Abstract
A bacterial strain named XHY-12 was isolated from corn soil samples and identified as Burkholderia sp. based on 16S rDNA sequencing, it displayed high antagonistic activity against 12 fungal pathogens and the common fungal contaminant in grain Aspergillus flavus. Plate experiment showed that XHY-12 fermentation broth reduced the incidence of S. sclerotiorum on detached rape leaves (Brassica campestris L.) by 100%, and a greenhouse experiment showed that it could promote the growth of rape seedlings with significant increases in plant height, root length, and fresh weight. Furthermore, a novel funding was the reduction of aflatoxin B1 and B2 by over 85% in 60 h, and the decomposition enzymes should be extracellular. The results suggest that XHY-12 has a potential for commercial applications as biocontrol, mycotoxin detoxification agent or biofertilizer.
Electronic supplementary material
The online version of this article (10.1007/s13205-020-2112-y) contains supplementary material, which is available to authorized users.
Keywords: Burkholderia sp. strain XHY-12, Antifungal, Plant growth promoting, Aflatoxin detoxication
Introduction
The long-term over-dependency of chemical fungicides in agriculture has led to many negative consequences including the growing tolerance and resistance of pathogen to chemical fungicides, the harmful residues in agricultural products, the more and more seriously polluted environment, etc. The subsequent problems of environmental pollution, food security, and healthy worries have aroused public attention (Wilson and Wisniewski 1989; Chapman et al.2011; Lenteren et al. 2017). Biological control is a potential strategy for lowering the deleterious effects of plant pathogens (Haas and Defago 2005; Sharma et al. 2009; Eljounaidi et al. 2016).
Soil bacteria are the main sources of microbial biocontrol agents, many of which are originated mainly from Bacillus, Pseudomonas, Agrobacterium, Streptomyces, etc. (Chin-A-Woeng et al. 2003; Fravel 2005; Höfte and Altier 2010). Specifically, some plant growth-promoting Rhizobacterias (PGPR) not only promote plant growth, but also inhibit some plant pathogens (Ben and Faina 2009; Beneduzi et al. 2012). PGPR strains and their active products are being increasingly used in agricultural formulations (Ligon et al. 2000; Liu et al. 2017; Mishra and Arora 2018).
PGPR Burkhulderia spp. common in soil, water, and rhizoshpere can control soil-borne pathogens such as Pythium spp. (Bowers and Parke 1993), Rhizoctonia solani (Homma et al. 1989), Fusarium spp. (Hebbar et al.1992), etc. by synthesizing antifungal metabolites to inhibit spore germination and hyphae growth. The two main metabolites are antibiotics and siderophores. Antibiotics such as pyrrolnitrin, phenazine, phenylpyrroles, etc. are generally attributed to the control of fungal pathogens (Roitman et al. 1990; Cartwright et al.1995; Hwang et al. 2002). Siderophores including salicylic acid, ornibactins, pyochelin, and cepabactin are implicated in biocontrol of soil-borne pathogens through microbial competition for iron (Sokol et al.1999; de los Santos-Villalobos et al.2010). Some strains might produce enzymes to decompose cell wall to control the pathogens (Jennifer and Doug 2001). Competiting for nutrition or for ecological niche, might be other mechanism choices for Burkhulderia spp. to control soil-borne pathogens (Nacamulli et al. 1997; Van et al.2000; Bevivino et al. 2005).
In this study, we isolated Burkholderia sp. strain XHY-12 from the corn rhizospheric soil and evaluated its antagonistic bacterial activity by plate confrontation test. The disease control and growth-promoting ability towards rape plants in greenhouse and the mycotoxin detoxication ability were analyzed as well. The preliminary findings aimed to lay a foundation for further exploring the mechanism of mycotoxin detoxication.
Materials and methods
Sample collection and isolation
Soil samples were collected from the corn soil in Xinhua county of Hunan province of China (27° 51′ N, 111° 25′ E, 587 m elevation). Briefly, 1 g of soil sample was placed in 99 mL of sterile water in a baffled flask, shaking at 220 r/min for 30 min, and then 1 mL of this suspension was transferred into 9 mL of fresh sterile water for dilution. The suspension was serially diluted until a 10−4 dilution, and 100 µL of the supernatant from the last three dilutions was plated on PDA plates (200 g peeled potatoes, 20 g glucose, 17 g agar, and 1 L distilled water), and incubated at 28 °C for 3 days. Single colonies were then selected and inoculated in PDA medium. The isolated strain, designated XHY-12, was stored in the laboratory of edible and medicinal vegetables of Institute of Bast Fiber Crops of the Chinese Academy of Agricultural Sciences (CAAS).
