Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Sep 1.
Published in final edited form as: Cancer Res. 2020 Jan 16;80(5):929–936. doi: 10.1158/0008-5472.CAN-19-2257

SLC43A3 is a Biomarker of Sensitivity to the Telomeric DNA Damage Mediator 6-Thio-2’-Deoxyguanosine

Ilgen Mender 1, Kimberly Batten 1, Michael Peyton 2, Aishwarya Vemula 1, Crystal Cornelius 1, Luc Girard 2,4,5, Boning Gao 2,4, John D Minna 2,3,4,5, Jerry W Shay 1,*
PMCID: PMC7056593  NIHMSID: NIHMS1549965  PMID: 31948943

Abstract

Cell membrane transporters facilitate the passage of nucleobases and nucleosides for nucleotide synthesis and metabolism, and are important for the delivery of nucleoside analogues used in anti-cancer drug therapy. Here, we investigated if cell membrane transporters are involved in the cellular uptake of the nucleoside analogue DNA damage mediator 6-thio-2’-deoxyguanosine (6-thio-dG). A large panel of non-small cell lung cancer (NSCLC) cell lines (73 of 77) were sensitive to 6-thio-dG; only 4 NSCLC lines were resistant to 6-thio-dG. When analyzed by microarray and RNA sequencing, the resistant NSCLC cell lines clustered together, providing a molecular signature for patients that may not respond to 6-thio-dG. Significant downregulation of solute carrier family 43 A3 (SLC43A3), an equilibrative nucleobase transporter, was identified as a candidate in this molecular resistance signature. High levels of SLC43A3 mRNA predicted sensitivity to 6-thio-dG and therefore SLC43A3 could serve as a promising biomarker for 6-thio-dG sensitivity in NSCLC patients.

Keywords: telomerase, 6-thio-dG, drug transporter, drug resistance

Introduction

Nucleosides (nucleobase, ribose or deoxyribose) and their related nucleotides (nucleobase, ribose or deoxyribose and phosphate) are the key building blocks of DNA and RNA. The de novo materials of purine synthesis are amino acids and bicarbonate whereas the salvage pathway utilizes nucleobases from the degradation of nucleosides and nucleotides to assemble newly synthesized nucleotides. The salvage pathway saves energy for nucleotide production (1–3). Molecules such as purine nucleobases that can not permeate membranes by simple diffusion utilize biological transport systems to pass through the plasma membrane. Several solute carrier (SLC) transporters have been identified for the transport of purine nucleobases such as concentrative and facilitative transporters (sodium-dependent nucleobase transporter 1 (SNBT1/SLC23A4), equilibrative nucleoside transporter 1 (ENT1/SLC29A1, ENT2/SLC29A) and equilibrative nucleobase transporter 1 (ENBT1/SLC43A3)) [reviewed in (4)]. SLC43A3 is a member of the SLC43A family comprising two other members SLC43A1 and SLC43A2, which mediate facilitative transport of neutral amino acids (5). SLC43A3 is a nucleobase transporter involved in purine salvage pathways in mammals (6) and has a potential role in delivering the structural analogues of nucleobases, such as anti-cancer (6-thioguanine, 6-mercaptopurine) and anti-viral (acyclovir, ganciclovir) drugs (4, 7). Although acyclovir and ganciclovir (2’-deoxyguanosine analogues) lack a sugar ring, they still act as nucleosides (8). SLC43A3 is highly expressed in several embryonic epithelial tissues such as lung and liver and was also named embryonic epithelial gene 1 (EEG1) (4).

