]-1-propanesulfonate (CHAPS), 1% dithiothreitol (DTT), 1% pharmalyte and respectively loaded with 200 μg of the sample. Isoelectric focusing (IEF) was performed at 20°C using a Multiphor II electrophoresis unit and EPS 3500 XL power supply (Amersham Biosciences) following manufacturer’s instruction. For IEF, the voltage was linearly increased from 150 to 3,500 V during 3 hrs for sample entry followed by constant 3,500 V and focusing was completed after reaching 96 kVh. Prior to the second dimensional separation, strips were incubated for 10 min in equilibration buffer (50 mM Tris-Cl, pH 6.8 containing 6 M urea, 2% SDS and 30% glycerol), firstly with 1% DTT and secondly with 2.5% iodoacetamide. Equilibrated strips were inserted onto SDS-PAGE gels (20 x 24 cm, 10–16%). SDS-PAGE was performed using Hoefer DALT 2D system (Amersham Biosciences) following manufacturer’s instruction. The 2D gels were run at 20°C for 1,700 Vh. Subsequently, the protein gels were stained with Pro-QTM Emerald 488 glycoprotein stain kit (Invitrogen) and imaged for measuring glycoprotein levels. The gels were then stained by using a Colloidal Coomassie Brilliant Blue (CBB) method for measuring the levels of total proteins. Quantitative analysis of digitized images was carried out using the PDQuest (version 7.0, BioRad) software following the protocol provided by the manufacturer. The intensities of glycoproteins were normalized to those of total proteins, to compare the glycoprotein levels in four different experimental samples. Protein spots whose glycosylation levels were increased by PA14 infection in an stt-3-dependent manner were selected for extracting proteins from the gels and for subsequent Peptide Mass Fingerprinting (PMF) analyses.

Lifespan assays

Lifespan assays were performed as previously described [71]. Young adult worms that were grown on control RNAi and OST component RNAi plates were transferred to 5 μM FUdR-containing control and OST component RNAi plates, respectively. The animals that did not move upon gentle touch were counted as dead. The animals that crawled off the plates, displayed ruptured vulvae, burrowed, or displayed internal hatching were censored but included in the subsequent statistical analysis. Statistical analysis of lifespan data was performed by using OASIS (http://sbi.postech.ac.kr/oasis), and OASIS2 (https://sbi.postech.ac.kr/oasis2), which calculate p values using log-rank (Mantel-Cox method) test [69, 70].

RNA extraction and quantitative RT-PCR

RNA extraction and qRT-PCR were performed as previously described with minor modifications [72]. Wild-type N2 worms fed with control RNAi, pmk-1 RNAi or OST component RNAi bacteria were grown to L4 stage and then transferred to corresponding RNAi bacteria- or PA14-seeded plates after washing with M9 buffer 3–4 times. After 12 hrs, worms were harvested by washing with M9 buffer 3–4 times to remove residual bacteria. Total RNA in the animals was isolated by using RNAiso plus (Takara, Seta, Kyoto, Japan) and was used for synthesizing cDNA with ImProm-II Reverse Transcriptase kit (Promega, Madison, WI, USA). Quantitative real-time PCR was performed by using StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) as described in the manufacturer’s protocol. Comparative CT method was used for the quantitative analysis of mRNAs. For all biological data sets, ama-1 mRNA, which encodes an RNA polymerase II large subunit, was used as a normalization control. The primer sequences used for qRT-PCR analysis are as follows; 5’-TGGAACTCTGGAGTCACACC (forward) and 5’-CATCCTCCTTCATTGAACGG (reverse) for ama-1, 5’-AGTTGAAATCATCGCCAACG (forward) and 5’- GCCCAATCAGACGCTTGG (reverse) for hsp-4, 5’- CCGATCCACCTCCATCAAC (forward) and 5’-ACCGTCTGCTCCTTCCTCAATG (reverse) for total xbp-1, 5’-TGCCTTTGAATCAGCAGTGG (forward) and 5’- ACCGTCTGCTCCTTCCTAATG (reverse) for spliced xbp-1, 5’-TGTTAGACAATGCCATGATGAA (forward) and 5’-ATTGGCTGTGCAGTTGTACC (reverse) for T24B8.5, 5’-GAACAATAGTGTCAAGCCGATCTGC (forward) and 5’-TTCTGAATGATGAATGCATGTTTAC (reverse) for C17H12.8, 5’-TCTGGTCAAAATATCCTCCGGGAAG (forward) and 5’-GAGCATCACTCGATTGATTGCAGTG (reverse) for K08D8.5, 5’-GATCTTGTTCCGTACCCATGG (forward) and 5’-GCTTTGTCAAGACCAATTCCC (reverse) for irg-1, 5’- TTTACTTCCGAAAATCTCTC (forward) and 5’-GATAAGTTTTGACAATTGTG (reverse) for irg-2.

RNA-sequencing analysis

RNA was extracted as described above (see RNA extraction and quantitative RT-PCR section). Libraries were constructed and sequencing was performed by Macrogen Inc. (Seoul, South Korea). Sequencing reads were aligned to the C. elegans genome WBcel235 (ce11) by using HISAT2 (v.2.0.5) [73]. Aligned transcripts were assembled and quantified by using StringTie (v.1.3.3b) [74] and Ballgown (v.2.0.0) [75]. The batch effects of samples were removed by upper-quartile normalization followed by RUVSeq with control genes (v1.16.1) [76]. Differentially expressed genes (fold change > 2 and adjusted p value < 0.05) were identified by using DESeq2 (v.1.22.2) [77]. Wald test p values are adjusted for multiple testing using the procedure of Benjamini and Hochberg. Genes whose expression was significantly changed by PA14 in control RNAi-treated worms but not by PA14 in stt-3 RNAi-treated worms (fold change > 2 in opposite directions) were defined as stt-3-dependent PA14-responsive genes (569 genes for stt-3-dependent up-regulated genes by PA14 and 569 genes for stt-3-dependent down-regulated genes by PA14, S5 Table); it is a rare coincidence for having exact 569 genes for each set. GO terms enriched in certain genes were identified by GOstats (v.2.48.0) [78]. The ratio of spliced form in a particular transcript was obtained by using MISO (v.0.5.4) [79]. Motifs enriched in the promoter regions (-1 kb to +100 bp) of genes of interest compared to corresponding positions of background genes were identified by using AME (v.5.0.5) [80]. Given gene lists with previously discovered targets of transcription factors were compared by using WormExp (v.1.0) [40, 81]. Fifty-two previously published gene sets related to anti-PA14 immunity were collected. Global changes of certain gene sets in a comparison (treatment vs. control) were shown as normalized enrichment scores (NES) by using GSEA (v.3.0) [82]. A difference between two comparisons was defined as a relative enrichment: NES(ctrl RNAi + PA14)/ctrl RNAi−NES(stt-3 RNAi + PA14)/stt-3 RNAi. The numbers represent the differences in expression changes caused by PA14 treatment with or without stt-3 RNAi for specific gene sets. To identify gene sets significantly changed by PA14, gene sets whose FDR q value < 0.25 in any comparison were selected. R (v.3.5.3, http://www.r-project.org) was used for plotting results. Raw data and processed data are available in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo, GSE134687).