16S rDNA sequencing and phylogenetic analysis
The 16S rDNA gene sequences were amplified using extracted DNA as the template and the 16S universal forward and reverse primers were 27F/1492R (27F: AGAGTTTGATCCTGGCTCAG 1492R:CTACGGCTACCTTGTTACGA) (Lane 1991). The PCR mixture consisted of 25 µL of 2 × HF Master Mix (Tsingke, China), 2 µL each of individual primers, 1 µL of DNA template, and 20 µL of double-distilled water (ddH2O) to make up the volume to 50 µL. The reaction started at 98 °C for 2 min and then was run for 35 cycles of 98 °C for 10 s, 54 °C for 10 s, and 72 °C for 15 s, followed by a final extension step of 72 °C for 2 min. The PCR products were then sequenced by Tsingke Biotech (Changsha, China) Co., Ltd. The results of the sequencing analysis were submitted to the NCBI website and blasted for similar sequences in the GenBank Nucleotide Database.
Preparation of XHY-12 fermentation
With an inoculation needle, a loop of slant XHY-12 was transferred into 9 mL of fresh sterile water for dilution. Subsequently, the suspension was serially diluted until a 10−8 dilution, and 100 µL of the supernatant from the last three dilutions was plated on the medium. Sealed with seal film, the plates were placed upside down in the incubator at 35 °C for 24 h to get the single colonies.
A single colony was inoculated in 50 mL of liquid medium which consisted of 1.0% tryptone, 0.5% yeast extract, and 0.5% NaCl at pH7.4 in a 250-mL baffled flask, and the flasks were then incubated in a rotary shaker with stirring at 180 rpm at 35 °C for 8 h to get the activated broth. Then 2 mL of the activated broth was inoculated in 150 mL of the same liquid medium in a 500-mL baffled flask, and the flasks were then incubated on a rotary shaker with stirring at 180 rpm at 35 °C for 24 h to get the fermentation broth. 30 mL of the fermentation broth was precipitated on a centrifuge at 3000 rpm for 5 min, the bacterial precipitation was dispersed and washed in physiological saline and then precipitated two times. The final bacterial precipitation was dissolved in 30 mL physiological saline, and then 10 mL of the bacterial solution was diluted in 90 mL physiological saline to get the 100-fold diluted bacterial solution for plant growth-promotion experiment.
500 mL of the fermentation broth was lyophilized in a vacuum freeze dryer for 72 h, 0.1 g lyophilized powder was dissolved in 2 mL of sterile water, and then the dissolved solution was filtrated with 0.22-μm sterile filtration film to get the concentrated and filtrated fermentation broth for inhibiting the growth of A. flavus.
Antifungal activity bioassay
Thirteen fungal pathogens were as follows: Sclerotinia sclerotiorum, Phytophthora capsici and other nine fungal pathogens originating from fusarium wilt of cucumber and watermelon, white rust of radish, white rot of pepper, seeding blight of flax, anthrax of flax, damping-off disease of tomato, soft rot of pear, and stem rot of kiwifruit were provided by the laboratory of plant protection of Institute of Bast Fiber Crops of the Chinese Academy of Agricultural Sciences (CAAS), Fusarium graminearum (no. ACCC37682) was provided by the Agricultural Culture Collection of China (ACCC), and Aspergillus flavus which was isolated from mildewed peanuts and stored in the laboratory of edible and medicinal vegetables of Institute of Bast Fiber Crops of the Chinese Academy of Agricultural Sciences (CAAS). All the fungal pathogens were stored on PDA slant medium.
One fungal hyphal piece cut from slant medium was incubated on a PDA plate at 28 °C for 4 days to get the activated fungal hyphae. One activated hyphal piece with a 15-mm diameter was put in the hole which was punched in the middle of a PDA medium plate first and the plate was as the control. Another activated hyphae piece was placed in another plate and two single colonies of XHY-12 were then inoculated on both sides of the hyphae piece, respectively, and this plate was as the treatment. Sealed with the seal film, the plates were placed upside down in the incubator, culturing at 28 °C for 5–6 days and the inhibition diameter was calculated. Each treatment was repeated in triplicate. The inhibition rate was calculated using the following formula: (control diameter-inhibition diameter)/control diameter × 100%.