6-thio-2’-deoxyguanosine (6-thio-dG) is a modified purine nucleoside analogue prodrug that is preferentially incorporated into telomeres but only in telomerase-positive cells leading to telomere uncapping, genomic instability and cell death with minimal cytotoxic effects on telomerase-negative normal cells. Additionally, 6-thio-dG is effective and safe in mice (9, 10). Recently, we demonstrated that 6-thio-dG overcomes EGFR targeted- and platin-doublet chemotherapy resistance in NSCLC cell lines (11); therapy-resistant pediatric brain cancers (12); targeted-therapy (PLX4720 BRAF inhibitor) resistance in melanomas (13); and immunotherapy (checkpoint inhibitor) resistance in melanomas (13). In addition, 6-thio-dG in combination with gamitrinib showed improved results in “untargetable” NRAS oncogene-induced melanoma (14). Thus, there is an urgent need for additional therapeutic options for multi-drug resistant tumors. In the present preclinical studies, based on a candidate approach from transcriptomic analyses on 6-thio-dG sensitive and resistant cell lines, we tested if the SLC43A3 transporter is involved in the cellular uptake of 6-thio-dG. We found that ~95% of NSCLC cell lines tested are sensitive to 6-thio-dG and contain very high levels of SLC43A3 mRNA while resistant cells have significantly lower levels of SLC43A3 providing a potential biomarker of intrinsically resistant cell lines. Mechanistically, we found that human lung cancer cells that are resistant to 6-thio-dG expressed low mRNA levels of the SLC43A3 transporter gene. Experimental manipulation of SLC43A3 levels altered the sensitivity of cells to 6-thio-dG. In addition, treatment with increasing doses of 6-thio-dG resulted in resistance to 6-thio-dG that correlated with reduced levels of SLC43A3. In summary, SLC43A3 expression levels may predict the efficacy of 6-thio-dG in multi-drug resistant NSCLC patients.

Materials and Methods

Cell lines

The NCI and HCC series of lung cancer cell lines used in this study were obtained from the UT Southwestern Hamon Center respository. Except when noted, mycoplasma free (e-Myco kit, Boca Scientific, Boca Raton, FL) human cancer cell lines were grown in a Medium X (DMEM:199, 4:1, Hyclone, Logan, UT) supplemented with 10% cosmic calf serum (Hyclone, Logan, UT) without antibiotics and incubated with 5% CO2 at 37˚C. NSCLC and SCLC cell lines were authenticated using the Power-Plex 1.2 kit (Promega, Madison, WI) that matched the DNA fingerprint library maintained by ATCC. Patient-derived NSCLC cells were grown in RPMI-1640 (Sigma, St Louis, MO) supplemented with 5% cosmic calf serum incubated in low oxygen (2–3%) at 37°C.

Drug preparation

For in vitro studies, 6-thio-dG (Metkinen Oy, Kuopio, Finland) was dissolved in DMSO/water (1:1) to prepare 10mM stock solutions, and maintained at –20°C. A 1mM, final concentration stock was prepared for in vitro experiments and added in fresh medium at different concentrations for cell treatments. For in vivo studies, 3mg/kg 6-thio-dG was prepared in 5% DMSO (in 1xPBS) and kept frozen at –20°C.

Cell viability assay

For determination of IC50 with cell proliferation assays, a panel of human NSCLC and SCLC was screened with 6-thio-dG with a 2–4 fold dilution series in 8 different points in 96-well plates. Cells were plated 24 hours prior to addition of drug, incubated for 4 days, and assayed using the CellTiter 96® Aqueous One Solution Cell Proliferation Assay (Promega, Madison WI). Dose response curves were generated and IC50s calculated using in-house software, DIVISA or Graphpad Prism. All samples were analyzed in triplicate and standard deviations were from 2–3 independent experiments. For determination of viable cells, H1693 and H1693 SLC43A3 over expressed cells (5,000 cells/cm2) and H2087 clones (3,000 cells/cm2) were treated with 10μM 6-thio-dG for 4–7 days and then counted.

Transient siRNA experiments

For siRNA experiments, HCC4017 NSCLC cell lines were either plated in 96-well plates (3,000 cells per well) to determine cell viability or 6-well plates (200,000 cells per well) to determine knock-down efficiency. Cells were reverse-transfected with non-silencing controls (Santa Cruz Biotechnology, sc-37007) or a pool of three different siRNA duplexes targeting SLC43A3 (Santa Cruz Biotechnology, sc-96371).

sc-96371A, sense RNA sequence: 5’- CCUUCAUCCUGCAAGUGAUtt-3’, antisense RNA sequence: 5’-AUCACUUGCAGGAUGAAGGtt-3’,

sc-96371B, sense RNA sequence: 5’- CCAUCUUCACCCUCAUCAAtt-3’, antisense RNA sequence: 5’- UUGAUGAGGGUGAAGAUGGtt-3’,

sc-96371C, sense RNA sequence: 5’- GUUGCCAAGCAGAUUGAUAtt-3’, antisense RNA sequence: 5’- UAUCAAUCUGCUUGGCAACtt-3’.