Supporting information

S1 Fig. The effects of stt-3 RNAi on the survival of worms infected with PA14 at L4 and young adult stages and pumping rates, and the schematic of stt-3(syb458) knock-in allele.

(A-B) stt-3 RNAi reduced the survival of worms infected with PA14 at the L4 (A) and young adult (B) stages. pmk-1 RNAi was used as a positive control. (C) The molecular nature of syb458 knock in mutation in stt-3. Upper part: the gene structure of C. elegans stt-3. The location of stt-3(syb458) mutation was marked with a red inverted triangle. Bottom part: the comparison of worm STT-3, yeast STT3, mouse STT3a/b and human STT3A/B protein sequences that contain conserved WWDYG motifs (marked with a black line). Black bars at the bottom indicate conservation scores of individual amino acid residues. WWDYG: Trp-Trp-Asp-Tyr-Gly. stt-3(syb458) mutation results in the substitution of 550th tyrosine to alanine that perturbs the WWDYG motif. (D) Pharyngeal pumping rates of worms treated with control or stt-3 RNAi. Error bars indicate SEM. p values were calculated by using two-tailed Student’s t-test (**p < 0.01). See S3 Table for additional repeats and statistical analysis for survival assay results in this figure.

(EPS)

S2 Fig. Enriched GO terms and xbp-1 splicing affected by stt-3 RNAi.

(A) Overrepresented GO terms of genes whose expression was decreased by stt-3 RNAi. The numbers of genes for individual terms are indicated in parentheses. (B) qRT-PCR data showing that feeding worms with stt-3 RNAi bacteria was sufficient to reduce stt-3 mRNA levels. (C-D) qRT-PCR data showing that increases in the mRNA levels of hsp-4 (C) and hsp-3 (D) by stt-3 RNAi were suppressed by xbp-1 mutations. (E) An intron retention of xbp-1 transcripts in two other sets of RNA-seq data, which are different from Fig 3G. A grey box with dotted lines indicates the location of alternative splicing. Error bars indicate SEM. p values were calculated by using two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001).

(EPS)

S3 Fig. Infection with PA14 causes broad remodeling of transcription.

(A) A principal component (PC) analysis showing relative distance between samples. (B) Overrepresented GO terms of genes down-regulated by PA14 in an stt-3-dependent manner. UPRER: ER unfolded protein response. The numbers of genes for individual terms are indicated in parentheses.

(EPS)

S4 Fig. Relationship between stt-3-independent PA14-induced genes and other immune-regulators.

A subset of genes whose expression was increased by PA14 in an stt-3-independent manner, shown in Fig 4C. The relative enrichment indicates the extent of expression changes in a gene set by PA14 infection with or without stt-3 RNAi. The numbers of genes for individual categories are indicated in parentheses. Superscript numbers indicate supplemental references that include corresponding transcriptomic data.

(EPS)

S5 Fig. ER stress does not appear to be a main cause for the susceptibility of OST-inhibited worms to PA14.

(A) Fluorescent images of hsp-4p::GFP worms. PA14 infection slightly increased the expression level of hsp-4p::GFP in control worms but substantially decreased that in worms treated with stt-3 RNAi. Scale bar indicates 500 μm. (B) Tunicamycin significantly increased the survival of wild-type (WT) worms on PA14. (C) Fluorescent images showing the effect of ER stress induced by treatment with tunicamycin on the induction of T24B8.5p::GFP reporter with or without PA14 infection. These data suggest that down-regulation of PMK-1 pathway by inhibition of OST is uncoupled by the induction of ER stress. Scale bar indicates 100 μm. See S3 Table for the additional repeats and statistical analysis for survival assay data in this figure.

(EPS)

S6 Fig. PA14 susceptibility of animals with reduced UPRER and PMK-1 signaling.

Consistent with a precious report [29], xbp-1(zc12) [xbp-1(-)] mutations did not further reduce the survival of pmk-1(km25) [pmk-1(-)] mutants on PA14. See S3 Table for additional repeats and statistical analysis for survival assay results in this figure.

(EPS)

S7 Fig. VIT-6 does not appear to affect PMK-1 pathway.

(A) Genetic inhibition of vit-6 by RNAi significantly reduced the survival of both wild-type (WT) worms and hsp-60 transgenic (hsp-60 Tg) worms to a similar extent. (B) vit-6 RNAi did not alter the expression level of T24B8.5p::GFP reporter with or without PA14 infection. Scale bar indicates 500 μm. See S3 Table for the additional repeats and statistical analysis for survival assay data in this figure.

(EPS)

S1 Table. Genetic screen data using PA14 standard slow killing assay with RNAi clones targeting non-mitochondrial genes that have mitochondrial GO terms.

S1 Table is uploaded as a separate Excel file.

(XLSX)

S2 Table. List of the proteins whose N-glycosylation levels were increased by PA14 infection in an stt-3-dependent manner.

S2 Table is uploaded as a separate word file.

(DOCX)

S3 Table. The effects of genetic inhibition of each oligosaccharyl transferase (OST) component or vit-6 on survival in various genetic backgrounds under pathogenic bacteria- or dietary E. coli-fed conditions.

S3 Table is uploaded as a separate word file.

(DOCX)

S4 Table. Genes whose expression was significantly changed by stt-3 RNAi in RNA-seq data.

S4 Table is uploaded as a separate Excel file.

(XLSX)

S5 Table. Genes whose expression was significantly changed by PA14 in an stt-3-dependent manner.

S5 Table is uploaded as a separate Excel file.

(XLSX)

Acknowledgments

We thank Drs. Dennis H. Kim and David Gems for providing some C. elegans strains. We also thank Lee lab members for helpful discussions and valuable comments on the manuscript.

Data Availability

RNA seq. raw data and processed data are available in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo, GSE134687). All other data are within the manuscript and Supporting Information files.