About 10 mL of the melted PDA medium was poured into a plate to form the low layer, and once the medium was solidified, 20 mL melted PDA medium was poured into the plate to form the up layer. Once the up layer medium was solidified, three holes with 15-mm diameter were punched on the two-layer PDA plate, one was in the middle, and the other two were 2 cm beside the middle hole, respectively. The depth of hole was just to the bottom of the up layer medium and the low layer medium could not be destroyed. One A. flavus hyphae piece with 15-mm diameter was put in the middle hole in a two-layer PDA plate, and 0.4 mL of the concentrated and filtrated fermentation broth was dropped in the two holes bedside the middle hole, respectively. Sealed with the seal film, the plates inoculated together with A. flavus hyphae piece and the concentrated and filtrated fermentation broth were placed upside down in the incubator, culturing at 28 °C for for 5–6 days to calculate the inhibition diameter. Each treatment was repeated in triplicate.
Aflatoxins decomposition
Two pieces of wet filter papers were put in a plate, ten peanuts were placed on the filter paper, and after being sterilized by steam, two plates of such treatment (marked as plate A and B) were prepared. Each peanut in plate A was inoculated with one loop of A. flavus spores. Each peanut in plate B was covered with one drop of XHY-12 fermentation broth, and then one loop of A. flavus spores was inoculated on each peanut. Sealed with seal film, the two plates were placed in the incubator, culturing at 28 °C for 4 days to evaluate the inhibition of XHY-12 against the infection of A. flavus on peanuts.
The 100 g peanuts were put in a 500-mL baffled flask, which were immersed by the tap water with the full coverage of water to the peanuts overnight at 4 °C and the redundant water was dumped. Overall, twelve baffled flasks of such treatment were prepared. After being sterilized by steam, a treated baffled flask was added with 150 mL of XHY-12 fermentation broth, shaking on a rotary shaker for 30 min and then dried in an oven dryer at 105 °C. Finally, the dried peanuts were powdered in a grinder. The flask was treated in triplicate and formed the Group CK. Each of the other nine flasks was inoculated with A. flavus spore pieces with the size of 2 cm × 2 cm, shaking on a rotary shaker to disperse the spores. After being cultured for 96 h at 28 °C, these nine baffled flasks were divided into three groups, namely Group 1, Group 2 and Group 3, each group was set triplicates. Each baffled flask of Group 1 was added with 150 mL of sterile water, shaking on a rotary shaker for 30 min, and then dried in an oven dryer at 105 °C, finally powered in a grinder. Each baffled flask of Group 2 and Group 3 was inoculated with 150 mL of XHY-12 fermentation broth, culturing at 35 °C, 150 rpm for 24 h and 60 h, then dried at 105 °C, finally powered in a grinder. All the peanut samples were sent to Pony Testing International Group Co. Ltd (Beijing, China) to determine aflatoxin B1, B2, G1, and G2 by high-performance liquid chromatography (HPLC) with post-column derivatization.
The methods of aflatoxin B1 (AFB1) decomposition were designed according to Teniola (Teniola et al.2005), the 24-h cultured fermentation broth was centrifuged at 4 °C, 8000 r/min (Sigma 3k15, Germany) for 15 min to collect the supernatant and cells, and then the cells were washed twice in phosphate buffer (67 mM; pH 7.0). The washed cells were resuspended in phosphate buffer (3 mL buffer per gram cell mass) in preparation for cell rupture on an ultrasonic cell disruption system (DH92-IIN, Ningbo, China). The broken cell suspension was centrifuged at 4 °C, 12,000 rpm (Microfuge 20R, America) for 20 min, the supernatant from the centrifugation step was filtered aseptically using sterile filter membrane of 0.2-μm pore size (Jinteng, China) to get the intracellular liquid. AFB1 (Sigma, Germany) was added in the fermentation broth, supernatant, cells suspension and intracellular liquid, and the final concentrations of AFB1 were 2.5 μg/mL, AFB1 was added in phosphate buffer as a blank control. All the treatments were incubated in dark at 37 °C, 150 r/min for 72 h, and the AFB1 residual was detected under the designation of the ELISA kit (Helica, America).