Transfection siRNA complexes (70nM) were prepared using OptiMEM (Invitrogen) and RNAimax (Invitrogen). For knock-down efficiency, following 72hrs of exposure to siRNAs, cells were washed, trypsinized, counted and pelleted for RNA extraction. For cell viability assays, 48 hours after transfection, cells were treated with 6-thio-dG with a 2-fold dilution series in 18 different points in 96-well plates. 72 hours later, dose response curves were generated and IC50s calculated.

Transfection, lentivirus production and infection

SLC43A3 cDNA was inserted into pLenti6/V5_GW/lacZ (Invitrogen) and co-transfected with packaging vectors pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260) in 90% confluent 293FT cells for viral production. 10μg of plasmid DNA and 20μL of Lipofectamine 2000 (Invitrogen) were used for transfections. Supernatant lentiviral containing medium was concentrated with Lenti-X™ concentrator solution (Takara, 631231).

Reverse transcriptase and droplet digital PCR (ddPCR)

RNA was isolated using RNAeasy plus mini kit (Qiagen, 74134) and stored at –80ºC. cDNAs were synthesized using the iScript cDNA synthesis kit (Bio-Rad, 1708891) and diluted to make 10ng/μL stock and stored at −20ºC. Primers and probe sequences for ddPCR were as follows:

SLC43A3 (NM_014096.3) for human; Forward primer: AAGTGATCAGCCGCTCCTTC, Reverse primer: CCAAGTACGGCATTCCCGAT. Universal Probe Library, Probe #9 (cat.no.04685075001).

Western blot and immunohistochemistry (IHC) analysis

Total protein lysates were extracted from tissue culture cells using Pierce IP lysis buffer (Thermo Scientific #87788) supplemented with complete mini protease inhibitor cocktail (Sigma #11836153001). The protein concentration was determined using the BCA protein assay kit (Pierce). Protein (20μg) was run on SDS-PAGE gels, transferred to PVDF membranes and proteins were detected with rabbit polyclonal antibody for SLC43A3 (Atlas Antibodies, HPA030551, 1:200 dilution in 5% BSA). Protein loading was determined with antibodies against beta-actin (Sigma). Immunohistochemical analysis was performed on a Dako Autostainer Link 48 system. Briefly, the slides were baked for 20 min at 60˚C, then deparaffinized and hydrated before the antigen retrieval step. Heat-induced antigen retrieval was performed at pH 6 for 20 min in a Dako PT Link. The tissue was incubated with a peroxidase block and then an antibody incubation (1:100 dilution, Atlas Antibodies, HPA030551) for 60 min. The staining was visualized using the EnVision FLEX visualization system. Pictures were taken with Hamamatsu Nanozoomer 2.0HT by using 40X objective.

Gamma-H2AX immunofluorescence staining

Tissue sectioms (5 μM thick) were deparaffinized and hydrated before the antigen retrieval step. Heat-induced antigen retrieval was performed at pH 6 for 20 min. The tissues were incubated with blocking buffer (4% BSA in 0.1% Tween-20+PBS) for 30 min. Sections were incubated with phospho-histone H2AX antibody (1:500, Cell Signaling, cat.#9718) in blocking buffer overnight at 4˚C. Following washes with PBST, tissue sections were incubated with Alexaflour 568 conjugated goat anti-rabbit (1:500, Invitrogen, A11011) in blocking buffer at room temperature for 1 hr. Sections were washed and mounted with Vectashield mounting medium with DAPI (Vector Laboratories) and images were taken with fluorescence microscope by using 40X objective.