Funding Statement

This research was supported by grants NRF-2016R1E1A1A01941152 and NRF-2017R1A5A1015366 funded by the Ministry of Education, Science and Technology through the National Research Foundation (NRF) of Korea to S-JVL. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Roth J, Zuber C, Park S, Jang I, Lee Y, Kysela KG, et al. Protein N-glycosylation, protein folding, and protein quality control. Mol Cells. 2010;30(6):497–506. Epub 2011/02/23. 10.1007/s10059-010-0159-z . [DOI] [PubMed] [Google Scholar]
  • 2.Aebi M. N-linked protein glycosylation in the ER. Biochim Biophys Acta. 2013;1833(11):2430–7. Epub 2013/04/16. 10.1016/j.bbamcr.2013.04.001 . [DOI] [PubMed] [Google Scholar]
  • 3.Xu C, Ng DT. Glycosylation-directed quality control of protein folding. Nat Rev Mol Cell Biol. 2015;16(12):742–52. Epub 2015/10/16. 10.1038/nrm4073 . [DOI] [PubMed] [Google Scholar]
  • 4.Ohtsubo K, Marth JD. Glycosylation in cellular mechanisms of health and disease. Cell. 2006;126(5):855–67. Epub 2006/09/09. 10.1016/j.cell.2006.08.019 . [DOI] [PubMed] [Google Scholar]
  • 5.Marth JD, Grewal PK. Mammalian glycosylation in immunity. Nat Rev Immunol. 2008;8(11):874–87. Epub 2008/10/11. 10.1038/nri2417 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lyons JJ, Milner JD, Rosenzweig SD. Glycans Instructing Immunity: The Emerging Role of Altered Glycosylation in Clinical Immunology. Front Pediatr. 2015;3:54 Epub 2015/07/01. 10.3389/fped.2015.00054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Monticelli M, Ferro T, Jaeken J, Dos Reis Ferreira V, Videira PA. Immunological aspects of congenital disorders of glycosylation (CDG): a review. J Inherit Metab Dis. 2016;39(6):765–80. Epub 2016/07/10. 10.1007/s10545-016-9954-9 . [DOI] [PubMed] [Google Scholar]
  • 8.Schwarz F, Aebi M. Mechanisms and principles of N-linked protein glycosylation. Curr Opin Struct Biol. 2011;21(5):576–82. Epub 2011/10/08. 10.1016/j.sbi.2011.08.005 . [DOI] [PubMed] [Google Scholar]
  • 9.Kelleher DJ, Gilmore R. An evolving view of the eukaryotic oligosaccharyltransferase. Glycobiology. 2006;16(4):47R–62R. Epub 2005/12/01. 10.1093/glycob/cwj066 . [DOI] [PubMed] [Google Scholar]
  • 10.Mohorko E, Glockshuber R, Aebi M. Oligosaccharyltransferase: the central enzyme of N-linked protein glycosylation. J Inherit Metab Dis. 2011;34(4):869–78. Epub 2011/05/27. 10.1007/s10545-011-9337-1 . [DOI] [PubMed] [Google Scholar]
  • 11.Stevens J, Spang A. N-glycosylation is required for secretion and mitosis in C. elegans. PLoS One. 2013;8(5):e63687 Epub 2013/05/22. 10.1371/journal.pone.0063687 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kaji H, Kamiie J, Kawakami H, Kido K, Yamauchi Y, Shinkawa T, et al. Proteomics reveals N-linked glycoprotein diversity in Caenorhabditis elegans and suggests an atypical translocation mechanism for integral membrane proteins. Mol Cell Proteomics. 2007;6(12):2100–9. Epub 2007/09/01. 10.1074/mcp.M600392-MCP200 . [DOI] [PubMed] [Google Scholar]
  • 13.Zielinska DF, Gnad F, Schropp K, Wisniewski JR, Mann M. Mapping N-glycosylation sites across seven evolutionarily distant species reveals a divergent substrate proteome despite a common core machinery. Mol Cell. 2012;46(4):542–8. Epub 2012/05/29. 10.1016/j.molcel.2012.04.031 . [DOI] [PubMed] [Google Scholar]
  • 14.Irazoqui JE, Urbach JM, Ausubel FM. Evolution of host innate defence: insights from Caenorhabditis elegans and primitive invertebrates. Nat Rev Immunol. 2010;10(1):47–58. Epub 2009/12/24. 10.1038/nri2689 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cohen LB, Troemel ER. Microbial pathogenesis and host defense in the nematode C. elegans. Curr Opin Microbiol. 2015;23:94–101. Epub 2014/12/03. 10.1016/j.mib.2014.11.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ewbank JJ, Pujol N. Local and long-range activation of innate immunity by infection and damage in C. elegans. Curr Opin Immunol. 2016;38:1–7. Epub 2015/10/31. 10.1016/j.coi.2015.09.005 . [DOI] [PubMed] [Google Scholar]
  • 17.Garsin DA, Sifri CD, Mylonakis E, Qin X, Singh KV, Murray BE, et al. A simple model host for identifying Gram-positive virulence factors. Proc Natl Acad Sci U S A. 2001;98(19):10892–7. Epub 2001/09/06. 10.1073/pnas.191378698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kim DH, Ewbank JJ. Signaling in the innate immune response. WormBook. 2018;2018:1–35. Epub 2015/12/24. 10.1895/wormbook.1.83.2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hoffman C, Aballay A. Role of neurons in the control of immune defense. Curr Opin Immunol. 2019;60:30–6. Epub 2019/05/23. 10.1016/j.coi.2019.04.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Felix MA, Duveau F. Population dynamics and habitat sharing of natural populations of Caenorhabditis elegans and C. briggsae. BMC Biol. 2012;10:59 Epub 2012/06/27. 10.1186/1741-7007-10-59 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shapira M. Host-microbiota interactions in Caenorhabditis elegans and their significance. Curr Opin Microbiol. 2017;38:142–7. Epub 2017/06/18. 10.1016/j.mib.2017.05.012 . [DOI] [PubMed] [Google Scholar]
  • 22.Kim DH, Feinbaum R, Alloing G, Emerson FE, Garsin DA, Inoue H, et al. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science. 2002;297(5581):623–6. Epub 2002/07/27. 10.1126/science.1073759 . [DOI] [PubMed] [Google Scholar]
  • 23.Shapira M, Hamlin BJ, Rong J, Chen K, Ronen M, Tan MW. A conserved role for a GATA transcription factor in regulating epithelial innate immune responses. Proc Natl Acad Sci U S A. 2006;103(38):14086–91. Epub 2006/09/14. 10.1073/pnas.0603424103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Troemel ER, Chu SW, Reinke V, Lee SS, Ausubel FM, Kim DH. p38 MAPK regulates expression of immune response genes and contributes to longevity in C. elegans. PLoS Genet. 2006;2(11):e183 Epub 2006/11/14. 10.1371/journal.pgen.0020183 ; PubMed Central PMCID: PMC1635533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shivers RP, Pagano DJ, Kooistra T, Richardson CE, Reddy KC, Whitney JK, et al. Phosphorylation of the conserved transcription factor ATF-7 by PMK-1 p38 MAPK regulates innate immunity in Caenorhabditis elegans. PLoS Genet. 2010;6(4):e1000892 Epub 2010/04/07. 10.1371/journal.pgen.1000892 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Papp D, Csermely P, Soti C. A role for SKN-1/Nrf in pathogen resistance and immunosenescence in Caenorhabditis elegans. PLoS Pathog. 2012;8(4):e1002673 Epub 2012/05/12. 10.1371/journal.ppat.1002673 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Block DH, Twumasi-Boateng K, Kang HS, Carlisle JA, Hanganu A, Lai TY, et al. The Developmental Intestinal Regulator ELT-2 Controls p38-Dependent Immune Responses in Adult C. elegans. PLoS Genet. 2015;11(5):e1005265 Epub 2015/05/29. 10.1371/journal.pgen.1005265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fletcher M, Tillman EJ, Butty VL, Levine SS, Kim DH. Global transcriptional regulation of innate immunity by ATF-7 in C. elegans. PLoS Genet. 2019;15(2):e1007830 Epub 2019/02/23. 