Disease control
Sixty plastic pots were filled with the 9:1 ratio of nutrient soil and vermiculite. The 3–5 seeds were sowed, covered (0.5-cm thickness), and cultured in a greenhouse. The redundant seedlings were removed after the showering up of the first pair of leaves and only one seedling was left in each pot. The 30 pots were prepared for disease control experiment and the other 30 pots were prepared for growth promotion experiment.
After 4–5 leaves grew up, one leaf was cut down with a sterile knife from each seedling. Overall, 30 leaves were collected. Each leaf was placed on two pieces of wet filter papers which were placed in a sterile plate first. One hyphae piece of S. sclerotiorum which is the pathogen of sclerotinia stem rot of canola disease was put on each leaf, with the side of hyphae attached to the leaf. Each hyphae piece on 15 leaves was covered with 1 drop of XHY-12 fermentation broth. Each hyphae piece on the other 15 leaves was covered with 1 drop of sterile water. The plates were placed in an illumination incubator for 1 week at 26 °C, 12 h light, and 12 h darkness alternatively to investigate the capability of XHY-12 against the disease in plates.
After the leaves were cut down, the leaves of these 30 seedlings were inoculated with one hyphae piece of S. sclerotiorum. Each hyphae piece on 15 seedling leaves was covered with 1 drop of XHY-12 fermentation broth, and each hyphae piece on the other 15 seedling leaves was covered with 1 drop of sterile water. The pots were placed in a greenhouse for 2 weeks at 26 °C, 12 h light, and 12 h darkness alternatively to investigate the capability of XHY-12 against sclerotinia stem rot of canola in pots.
Plant growth promotion
After 2 ± 3 leaves grew up, the seedling roots in 15 pots were irrigated with the 100-fold diluted bacterial solution as follows: 1 mL for each pot first, 2 mL after 10 days, and another 2 mL after 20 days were conducted. The other 15 pots were irrigated with physiological saline as control treatment. If necessary, a moderate amount of sterile water was irrigated to keep the soil humidity. All the pots were placed in a greenhouse for 40 days at 26 °C, 12 h light, and 12 h darkness alternatively. After 40 days, the seedlings were dug up carefully, the roots were washed to remove soil, and fresh weight, plant height, and root length were measured as indicators of plant growth. The plant growth promotion efficacy was rated using the method described by Abdallah et al. (2016).
Data analysis
Statistical analysis was performed using analysis of variance in SPSS software 13.0 (IBM Corp, Armonk, NY, USA), significant differences between groups were compared using Fisher’s protected least-significant difference test at P = 0.05. A P value of < 0.05 was considered statistically significant.
Results
Identification and characterization of XHY-12
The bacterial strain which was isolated from the corn soil in Xinhua county of Hunan province of China was identified using PCR amplification and 16S rDNA analysis, and a 1417-bp fragment was obtained. The sequence data were submitted to GenBank, and a nucleotide accession number MN630837 was assigned. We compared its sequence with those of others in the GenBank database and found that XHY-12 was closely related to the Burkholderia sp. strains with 99% similarity (Figs. S1 and S2). We temporarily named this strain as Burkholderia sp. strain XHY-12.
In vitro screening of antagonistic activity
To test the antagonistic activity of XHY-12, we subjected 12 fungal pathogens and A. flavus for plate confrontation tests. Strain XHY-12 exhibited strong antagonistic activity towards all the fungi. Because there were nine pathogens which were not identified clearly, we only described the results of three typical fungal pathogens, namely S. sclerotiorum, P. capsici and F. graminearum, and A. flavus. The inhibition effect of single colony on the four fungi and the concentrated and filtrated fermentation broth on A. flavus were determined using the mycelial growth rate method. The inhibition rate was 67.75%, 65.68%, 56.17%, 43.17%, and 38.65% (Table 1). Strain XHY-12 had a wide inhibition capability against fungal pathogens (Figs. 1 and S3).
Table 1.