Gene expression differences of 6-thio-dG sensitive and resistant cell lines using microarray

Gene expression differences were determined between 40 NSCLCs (the cells that had IC50≤1.55 μM and those cells that had IC50 ≥10 μM) by microarray analysis. Briefly, approximately 5μg of total cellular RNA was isolated from each cell line and reverse transcribed into cDNA using standard techniques. The cDNA was indirectly labeled with a fluorescent probe using a two-step hybridization and labeling protocol where the gene chip (Illumina Human WG-6 V3, Cat No: BD-101–0203, BD-101–0603) was hybridized to cDNA overnight, washed stringently, and then post-stained with fluorescent dendrimers. After hybridization and washes, the gene chip was scanned using Illumina TotalPrep Kit (Ambion, Waltham, MA) and then arrays were scanned using Illumina Beadstation 500 BeadArray reader and data acquisitioned with Illumina BeadStudio for visualization and data mining.

Raw and processed data are available on GEO (accession GSE32036), http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=pfiphqkackiyubo&acc=GSE32036). Raw data was processed using default parameters of the MBCB package in R/Bioconductor. Statistically significant genes were determined using unpaired t-tests with multiple testing correction via the Bonferroni method (p<0.01).

Gene expression differences of 6-thio-dG sensitive and resistant cell lines using RNA-seq

Two independent RNAseq datasets were used for analyses. For the first dataset, raw sequencing data for 42 cell lines were mapped to the human reference genome (USCS Genome hg19) using TopHat 2.0.12 (15). Gene read counts were extracted from BAM files using HT-Seq (16). Normalization and differential gene expression analyses were performed using DESeq2 (17). The second dataset is a subset of NSCLC cell lines that were in culture during experiments (H2086, H1819, H1993, H1693, H2087 and HCC4017). RNA was extracted using Qiagen’s RNeasy plus mini kit, and sequencing was performed by GENEWIZ on Illumina HiSeq 2500 series for cell lines used in this study. Raw data was deposited on SRA (SRP131505) and processed as outlined above. Normalized counts were used to confirm that cell lines from the second RNA-seq dataset (H2086, H1819, H1993, H1693, H2087 and HCC4017) clustered with the same cell lines in the first analysis.

no symbol or _2: dataset from first RNA-seq analysis (same cell lines, replicate). *: dataset from second independent RNA-seq analysis (replicate).

(H1993, H1993_2, H1993* / H2073, H2073_2 / H1693, H1693* / H1819, H1819* / H2086, H2086* / H2087, H2087* / HCC4017, HCC4017*.

Xenograft experiment

UT Southwestern Institutional IACUC approved animal experiments (APN 2016–101375) were conducted per institutional guidelines. Athymic NCR nu/nu female mice (~6 weeks old) were used (Charles River, Wilmington, MA). 3.5×106 H2087 sensitive and acquired resistant clones were inoculated subcutaneously into the right dorsal flanks of nude mice in 100μL phosphate buffered saline (PBS). When tumors became visible (~70mm3), mice were divided into control and 6-thio-dG treatment groups. Animals were injected with 3mg/kg 6-thio-dG (intraperitoneally) five times a week for two weeks in 100μL drug solution per mouse. Tumor volumes were measured by calipers and recorded every 3–4 days. Tumor volumes were calculated by using the following formula: (length x width x height) x 0.5.

SLC43A3 expression and Kaplan–Meier survival curves

Clinical data for lung adenocarcinoma (LUAD), and expression data for all 33 cancer types represented in TCGA (https://www.cancer.gov/tcga) was downloaded using the R package TCGA2STAT (18). RNASeq2 level III RSEM data was used to generate the boxplot of SLC43A3 expression. Overall survival in patients with the highest or lowest 20% SLC43A3 expression was evaluated by Log-rank comparison of survival curves using Kaplan-Meier estimators computed using the R survival package (19).

Statistical analysis

Data are presented as mean values ± Standard Deviation (SD) for at least 2–3 replicates and significant differences between experimental conditions were determined using two-tailed unpaired t-test (****: p<0.0001). Tumor growth analyses shown as mean values ± SEM and p value determined by two-way ANOVA. Graphs and statistical analysis used GraphPad Prism software version 7.