10.1371/journal.pgen.1007830 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Richardson CE, Kooistra T, Kim DH. An essential role for XBP-1 in host protection against immune activation in C. elegans. Nature. 2010;463(7284):1092–5. Epub 2010/02/26. 10.1038/nature08762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Richardson CE, Kinkel S, Kim DH. Physiological IRE-1-XBP-1 and PEK-1 signaling in Caenorhabditis elegans larval development and immunity. PLoS Genet. 2011;7(11):e1002391 Epub 2011/11/30. 10.1371/journal.pgen.1002391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Dai LL, Gao JX, Zou CG, Ma YC, Zhang KQ. mir-233 modulates the unfolded protein response in C. elegans during Pseudomonas aeruginosa infection. PLoS Pathog. 2015;11(1):e1004606 Epub 2015/01/09. 10.1371/journal.ppat.1004606 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Jeong DE, Lee D, Hwang SY, Lee Y, Lee JE, Seo M, et al. Mitochondrial chaperone HSP-60 regulates anti-bacterial immunity via p38 MAP kinase signaling. EMBO J. 2017;36(8):1046–65. Epub 2017/03/12. 10.15252/embj.201694781 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Igura M, Maita N, Kamishikiryo J, Yamada M, Obita T, Maenaka K, et al. Structure-guided identification of a new catalytic motif of oligosaccharyltransferase. EMBO J. 2008;27(1):234–43. Epub 2007/11/30. 10.1038/sj.emboj.7601940 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tan MW, Mahajan-Miklos S, Ausubel FM. Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis. Proc Natl Acad Sci U S A. 1999;96(2):715–20. Epub 1999/01/20. 10.1073/pnas.96.2.715 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tan MW, Rahme LG, Sternberg JA, Tompkins RG, Ausubel FM. Pseudomonas aeruginosa killing of Caenorhabditis elegans used to identify P. aeruginosa virulence factors. Proc Natl Acad Sci U S A. 1999;96(5):2408–13. Epub 1999/03/03. 10.1073/pnas.96.5.2408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kirienko NV, Cezairliyan BO, Ausubel FM, Powell JR. Pseudomonas aeruginosa PA14 pathogenesis in Caenorhabditis elegans. Methods Mol Biol. 2014;1149:653–69. Epub 2014/05/14. 10.1007/978-1-4939-0473-0_50 . [DOI] [PubMed] [Google Scholar]
  • 37.Denzel MS, Storm NJ, Gutschmidt A, Baddi R, Hinze Y, Jarosch E, et al. Hexosamine pathway metabolites enhance protein quality control and prolong life. Cell. 2014;156(6):1167–78. Epub 2014/03/19. 10.1016/j.cell.2014.01.061 . [DOI] [PubMed] [Google Scholar]
  • 38.Hunt-Newbury R, Viveiros R, Johnsen R, Mah A, Anastas D, Fang L, et al. High-throughput in vivo analysis of gene expression in Caenorhabditis elegans. PLoS Biol. 2007;5(9):e237 Epub 2007/09/14. 10.1371/journal.pbio.0050237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Singh J, Aballay A. Endoplasmic Reticulum Stress Caused by Lipoprotein Accumulation Suppresses Immunity against Bacterial Pathogens and Contributes to Immunosenescence. MBio. 2017;8(3). Epub 2017/06/01. 10.1128/mBio.00778-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yang W, Dierking K, Schulenburg H. WormExp: a web-based application for a Caenorhabditis elegans-specific gene expression enrichment analysis. Bioinformatics. 2016;32(6):943–5. Epub 2015/11/13. 10.1093/bioinformatics/btv667 . [DOI] [PubMed] [Google Scholar]
  • 41.Bond MR, Ghosh SK, Wang P, Hanover JA. Conserved nutrient sensor O-GlcNAc transferase is integral to C. elegans pathogen-specific immunity. PLoS One. 2014;9(12):e113231 Epub 2014/12/05. 10.1371/journal.pone.0113231 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.McEwan DL, Feinbaum RL, Stroustrup N, Haas W, Conery AL, Anselmo A, et al. Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway. BMC Biol. 2016;14(1):105 Epub 2016/12/09. 10.1186/s12915-016-0334-6 ; PubMed Central PMCID: PMC5143455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Mann FG, Van Nostrand EL, Friedland AE, Liu X, Kim SK. Deactivation of the GATA Transcription Factor ELT-2 Is a Major Driver of Normal Aging in C. elegans. PLoS Genet. 2016;12(4):e1005956 Epub 2016/04/14. 10.1371/journal.pgen.1005956 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Dineen A, Osborne Nishimura E, Goszczynski B, Rothman JH, McGhee JD. Quantitating transcription factor redundancy: The relative roles of the ELT-2 and ELT-7 GATA factors in the C. elegans endoderm. Dev Biol. 2018;435(2):150–61. Epub 2018/01/24. 10.1016/j.ydbio.2017.12.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Estes KA, Dunbar TL, Powell JR, Ausubel FM, Troemel ER. bZIP transcription factor zip-2 mediates an early response to Pseudomonas aeruginosa infection in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2010;107(5):2153–8. Epub 2010/02/06. 10.1073/pnas.0914643107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Steinbaugh MJ, Narasimhan SD, Robida-Stubbs S, Moronetti Mazzeo LE, Dreyfuss JM, Hourihan JM, et al. Lipid-mediated regulation of SKN-1/Nrf in response to germ cell absence. Elife. 2015;4 Epub 2015/07/22. 10.7554/eLife.07836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Li J, Chauve L, Phelps G, Brielmann RM, Morimoto RI. E2F coregulates an essential HSF developmental program that is distinct from the heat-shock response. Genes Dev. 2016;30(18):2062–75. Epub 2016/11/01. 10.1101/gad.283317.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zhang B, Xiao R, Ronan EA, He Y, Hsu AL, Liu J, et al. Environmental Temperature Differentially Modulates C. elegans Longevity through a Thermosensitive TRP Channel. Cell Rep. 2015;11(9):1414–24. Epub 2015/06/02. 10.1016/j.celrep.2015.04.066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kim DH, Liberati NT, Mizuno T, Inoue H, Hisamoto N, Matsumoto K, et al. Integration of Caenorhabditis elegans MAPK pathways mediating immunity and stress resistance by MEK-1 MAPK kinase and VHP-1 MAPK phosphatase. Proc Natl Acad Sci U S A. 2004;101(30):10990–4. Epub 2004/07/17. 10.1073/pnas.0403546101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Singh V, Aballay A. Heat-shock transcription factor (HSF)-1 pathway required for Caenorhabditis elegans immunity. Proc Natl Acad Sci U S A. 2006;103(35):13092–7. Epub 2006/08/19. 10.1073/pnas.0604050103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yang W, Dierking K, Rosenstiel PC, Schulenburg H. GATA transcription factor as a likely key regulator of the Caenorhabditis elegans innate immune response against gut pathogens. Zoology (Jena). 2016;119(4):244–53. Epub 2016/07/04. 10.1016/j.zool.2016.05.013 . [DOI] [PubMed] [Google Scholar]