Prohibition rate of the four fungal pathogens by strain XHY-12 and its concentrated and filtrated fermentation broth
| Fungal pathogens | Prohibition rate of mycelium growth (%) |
|---|---|
| S. sclerotiorum | 67.75 ± 1.83 |
| P. capsici | 65.68 ± 2.08 |
| F. graminearum | 56.17 ± 1.52 |
| Aspergillus flavus | 43.17 ± 1.36 |
| Aspergillus flavus* | 38.65 ± 1.07 |
*Meant that Aspergillus flavus was prohibited by the concentrated and filtrated fermentation broth of strain XHY-12
Fig. 1.

Plate confrontation tests of strain XHY-12 against four fungi. a1S. sclerotiorum; a2 prohibition of strain XHY-12 against S. sclerotiorum. b1P. capsicin; b2 prohibition of strain XHY-12 against P. capsici. c1F. graminearum; c2 prohibition of strain XHY-12 against F. graminearum. d1A. flavus; d2 prohibition of strain XHY-12 against A. flavus. d3 Prohibition of the concentrated and filtrated fermentation broth of strain XHY-12 against A. flavus
Evaluation of aflatoxin decomposition
The peanuts which were inoculated with A. flavus spores culturing for 4 days were completely covered by thick hyphae and spores (Fig. 2a), the peanuts which were covered first with XHY-12 fermentation broth and then inoculated with A. flavus spores, being cultured for 4 days, were clear with no hyphae and spores (Fig. 2b). The results showed that the inoculation of XHY-12 fermentation broth could inhibit evidently the infection of A. flavus (Fig. 2).
Fig. 2.

Protection of peanuts covered with XHY-12 fermentation drops from the infection of A. flavus. a Peanuts inoculated with A. flavus spores, culturing for 4 days (control). b Peanuts covered with XHY-12 fermentation drops and then inoculated with A. flavus spores, culturing for 4 days
Being infected with A. flavus for 96 h, the peanuts were covered by thick hyphae and spores (Fig. 3 baffled flask B), and the 96-h infected peanuts were then inoculated with XHY-12 fermentation broth for 24 h and 60 h, the hyphae and spores seemed to be disappeared (Fig. 3 baffled flask A). With 4.51 μg/kg of AFB1 and 1.00 μg/kg of AFB2, the peanut samples had been slightly infected by A. flavus (Table 2, Group CK). After being inoculated with A. flavus hyphae pieces and being cultured for 96 h, the aflatoxins all increased significantly. AFB1 was up to 327 μg/kg, aflatoxin B2 was up to 38.6 μg/kg and aflatoxin G2 was up to 1.76 μg/kg, (Table 2, Group 1). Compared with Group CK, the severely infected peanuts were inoculated with XHY-12 fermentation broth and being cultured for 24 h, the aflatoxins decreased slightly, and the decomposition rate of AFB1 was 7.95%, AFB2 was 38.34%, and AFG2 was 69.89% (Table 2, Group 2). The decomposition rate of AFB1 was much slower than of the other aflatoxins within 24 h. Compared with Group CK, after being inoculated with XHY-12 fermentation broth and cultured for 60 h, the aflatoxins decreased significantly, and the decomposition rate of AFB1 was 85.20%, AFB2 was 88.39% and AFG2 was 83.64% (Table 2, Group 3). AFB1 in the peanuts of Group 3 which was decomposed with XHY-12 for 60 h was 48.4 μg/kg. There was no afltoxin G1 determined in all the samples.
Fig. 3.

Decomposition comparison of A. flavus with strain XHY-12 on peanuts. a Peanuts inoculated with A. flavus spores for 96 h and then inoculated with XHY-12 for 60 h; b peanuts inoculated with A. flavus spores for 96 h (control)
Table 2.
Effect of XHY-12 fermentation broth on aflatoxin decomposition
| Aflatoxins | Group CK (μg/kg) | Group 1 (μg/kg) | Group 2 (μg/kg) | Group3 (μg/kg) |
|---|---|---|---|---|
| Aflatoxin B1 | 4.51 | 327 | 301 | 48.4 |
| Aflatoxin B2 | 1.00 | 38.6 | 23.8 | 4.48 |
| Aflatoxin G1 | 0.00 | 0.00 | 0.00 | 0.00 |
| Aflatoxin G2 | 0.00 | 1.76 | 0.53 | 0.29 |
Group CK, peanuts added in with XHY-12 fermentation broth, no culturing; Group 1, peanuts inoculated with A. flavus spores, culturing for 96 h; Group 2, peanuts inoculated with A. flavus spores, culturing for 96 h and then inoculated with XHY-12, culturing for 24 h; Group 3, peanuts inoculated with A. flavus spores, culturing for 96 h and then inoculated with XHY-12, culturing for 60 h
Being added in with aflatoxin B1 and cultured for 72 h, the fermentation broth showed the highest AFB1 degradation rate of 77.26%, the supernatant ranked the second of 57.51%. However, the degradation rate of the cells suspension was below 10%, and the intracellular liquid had hardly degradation capability (Fig. 4).