Results

Combining mRNA expression profiles and drug response phenotypes in NSCLC lines

We determined 6-thio-dG response phenotypes across a large panel (n=77) of NSCLC lines that represent a variety of responses to clinically available drugs (Supplementary Table S1). The median IC50 of 77 NSCLC lines was 1.55μM. Therefore, we used the median IC50 (1.55μM) concentration to set the threshold for sensitive cell lines. A large proportion of NSCLC had IC50 values <1.5μM (40 NSCLC lines). Only 4 of 77 NSCLC lines exhibited IC50 values to 6-thio-dG >10μM (H1693 IC50: 40μM, H1993 IC50: 34μM, H2086 IC50: 11.5μM, H1819 IC50: 10.5μM) (Figure 1A) and 33 NSCLC lines fell in between these two groups. We confirmed the 6-thio-dG resistance of these 4 NSCLC lines by a separate assay treating the cells with 3μM 6-thio-dG every three days for 1 week, and found >50% of the cells from these 4 lines survived in this treatment. We then determined genes with differential expression by stringent filtering between 6-thio-dG sensitive and resistant NSCLCs found in both microarray and RNA-seq analyses. Mean log2 expression of SLC43A3 in RNA-seq data for sensitive NSCLC lines (IC50≤1.55uM) was 8.603, for non-responsive NSCLC lines (IC50≥10uM) was 3.256 and for NSCLC lines that fall in between two categories is 4.574 (Figure 1B, Supplementary Figures S1 and S2).

Figure 1.

Figure 1.

(A) Column scatter graph shows the IC50 values of NSCLC cells on log10 scale following 6-thio-dG treatment. IC50 values of four cell lines, H1819, H2086, H1993 and H1693, are higher (IC50˃10μM) compare to 73 cell lines tested. Thus, only 4 of 77 NSCLC cell lines are intrinsically resistant to 6-thio-dG. For further analysis, cells IC50˂1.55μM (median) and IC50˃10μM selected as sensitive and resistant group, respectively. (B) Venn diagram shows the overlap between microarray (430 genes) and RNA-seq (686) data.

Downregulation of SLC43A3 confers resistance to 6-thio-dG in NSCLC

Transcriptomic studies identified 101 genes that were differentially expressed between 6-thio-dG sensitive and resistant cell lines. We chose 10 different gene candidates based on our literature search. We included SLC29A1 (ENT1) even though it was not present in our gene signature, because it was shown that SLC29A1 plays a role in the transport of nucleoside analogues. However, when we knocked-down SLC29A1 in HCC4017 NSCLC, we did not observe a difference in the IC50 of 6-thio-dG. SLC13A3 and SLC15A3 were other candidates of the differential expressed genes that might be involved in drug transport, but they were also eliminated as candidates. Next we tested SLC43A3 (solute carrier family 43 member A3) due to its function in purine transport. SLC43A3 was significantly downregulated in 6-thio-dG resistant NSCLC lines, which nominated it as a top candidate for conferring 6-thio-dG resistance based on differences in mRNA expression and significance between resistant and sensitive cell lines. We next validated differential SLC43A3 mRNA levels in 6-thio-dG sensitive and resistant cell lines using ddPCR. We found that while Calu1, HCC4017 and HCC1359 (sensitive cell lines) had substantially higher mRNA expression of SLC43A3, there was very low or no expression in H1693, H1819, H1993 and H2086 (intrinsically resistant cell lines) (Figure 2A). We further investigated the relationship between SLC43A3 mRNA expression levels and 6-thio-dG IC50s of 16 NSCLC lines and found a negative correlation between the two variables (correlation coefficient, r = −0.756) (Figure 2B). We next functionally tested the role of SLC43A3 by siRNA knock-down in 6-thio-dG sensitive HCC4017 cells (Figure 2C), that resulted in development of resistance to 6-thio-dG. In addition, overexpressing SLC43A3 in the 6-thio-dG resistant cell line H1693 resulted in increased 6-thio-dG cell killing (Figure 2D).

Figure 2.

Figure 2.

(A) ddPCR showing SLC43A3 mRNA level in 6-thio-dG sensitive and resistant cells. (B) Negative linear relationship between SLC43A3 mRNA levels (log2 of molecules per 10ng RNA) and 6-thio-dG IC50 values (pIC50=log10(IC50×106)) in 16 NSCLCs. (C) ddPCR showing siRNA knock-down efficiency of SLC43A3 in HCC4017 NSCLCs (left panel). Knock-down of SLC43A3 in HCC4017 shifts 6-thio-dG IC50 to a higher concentration (right panel). (D) ddPCR showing overexpression efficiency of SLC43A3 in H1693 NSCLCs (left panel). Overexpression of SLC43A3 in H1693 resulting in increased 6-thio-dG sensitivity following 10μM treatment (right panel).