  • 52.Bogaerts A, Beets I, Temmerman L, Schoofs L, Verleyen PJBD. Proteome changes of Caenorhabditis elegans upon a Staphylococcus aureus infection. 2010;5(1):11 10.1186/1745-6150-5-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Dierking K, Yang W, Schulenburg H. Antimicrobial effectors in the nematode Caenorhabditis elegans: an outgroup to the Arthropoda. Philos Trans R Soc Lond B Biol Sci. 2016;371(1695). Epub 2016/05/11. 10.1098/rstb.2015.0299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Grant B, Hirsh D. Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol Biol Cell. 1999;10(12):4311–26. Epub 1999/12/10. 10.1091/mbc.10.12.4311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Lee SH, Omi S, Thakur N, Taffoni C, Belougne J, Engelmann I, et al. Modulatory upregulation of an insulin peptide gene by different pathogens in C. elegans. Virulence. 2018;9(1):648–58. Epub 2018/02/07. 10.1080/21505594.2018.1433969 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Ezcurra M, Benedetto A, Sornda T, Gilliat AF, Au C, Zhang Q, et al. C. elegans Eats Its Own Intestine to Make Yolk Leading to Multiple Senescent Pathologies. Curr Biol. 2018;28(20):3352 Epub 2018/10/24. 10.1016/j.cub.2018.10.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Akiyoshi S, Nomura KH, Dejima K, Murata D, Matsuda A, Kanaki N, et al. RNAi screening of human glycogene orthologs in the nematode Caenorhabditis elegans and the construction of the C. elegans glycogene database. Glycobiology. 2015;25(1):8–20. Epub 2014/08/06. 10.1093/glycob/cwu080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Urano F, Calfon M, Yoneda T, Yun C, Kiraly M, Clark SG, et al. A survival pathway for Caenorhabditis elegans with a blocked unfolded protein response. J Cell Biol. 2002;158(4):639–46. Epub 2002/08/21. 10.1083/jcb.200203086 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Haskins KA, Russell JF, Gaddis N, Dressman HK, Aballay A. Unfolded protein response genes regulated by CED-1 are required for Caenorhabditis elegans innate immunity. Dev Cell. 2008;15(1):87–97. Epub 2008/07/09. 10.1016/j.devcel.2008.05.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Sun J, Singh V, Kajino-Sakamoto R, Aballay A. Neuronal GPCR controls innate immunity by regulating noncanonical unfolded protein response genes. Science. 2011;332(6030):729–32. Epub 2011/04/09. 10.1126/science.1203411 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Parnas O, Jovanovic M, Eisenhaure TM, Herbst RH, Dixit A, Ye CJ, et al. A Genome-wide CRISPR Screen in Primary Immune Cells to Dissect Regulatory Networks. Cell. 2015;162(3):675–86. Epub 2015/07/21. 10.1016/j.cell.2015.06.059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Sun J, Duffy KE, Ranjith-Kumar CT, Xiong J, Lamb RJ, Santos J, et al. Structural and functional analyses of the human Toll-like receptor 3. Role of glycosylation. J Biol Chem. 2006;281(16):11144–51. Epub 2006/03/15. 10.1074/jbc.M510442200 . [DOI] [PubMed] [Google Scholar]
  • 63.Komura T, Sakai Y, Honda M, Takamura T, Wada T, Kaneko S. ER stress induced impaired TLR signaling and macrophage differentiation of human monocytes. Cell Immunol. 2013;282(1):44–52. Epub 2013/05/15. 10.1016/j.cellimm.2013.04.006 . [DOI] [PubMed] [Google Scholar]
  • 64.Van den Steen P, Rudd PM, Dwek RA, Van Damme J, Opdenakker G. Cytokine and Protease Glycosylation as a Regulatory Mechanism in Inflammation and Autoimmunity In: Axford JS, editor. Glycoimmunology 2. Boston, MA: Springer US; 1998. p. 133–43. [DOI] [PubMed] [Google Scholar]
  • 65.Stiernagle T. Maintenance of C. elegans. WormBook. 2006:1–11. Epub 2007/12/01. 10.1895/wormbook.1.101.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Reddy KC, Andersen EC, Kruglyak L, Kim DH. A polymorphism in npr-1 is a behavioral determinant of pathogen susceptibility in C. elegans. Science. 2009;323(5912):382–4. Epub 2009/01/20. 10.1126/science.1166527 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Tan MW. Identification of host and pathogen factors involved in virulence using Caenorhabditis elegans. Methods Enzymol. 2002;358:13–28. Epub 2002/12/12. 10.1016/s0076-6879(02)58078-2 . [DOI] [PubMed] [Google Scholar]
  • 68.Hwang AB, Ryu EA, Artan M, Chang HW, Kabir MH, Nam HJ, et al. Feedback regulation via AMPK and HIF-1 mediates ROS-dependent longevity in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2014;111(42):E4458–67. Epub 2014/10/08. 10.1073/pnas.1411199111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Yang JS, Nam HJ, Seo M, Han SK, Choi Y, Nam HG, et al. OASIS: online application for the survival analysis of lifespan assays performed in aging research. PLoS One. 2011;6(8):e23525 Epub 2011/08/23. 10.1371/journal.pone.0023525 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Han SK, Lee D, Lee H, Kim D, Son HG, Yang JS, et al. OASIS 2: online application for survival analysis 2 with features for the analysis of maximal lifespan and healthspan in aging research. Oncotarget. 2016;7(35):56147–52. Epub 2016/08/17. 10.18632/oncotarget.11269 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, et al. SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat. Genes Dev. 2015;29(23):2490–503. Epub 2015/12/08. 10.1101/gad.266304.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Seo K, Choi E, Lee D, Jeong DE, Jang SK, Lee SJ. Heat shock factor 1 mediates the longevity conferred by inhibition of TOR and insulin/IGF-1 signaling pathways in C. elegans. Aging Cell. 2013;12(6):1073–81. Epub 2013/07/25. 10.1111/acel.12140 . [DOI] [PubMed] [Google Scholar]
  • 73.Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12(4):357–60. Epub 2015/03/10. 10.1038/nmeth.3317 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290–5. Epub 2015/02/19. 10.1038/nbt.3122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Frazee AC, Pertea G, Jaffe AE, Langmead B, Salzberg SL, Leek JT. Ballgown bridges the gap between transcriptome assembly and expression analysis. Nat Biotechnol. 2015;33(3):243–6. Epub 2015/03/10. 10.1038/nbt.3172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Risso D, Ngai J, Speed TP, Dudoit S. Normalization of RNA-seq data using factor analysis of control genes or samples. Nat Biotechnol. 2014;32(9):896–902. Epub 2014/08/26. 10.1038/nbt.2931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550 Epub 2014/12/18. 10.1186/s13059-014-0550-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Falcon S, Gentleman R. Using GOstats to test gene lists for GO term association. Bioinformatics. 2007;23(2):257–8. Epub 2006/11/14. 10.1093/bioinformatics/btl567 . [DOI] [PubMed] [Google Scholar]
  • 79.Katz Y, Wang ET, Airoldi EM, Burge CB. Analysis and design of RNA sequencing experiments for identifying isoform regulation. Nat Methods. 2010;7(12):1009–15. Epub 2010/11/09. 10.1038/nmeth.1528 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.McLeay RC, Bailey TL. Motif Enrichment Analysis: a unified framework and an evaluation on ChIP data. BMC Bioinformatics. 2010;11:165 Epub 2010/04/02. 10.1186/1471-2105-11-165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Khan A, Fornes O, Stigliani A, Gheorghe M, Castro-Mondragon JA, van der Lee R, et al. JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework. Nucleic Acids Res. 2018;46(D1):D260–D6. Epub 2017/11/16. 10.1093/nar/gkx1126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545–50. Epub 2005/10/04. 10.1073/pnas.0506580102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Dillin A, Hsu AL, Arantes-Oliveira N, Lehrer-Graiwer J, Hsin H, Fraser AG, et al. Rates of behavior and aging specified by mitochondrial function during development. Science. 2002;298(5602):2398–401. Epub 2002/12/10. 10.1126/science.1077780 . [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Danielle A Garsin, Gregory P Copenhaver