Fig. 4.

Columns of AFB1 decomposition rate of XHY-12 fermentation broth, supernatant, cells suspension and intracellular liquid
Evaluation of effect against sclerotinia stem rot of canola in rape leaves
Being inoculated with hyphae pieces of S. sclerotiorum, and then covered with XHY-12 fermentation broth drops, culturing for 4 days, each detached rape leaf showed a green healthy condition, no disease spots were seen on the leaves (Fig. 5a). However, severe disease spots were seen on each leave which were inoculated only with the hyphae pieces of S. sclerotiorum, some leaves were fully ruined showing dark yellow (Fig. 5b). Accordingly, the rape plant leaves which were inoculated with the hyphae pieces of S. sclerotiorum, were then covered with XHY-12 fermentation broth drops and cultured for 2 weeks had no disease spots (Fig. 6a). However, rape plant leaves inoculated only with the hyphae pieces of S. sclerotiorum showed dark yellow disease spots (Fig. 6b). Compared with the detached leaves in plates (Fig. 5b), the disease spots on the rape plant leaves in pots were much smaller, and the disease spots only grew around the hyphae pieces and no full leaves were infected and ruined (Fig. 6b).
Fig. 5.
Control of XHY-12 against sclerotinia stem rot of canola in detached rape leaves. a Detached rape leaves inoculated with the hyphae pieces of S. sclerotiorum and then covered with XHY-12 fermentation broth drops. b Detached rape leaves inoculated with the hyphae pieces of S. sclerotiorum (control)
Fig. 6.
Control of XHY-12 against sclerotinia stem rot of canola in rape plant leaves. a Rape plant leaves inoculated with the hyphae pieces of S. sclerotiorum and then covered with XHY-12 fermentation broth drops. b Rape plant leaves inoculated with the hyphae pieces of S. sclerotiorum (control)
Effects of plant growth promoting on rape plants
The capability of XHY-12 of promoting rape plant growth was tested under greenhouse conditions. Strain XHY-12 exhibited an obvious growth promotion for rape seedlings. Compared with the control treatments which were irrigated with physiological saline (Fig. 7a), rape seedlings irrigated with the 100-fold diluted bacterial solution had well-developed root systems and faster overall plant growth (Fig. 7b). Compared with the control treatment of which plant height was 32.37 cm, root height was 12.94 cm and fresh weight was 13.35 g, the rape seedlings treated with the 100-fold diluted bacterial solution resulted in extremely significant increase in plant height (37.07 cm), root height (14.67 cm) and fresh weight (15.90 g), suggesting the increase of 14.53%, 13.29% and 19.11%, respectively (Table 3).
Fig. 7.
Effect of strain XHY-12 on the development of rape seedlings under greenhouse conditions. a Rape seedlings treated with sterile physiological saline (control). b Rape seedlings treated with 100-fold diluted bacterial solution
Table 3.
Effect of XHY-12 fermentation broth on rape plants grown under greenhouse conditions
| Treatment | Plant height (cm) | Root height (cm) | Fresh weight (g) |
|---|---|---|---|
| Control | 32.37 ± 1.30a | 12.94 ± 1.00a | 13.35 ± 0.68a |
| XHY-12 (2 ×) | 37.07 ± 0.98b | 14.67 ± 0.74b | 15.90 ± 0.75b |
a and b, values with different superscript letters indicate extremely significant difference (p < 0.05)
Discussion
Strain XHY-12 isolated in this paper was closely related to the Burkholderia sp. strains with 99% similarity and it is hard to distinguish between the species only based on 16S rDNA sequence analysis (Miller et al. 2002; Tabacchioni et al. 2002; Coenye and Vandamme 2003). Hence we temporarily named this strain as Burkholderia sp. strain XHY-12.