To establish in vitro models of lung cancer acquired resistance, we treated 6-thio-dG sensitive H2087 NSCLCs with either vehicle or 6-thio-dG (3μM) for 9–18 days and selected the clones that survived following vehicle or 6-thio-dG treatment. We then continued to passage the selected clones with vehicle or 6-thio-dG treatment until cells that could survive and grow in the present of 6-thio-dG (˃6 months) (Figure 3A). We did not observe any changes in cell morphology over the course of selection, such as epithelial-mesenchymal (EMT) transition (Figure 3B upper panels). Cells were then characterized for their drug response. While the H2087 original control clone was highly sensitive to 6-thio-dG treatment, 6-thio-dG did not kill the H2087 cells that were selected for growth in 6-thio-dG. We thus developed isogenic 6-thio-dG sensitive and resistant cell lines (Figure 3B left lower panel). We performed western blot (Figure 3B right lower panel) and ddPCR (Figure 3C left panel) analyses to test SLC43A3 protein and mRNA levels in 6-thio-dG sensitive and acquired resistant clones and found that SLC43A3 gene expression decreased 40-fold in the H2087 6-thio-dG resistant compared to the sensitive clone. To determine if 6-thio-dG resistance was reversible, 6-thio-dG treatment was stopped after 6 months treatment and cells were grown in the absence of drug for 11 weeks. After 11 weeks off 6-thio-dG, cells were still resistant and still exhibited downregulated SLC43A3 expression level (Figure 3C and 3D). Further, we compared the transcriptional profile of H2087 control and acquired resistant clones and found 154 genes that were differentially expressed by RNA-seq at p<0.01 and >2 fold change. Only 5 genes (ATP8B3, HCP5, IFITM1, SLC43A3, SYT12) came up from the overlap analysis between 154 genes and 101 differentially expressed genes and SLC43A3 was one of them (Supplementary Figure S3). Additionally, we performed xenograft experiments with H2087 sensitive and acquired resistant clones. We injected 3mg/kg 6-thio-dG five times in a week for two weeks and confirmed the sensitivity and resistance to 6-thio-dG in H2087 sensitive and acquired resistant clones, respectively (Figure 4A). H2087 acquired resistant and sensitive control tumors showed a correlation between immunohistochemistry of SLC43A3 and sensitivity to 6-thio-dG. Increased level of gamma-H2AX in 6-thio-dG treated sensitive model provided an additional evidence of mechanism based activity (Supplementary Figure S4A, B). We tested two freshly established lung tumor cell lines from lung cancer patients (HCC4150 and HCC4087) that express high SLC43A3 and validated SLC43A3 mRNA levels in these two cell lines. We then determined IC50 of 6-thio-dG in HCC4150 (<1μM) and HCC4087 (~1.5μM) and found both cell lines sensitive to 6-thio-dG (Figure 4B). We also performed immunohistochemistry in two patient-derived xenograft tumors, HCC4170 lung squamous and HCC4225 lung adenocarcinoma, which have low (expression of SLC43A3 in RNA-seq data is 0.146) and high expression (expression of SLC43A3 in RNA-seq data is 5.56). Our analysis showed a correlation between IHC and mRNA level of SLC43A3 in PDX tumors (Supplementary Figure S5). According to TCGA analyses (either with chemotherapy or without chemotherapy), low SLC43A3 expression was associated with poor prognosis and high SLC43A3 expression was associated with better prognosis (Figure 4C). However, SLC43A3 is highly expressed in lung tumors compared to most other tumor types and it may provide better therapeutic responses for patients who have high SLC43A3 expression with progressive disease (Figure 4D).

Figure 3.

Figure 3.

(A) Schematic figure shows the generation of sensitive and resistant clones. (B) Brightfield image (10X) shows the morphology of sensitive and resistant clones (upper panel). IC50 of H2087 sensitive and resistant clones (left panel). Western blot shows SLC43A3 protein levels in H2087 sensitive and acquired resistant clones. β-actin is a loading control (right panel). (C) ddPCR showing SLC43A3 gene expression level and (D) cell count in H2087 sensitive, acquired resistant and 11 week drug off clones with/without 6-thio-dG.