5 Sep 2019

Dear Dr Lee,

Thank you very much for submitting your Research Article entitled 'Oligosaccharyl transferase that maintains ER homeostasis enhances immunity via up-regulating p38 MAP kinase signaling in C. elegans' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review again a much-revised version. We cannot, of course, promise publication at that time.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see our guidelines.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

Danielle A. Garsin

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The authors present the argument that OST is involved in innate immunity and that it acts by regulating PMK-1 signaling. The biggest problem that I have with this argument is that the authors never conclusively prove that OST directly regulates innate immunity, at least not as it is conventionally considered.

Infection with PA14 causes ER stress by activation of the PMK-1 pathway. This is well established through the work of Dennis Kim. This activates the IRE-1/XBP-1 ER stress axis, as they note in their manuscript. Activation of this pathway stimulates the expression not only of chaperones, but also changes the expression of nuclear genes to reduce total gene expression to reduce the stress on the system. This is consistent with what has been reported in many model systems, and with what has been shown by the Kim lab in the context of PA14 infection.

But disrupting the OST system also induces ER stress, because of ER protein folding control pathways that utilize ERAD. This is not surprising; treatment of cells with tunicamycin induces ERAD and disrupting ERAD pathways and then treating with tunicamycin causes cell death, probably by overloading ER stress management pathways and inducing apoptosis, perhaps through the IRE1/XBP axis or through PERK. Indeed, it is known that members of the OST complex, when disrupted, have this exact effect. Given the absence of somatic apoptosis in C. elegans, it may not be surprising that the host succumbs to this stress, as was seen previously in Dr. Kim's work.

Instead, I think that it is more likely that the ER stress induced is simply overwhelming host stress responses and killing the worm. Admittedly, innate immunity and stress responses almost certainly have a greater relationship and overlap than their categorical considerations generally allow. Nevertheless, calling this system innate immunity, without further evidence, seems unwarranted. If the authors want to say that this is innate immunity, rather than ER stress, they should show that the effects that they've observed are specific to pathogens. (Point of fact, the observation that it doesn't seem to happen with EPEC or with E. faecalis actually undermines their claim that it is innate immunity. While I understand that innate immune processes differ, there are also consequences of infection that are not necessarily resolved by or defended against by innate immunity.) For example, the authors could show that disruption of the OST complex does not change the response to tunicamycin or some other ER stress phenotype. Alternatively, the authors could try dirupting the ERAD system via RNAi of cup-2 or hrdl-1. In any case, it isn't accurate to say that the genes are induced by OST, since this is not a transcriptional regulator. Instead, it is more accurate to say that full induction requires OST.

I hurry to note that this does nothing to make the paper less interesting. Ultimately, whether it is innate immunity or stress response will hopefully become a semantic issue, but for the time being matters are considered separate, and so accuracy is encouraged.

On a smaller scale the authors make several other claims that I have problems with. For example, they claim that VIT-6 glycosylation is increased by PA14 infection. There is no evidence presented to support this. They present an argument that VIT-6 glycosylation was decreased by stt-3 RNAi, which is not surprising, but there is insufficient information to understand how they came to that conclusion in the Materials and Methods. At the least, I missed the comparison between normal glycosylation of VIT-6 and post-infection glycosylation of VIT-6, but I think that it is absent from Supplementary Table 2.

Their slow kill data, while all consistent internally, don't make sense to me. Those assays are usually much faster. For example, 50% N2 killing at 4 days is really strange, often by that time, most of the worms are dead, especially if they are using L4 worms, which are more sensitive. For example, their colonization data are really strange. WT C. elegans by 72 h should be completely colonized by PA14 (e.g., Tan, et al. 1999; Irazoqui, et al., 2010; Twumasi-Boateng and Shapira, 2012; Kirienko, et al., 2013, etc.)

The authors should consider preparing a model figure to more graphically show their hypothesis about how this system works. They should also consider the alternative explanation. I.e., that overload of stress in the ER triggers retrograde signaling that reduces the expression of ER-targeted (or all) proteins, such as PMK-1 effectors.

Minor Issues:

VIT-6 should be hyphenated whenever it appears.

Please show a larger version of Fig 2A, perhaps even a part of the worm. It is difficult to see details in these images. This is also true for other fluorescence images, such as Fig 1C, Fig 5A, etc. It can be hard to tell correct expression from autofluorescence of dead worms, for example.