Figure 4.

Figure 4.

(A) Xenograft experiment in H2087 sensitive and acquired resistant clones. 3mg/kg 6-thio-dG, five times in a week for two weeks. (B) SLC43A3 mRNA level and cell viability in patient-derived cell lines. (C) Kaplan Meier plot of the highest and lowest 20% SLC43A3 expression in TCGA-LUAD. (D) Box plot of SLC43A3 expression in the 33 cancer types in TCGA.

6-thio-dG drug response of human SCLC

We determined 6-thio-dG response phenotypes across a panel of SCLCs (n=15) and investigated the relationship between SLC43A3 mRNA levels and 6-thio-dG IC50s of 15 SCLC lines and found a weaker correlation between the two variables (correlation coefficient, r = 0.0494) (Supplementary Figure S6). In addition, we did not find many genes in SCLC RNA-seq that overlapped with NSCLC. This indicates that SLC43A3 is more specific for NSCLC. Since the microarray and RNA-seq data were analyzed based on 6-thio-dG response profiles in NSCLC cell lines we expected a better correlation in NSCLCs compared to SCLCs. Additionally, some SCLC cells grow in suspension, some as adherent and some as suspension+adherent in culture. Their SLC43A3 expression profile can differ based on cell culture conditions even among SCLC cell lines.

Discussion

We used preclinical models to develop mRNA expression signatures to determine which NSCLC patients would receive the most benefit from 6-thio-dG therapy. We reasoned that these signatures could be used as future clinical inclusion/exclusion biomarkers. Our results showed that most NSCLC cells tested were highly sensitive (˂1.5μM) to 6-thio-dG showing the broad utility of 6-thio-dG. Transcriptomic analyses of the 6-thio-dG resistant NSCLC cell lines resulted in the reduced expression of SLC43A3 being responsible for 6-thio-dG resistance. Human SLC43A3 is expressed abundantly in the liver, lung, heart and ubiquitously in the pancreas, thymus, placenta and kidney (5, 6). However, these normal tissues are telomerase negative and thus 6-thio-dG is unlikely to adversely affect these tissues (9). Therefore, SLC43A3 is a useful biomarker to measure in NSCLC patients in future 6-thio-dG clinical trials.

Supplementary Material

2
3
4
5
1
6
7
8

Acknowledgements

Supported by NCI SPORE P50CA70907, the Johnson Foundation, and NIH grant C06RR30414. We acknowledge the assistance of UTSW Tissue Resource, a shared resource at the Simmons Comprehensive Cancer Center, which is supported in part by the NCI under award number 5P30CA142543 and UTSW Whole Brain Microscopy Facility in the Department of Neurology and Neurotherapeutics. The WBMF is supported by the Texas Institute for Brain Injury and Repair. We also acknowledge the CPRIT training grant, RP160157 and NCI T32 training grant CA124334 (Mender). J.W. Shay holds the distinguished Southland Financial Corporation Distinguished Chair in Geriatrics Research and is a founding scientist of Thio Therapeutics, Inc. (part of Maia Biotechnology) while other authors declare no conflicts of interest.

Footnotes

Conflict of Interest: J.W.Shay is a founding scientist of Thio Therapeutics, Inc. while other authors declare no conflicts of interest.