Were there 569 genes used for each anaylsis of stt-3? Was that done so that there were equal numbers in each case? I'm mostly curious, I don't think that it is a problem.

Reviewer #2: Jeong et al present a very interesting study looking at the OST protein complex on PA14 interactions and survival. This study is a nice complement from previous work from this group that investigated the role for mitochondrial function. The data is impressive and the study for the most part is well designed and I believe this work is an important contribution to the field. However, there are several issues in the presentation of the data and in several instances concerns with data interpretation and absence of followup experiments (or clarity of data). Overall I believe this work once revised will be a important to the field and readership of PLoS Gen.

Major concerns:

The authors demonstrate that loss of the stt-3 complex substantially decreased the resistance of C. elegans to PA14. But how do you reconcile potential lethality since loss of stt-3 is lethal.

More details are needed on how PA14 assays are performed since it has been demonstrated that L4 versus YA are very different responses and fast kill and slow kill responses are also different. In general, more experimental details required.

PA14 infects hosts and through secreted factor compromises health. The authors should look at potential impact of secreted factors on host health by comparing "fast-kill" and "slow-kill" assays.

The authors show that RNAi leads to accumulation of GFP labeled PA14, this should be normalized to GFP-labeled OP50 to account for RNAi impact on grinder function and bacterial clearance.

The impact of OST complex on VIT-6 is interesting, but this finding seems unfinished. Are the authors suggesting that the enhanced sensitivity is explained solely by VIT-6?

The authors use RNAi in combination with genetic mutants to infer epistasis. This is really not possible. The suggestion of parallel pathways cannot be established by these means. The authors need to use the stt-3 mutant in combination with pmk-1 mutants.

The discussion section is largely a restatement of the results. They authors should place their findings in the context of the field.

Minor comments:

The authors in several places use the word resistance when they should say sensitivity. N2 worms are never "resistant" to PA14. They eventually die, the question is how fast.

Figure 3C - many of these RNAi treatments have the potential to alter proteostasis. The authors should show RNA levels for hsp-4 also.

All Figures - the authors should define the number of genes that change in each category for enrichment.

Reviewer #3: The paper by Jeong et al provides an interesting outside-of-the-box examination of C. elegans immune responses. It demonstrates suppression of p38-dependent immune responses by disruption of ER homeostasis and ER stress. The particular driver of ER stress in this case is disruption of the oligosaccharyl transferase (OST) complex, which is required for protein glycosylation, reminiscent of the effects of the glycosylation inhibitor and popular ER stress agent tunicamycin. The authors show that genetic disruption of the OST complex affects glycosylation of three identified proteins, including VIT-6. Following OST disruption, VIT-6 becomes mislocalized, and further shows decreased induction upon P. aeruginosa strain PA14 infection. VIT-6 knock-down is sufficient to cause a significant decrease in resistance to this infection.

The results are intriguing, but leave a few questions unanswered, some of which could be addressed with simple experiments. These, as well as a few additional comments are described below:

1. Would exposure to tunicamycin also repress PA14 immune responses? This could easily be answered with the T24B8.5 reporter.

2. The authors suggest that VIT-6 may regulate immune responses. Would its knock-down be sufficient to abolish the protection conferred by the hsp-60 transgene-dependent activation of PMK-1?

3. Fig. 2A would benefit from better images. Also, what is the age of the presented worms? And what is the nature of VIT-6 milocalization? (from where to where)

Minor points:

1.“mutations in genes that act in the N-glycosylation pathway cause defects in both the innate and adaptive immune systems.” Add references.

2. Table S5 is not clear – Seems like the baseMean.ctrl_PA14_vs_ctrl_ctrl and baseMean.stt.3_PA14_vs_stt.3_ctrl columns have the same values. Better titles could help.

3. PA14 downregulated stt-3-dependent genes include some that were shown to be induced as part of a UPR in xbp-1 mutants (abu, pqn) (Urano J Cell Sci 2002), and were shown to be required for resistance to Salmonella (Haskins Plos Genet 2008). This seems to be relevant for the paper, and the authors may want to consider this.

4. Also, for the relationship between PMK-1, ATF-7 and ELT-2, the authors may want to consider Block Plos Genet 2015.

5. In discussion the authors write: ” In particular, many genes up-regulated in a PMK-1-dependent manner were induced by the OST complex upon PA14 infection.” I am not sure that this is the most accurate way to put this. How about “the OST complex is required for PMK-1-dependent gene induction in response to PA14 infection”? In the same vein, the title could be changed to: “Compromised ER homeostasis in C. elegans due to disruption of the Oligosaccharyl transferase complex suppresses p38-dependent immunity “

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Decision Letter 1

Danielle A Garsin, Gregory P Copenhaver

21 Dec 2019

* Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. *

Dear Dr Lee,

Thank you very much for submitting your Research Article entitled 'Compromised ER homeostasis by inhibition of the oligosaccharyl transferase in C. elegans suppresses p38-dependent protection against pathogenic bacteria' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic, but one reviewer identified some aspects of the manuscript that he/she thought could be further improved and we encourage you to consider his/her comments.

We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Danielle A. Garsin

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The authors have addressed all of my concerns. The manuscript is very interesting, and I can't wait to see where it goes next.

Reviewer #2: The authors have addressed my concerns

Reviewer #3: The authors have addressed my earlier comments satisfactorily. I feel that the paper is now clearer and stronger. However, the new experiments provide new insights that should be reflected in the title. In particular, results showing that tunicamycin did not compromise resistance to PA14 (Fig. S5B), together with the ability of stt-3 RNAi to further reduce PA14 resistance in xbp-1 mutants (Fig. 6), suggest that compromised ER proteostasis is not the primary cause of reduced PA14 susceptibility, and that something else associated with OST is the culprit. This should be reflected in the title, which currently ties ER proteostasis disruption to reduced infection resistance, while the new results suggest that the two phenotypes might be distinct consequences of OST disruption.

Further regarding the results in Fig. 5, saying that “ having established that the OST complex mediates the transcriptional changes caused by UPR-ER and PMK-1 signaling” (p.11, line 9) is somewhat misleading. The current phrasing implies that OST is part of the normal mechanism that regulates UPR-ER and innate immune responses, which does not seem to be the case. The phrasing may be almost true for PMK-1 signaling (although I would say that OST is required for PMK-1 signaling , rather than mediating transcription), but for UPR-ER, it is quite different, since OST disruption is what induces the UPR-ER.

Also, saying that “xbp-1 mutations further reduced the survival of stt-3 RNAi-treated worms on PA14 (Fig 6A)” is inaccurate, since RNAi does not achieve full knock out. The important results in this panel, which supports the authors’ conclusion is that stt-3 RNAi can further reduce resistance to PA14 of xbp-1 mutants.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: None

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Decision Letter 2

Danielle A Garsin, Gregory P Copenhaver

20 Jan 2020

Dear Dr Lee,

We are pleased to inform you that your manuscript entitled "Inhibition of the oligosaccharyl transferase in C. elegans that compromises ER proteostasis suppresses p38-dependent protection against pathogenic bacteria" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Danielle A. Garsin

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: 

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-19-01292R2

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

Acceptance letter

Danielle A Garsin, Gregory P Copenhaver

5 Feb 2020

PGENETICS-D-19-01292R2

Inhibition of the oligosaccharyl transferase in Caenorhabditis elegan that compromises ER proteostasis suppresses p38-dependent protection against pathogenic bacteria

Dear Dr Lee,

We are pleased to inform you that your manuscript entitled "Inhibition of the oligosaccharyl transferase in Caenorhabditis elegan that compromises ER proteostasis suppresses p38-dependent protection against pathogenic bacteria" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Matt Lyles

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. The effects of stt-3 RNAi on the survival of worms infected with PA14 at L4 and young adult stages and pumping rates, and the schematic of stt-3(syb458) knock-in allele.

    (A-B) stt-3 RNAi reduced the survival of worms infected with PA14 at the L4 (A) and young adult (B) stages. pmk-1 RNAi was used as a positive control. (C) The molecular nature of syb458 knock in mutation in stt-3. Upper part: the gene structure of C. elegans stt-3. The location of stt-3(syb458) mutation was marked with a red inverted triangle. Bottom part: the comparison of worm STT-3, yeast STT3, mouse STT3a/b and human STT3A/B protein sequences that contain conserved WWDYG motifs (marked with a black line). Black bars at the bottom indicate conservation scores of individual amino acid residues. WWDYG: Trp-Trp-Asp-Tyr-Gly. stt-3(syb458) mutation results in the substitution of 550th tyrosine to alanine that perturbs the WWDYG motif. (D) Pharyngeal pumping rates of worms treated with control or stt-3 RNAi. Error bars indicate SEM. p values were calculated by using two-tailed Student’s t-test (**p < 0.01). See S3 Table for additional repeats and statistical analysis for survival assay results in this figure.

    (EPS)

    S2 Fig. Enriched GO terms and xbp-1 splicing affected by stt-3 RNAi.

    (A) Overrepresented GO terms of genes whose expression was decreased by stt-3 RNAi. The numbers of genes for individual terms are indicated in parentheses. (B) qRT-PCR data showing that feeding worms with stt-3 RNAi bacteria was sufficient to reduce stt-3 mRNA levels. (C-D) qRT-PCR data showing that increases in the mRNA levels of hsp-4 (C) and hsp-3 (D) by stt-3 RNAi were suppressed by xbp-1 mutations. (E) An intron retention of xbp-1 transcripts in two other sets of RNA-seq data, which are different from Fig 3G. A grey box with dotted lines indicates the location of alternative splicing. Error bars indicate SEM. p values were calculated by using two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001).

    (EPS)

    S3 Fig. Infection with PA14 causes broad remodeling of transcription.

    (A) A principal component (PC) analysis showing relative distance between samples. (B) Overrepresented GO terms of genes down-regulated by PA14 in an stt-3-dependent manner. UPRER: ER unfolded protein response. The numbers of genes for individual terms are indicated in parentheses.

    (EPS)

    S4 Fig. Relationship between stt-3-independent PA14-induced genes and other immune-regulators.

    A subset of genes whose expression was increased by PA14 in an stt-3-independent manner, shown in Fig 4C. The relative enrichment indicates the extent of expression changes in a gene set by PA14 infection with or without stt-3 RNAi. The numbers of genes for individual categories are indicated in parentheses. Superscript numbers indicate supplemental references that include corresponding transcriptomic data.

    (EPS)

    S5 Fig. ER stress does not appear to be a main cause for the susceptibility of OST-inhibited worms to PA14.

    (A) Fluorescent images of hsp-4p::GFP worms. PA14 infection slightly increased the expression level of hsp-4p::GFP in control worms but substantially decreased that in worms treated with stt-3 RNAi. Scale bar indicates 500 μm. (B) Tunicamycin significantly increased the survival of wild-type (WT) worms on PA14. (C) Fluorescent images showing the effect of ER stress induced by treatment with tunicamycin on the induction of T24B8.5p::GFP reporter with or without PA14 infection. These data suggest that down-regulation of PMK-1 pathway by inhibition of OST is uncoupled by the induction of ER stress. Scale bar indicates 100 μm. See S3 Table for the additional repeats and statistical analysis for survival assay data in this figure.

    (EPS)

    S6 Fig. PA14 susceptibility of animals with reduced UPRER and PMK-1 signaling.

    Consistent with a precious report [29], xbp-1(zc12) [xbp-1(-)] mutations did not further reduce the survival of pmk-1(km25) [pmk-1(-)] mutants on PA14. See S3 Table for additional repeats and statistical analysis for survival assay results in this figure.

    (EPS)

    S7 Fig. VIT-6 does not appear to affect PMK-1 pathway.

    (A) Genetic inhibition of vit-6 by RNAi significantly reduced the survival of both wild-type (WT) worms and hsp-60 transgenic (hsp-60 Tg) worms to a similar extent. (B) vit-6 RNAi did not alter the expression level of T24B8.5p::GFP reporter with or without PA14 infection. Scale bar indicates 500 μm. See S3 Table for the additional repeats and statistical analysis for survival assay data in this figure.

    (EPS)

    S1 Table. Genetic screen data using PA14 standard slow killing assay with RNAi clones targeting non-mitochondrial genes that have mitochondrial GO terms.

    S1 Table is uploaded as a separate Excel file.

    (XLSX)

    S2 Table. List of the proteins whose N-glycosylation levels were increased by PA14 infection in an stt-3-dependent manner.

    S2 Table is uploaded as a separate word file.

    (DOCX)

    S3 Table. The effects of genetic inhibition of each oligosaccharyl transferase (OST) component or vit-6 on survival in various genetic backgrounds under pathogenic bacteria- or dietary E. coli-fed conditions.

    S3 Table is uploaded as a separate word file.

    (DOCX)

    S4 Table. Genes whose expression was significantly changed by stt-3 RNAi in RNA-seq data.

    S4 Table is uploaded as a separate Excel file.

    (XLSX)

    S5 Table. Genes whose expression was significantly changed by PA14 in an stt-3-dependent manner.

    S5 Table is uploaded as a separate Excel file.

    (XLSX)

    Attachment

    Submitted filename: Response to the reviewers_Jeong et al_120519.docx

    Attachment

    Submitted filename: Response to the reviewers_Jeong et al_011320-SJL.docx

    Data Availability Statement

    RNA seq. raw data and processed data are available in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo, GSE134687). All other data are within the manuscript and Supporting Information files.


    Articles from PLoS Genetics are provided here courtesy of PLOS

    RESOURCES