References

  • 1.Physiology Burnstock G. and pathophysiology of purinergic neurotransmission. Physiol Rev. 2007;87:659–797. [DOI] [PubMed] [Google Scholar]
  • 2.Murray AW. The biological significance of purine salvage. Annu Rev Biochem. 1971;40:811–26. [DOI] [PubMed] [Google Scholar]
  • 3.Lane AN, Fan TW. Regulation of mammalian nucleotide metabolism and biosynthesis. Nucleic Acids Res. 2015;43:2466–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Inoue K. Molecular Basis of Nucleobase Transport Systems in Mammals. Biol Pharm Bull. 2017;40:1130–8. [DOI] [PubMed] [Google Scholar]
  • 5.Bodoy S, Fotiadis D, Stoeger C, Kanai Y, Palacin M. The small SLC43 family: facilitator system l amino acid transporters and the orphan EEG1. Mol Aspects Med. 2013;34:638–45. [DOI] [PubMed] [Google Scholar]
  • 6.Furukawa J, Inoue K, Maeda J, Yasujima T, Ohta K, Kanai Y, Takada T, Matsuo H, Yuasa H. Functional identification of SLC43A3 as an equilibrative nucleobase transporter involved in purine salvage in mammals. Sci Rep. 2015;5:15057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Furukawa J, Inoue K, Ohta K, Yasujima T, Mimura Y, Yuasa H. Role of Equilibrative Nucleobase Transporter 1/SLC43A3 as a Ganciclovir Transporter in the Induction of Cytotoxic Effect of Ganciclovir in a Suicide Gene Therapy with Herpes Simplex Virus Thymidine Kinase. The Journal of pharmacology and experimental therapeutics. 2017;360:59–68. [DOI] [PubMed] [Google Scholar]
  • 8.Seley-Radtke KL, Yates MK. The evolution of nucleoside analogue antivirals: A review for chemists and non-chemists. Part 1: Early structural modifications to the nucleoside scaffold. Antiviral research. 2018;154:66–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mender I, Gryaznov S, Dikmen ZG, Wright WE, Shay JW. Induction of telomere dysfunction mediated by the telomerase substrate precursor 6-thio-2’-deoxyguanosine. Cancer Discov. 2015;5:82–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mender I, Gryaznov S, Shay JW. A novel telomerase substrate precursor rapidly induces telomere dysfunction in telomerase positive cancer cells but not telomerase silent normal cells. Oncoscience. 2015;2:693–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mender I, LaRanger R, Luitel K, Peyton M, Girard L, Lai TP, Batten K, Cornelius C, Dalvi MP, Ramirez M, Du W, Wu LF, Altschuler SJ, Brekken R, Martinez ED, Minna JD, Wright WE, Shay JW. Telomerase-Mediated Strategy for Overcoming Non-Small Cell Lung Cancer Targeted Therapy and Chemotherapy Resistance. Neoplasia. 2018;20:826–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sengupta S, Sobo M, Lee K, Senthil Kumar S, White AR, Mender I, Fuller C, Chow LML, Fouladi M, Shay JW, Drissi R. Induced Telomere Damage to Treat Telomerase Expressing Therapy-Resistant Pediatric Brain Tumors. Mol Cancer Ther. 2018;17:1504–14. [DOI] [PubMed] [Google Scholar]
  • 13.Zhang G, Wu LW, Mender I, Barzily-Rokni M, Hammond MR, Ope O, Cheng C, Vasilopoulos T, Randell S, Sadek N, Beroard A, Xiao M, Tian T, Tan J, Saeed U, Sugarman E, Krepler C, Brafford P, Sproesser K, Murugan S, Somasundaram R, Garman B, Wubbenhorst B, Woo J, Yin X, Liu Q, Frederick DT, Miao B, Xu W, Karakousis GC, Xu X, Schuchter LM, Mitchell TC, Kwong LN, Amaravadi RK, Lu Y, Boland GM, Wei Z, Nathanson K, Herbig U, Mills GB, Flaherty KT, Herlyn M, Shay JW. Induction of Telomere Dysfunction Prolongs Disease Control of Therapy-Resistant Melanoma. Clin Cancer Res. 2018;24:4771–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Reyes-Uribe P, Adrianzen-Ruesta MP, Deng Z, Echevarria-Vargas I, Mender I, Saheb S, Liu Q, Altieri DC, Murphy ME, Shay JW, Lieberman PM, Villanueva J. Exploiting TERT dependency as a therapeutic strategy for NRAS-mutant melanoma. Oncogene. 2018;37:4058–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature biotechnology. 2010;28:511–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31:166–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology. 2014;15:550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wan YW, Allen GI, Liu Z. TCGA2STAT: simple TCGA data access for integrated statistical analysis in R. Bioinformatics. 2016;32:952–4. [DOI] [PubMed] [Google Scholar]
  • 19.Therneau TM. GP. Modeling Survival Data: Extending the Cox Model: Springer; 2000. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

2
3
4
5
1
6
7
8

RESOURCES