Strain XHY-12 in our study showed high antagonistic activities against 12 fungal pathogens including S. sclerotiorum, P. capsici, F. graminearum etc., it could also inhibit the growth of common fungal contaminant in grains A. flavus and its concentrated and filtrated fermentation broth can also inhibit the growth of A. flavus. According to the size of inhibition zones and the inhibition rate of mycelium growth, the inhibition capability of the concentrated and filtrated fermentation broth was very close to the single colony when inhibiting A. flavus, which demonstrated that the fermentation broth contained antagonistic components. The inhibition capability of the single colony against A. flavus was much weaker than it against the three fungal pathogens, which might be that the growth of A. flavus was faster than that of the three fungal pathogens. A large amount of visible spores were on the mycelia of A. flavus and no visible spores were on the mycelia of the three fungal pathogens on PDA medium. It might be more difficult for strain XHY-12 to inhibit A. flavus than to inhibit the other three fungal pathogens.
Burkholderia spp. has a unique metabolic capacity of decomposing soil and groundwater contaminants such as phthalates, chlorinated hydrocarbons, tricholorethylene (Shields and Reagin 1992; Saint and Romas 1996; Gina and Shreve 1999), etc. In our study, we found that Burkhulderia spp. had the ability of decomposing aflatoxins, and the decreasing rate of AFB1 and B2 was beyond 85% within 60 h. To the best of our knowledge, this is the first report that a single Burkholderia spp. strain has the ability to decompose mycotoxins. AFB1 in the peanuts which was inoculated with A. Flavus spore pieces for 96 h, and then decomposed with XHY-12 for 60 h was 48.4 μg/kg, which was about two times of the lowest allowed content of 20 μg/kg in animal feed materials (2002/32/EC). The high AFB1 decomposition rate of the fermentation broth and supernatant demonstrated that strain XHY-12 could take use of AFB1 as carbon source, and the metabolites which could decompose aflatoxin B1 were in the supernatant, and the results of plate confrontation tests with concentrated and filtrated fermentation broth against A. flavus also seemed to demonstrate the conclusion. The low AFB1 decomposition rate of the cell suspension and intracellular liquid demonstrated that the metabolites should be extracellular enzymes. Whether strain XHY-12 could decompose other mycotoxin needs to develop more researches. The decomposing pathway, especially the involved genes, enzymes, and enzymatic products, also needs to be further discovered.
Strain XHY-12 could obviously inhibit the infection of S. sclerotiorum on detached rape (B. campestris L.) leaves with the reduction incidence of 100% in plates. Compared with the detached leaves in plates, the disease spots on the rape plant leaves in pots were much smaller, and the disease spots only grew around the hyphae pieces and no full leaves were infected and ruined. It can be ascribed to the plates which keep a high and steady humidity than the pots, leading to a better growth for the hyphae, and in turn, the healthy plant might have a capability of self-defense against pathogenic infection. There is a phenomenon that some strains show excellent biological control capabilities under greenhouse conditions other than under a field condition (Paulitz and Bélanger 2001; Serfling et al. 2007). More practical applications in the field to explore the control efficacy for strain XHY-12 will be conducted at the next steps.
Strain XHY-12 could improve the growth of rape seedlings with significant increase in plant height, root length, and fresh weight under a greenhouse condition. The main effective approaches of promoting plant growth for most PGPR strains are to synergize indole acetic acid (IAA) and siderophore, fix nitrogen, and solubilize phosphates (Minerdi et al. 2001; Garau et al. 2009; Ramesh et al. 2013; Liu et al. 2017). Correspondingly, the performance of promoting plant growth is beneficial for increasing the immune capability against pathogen infection. The mechanism of Burkhulderia sp. strain XHY-12 in our study to promote rape plant growth needs to be further explored.
These results were obtained under a controlled greenhouse conditions, it might be uncertain that the strain would be applied practically to control pathogen infection, to promote plant growth in the field and to decompose mycotoxins in the infected grains. Therefore, more practical applications and the mechanism researcher will be planned to execute in the future. The results might lay a foundation for exploring the pathogen control, plant growth promotion, and new mycotoxin detoxication agents.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We would like to acknowledge the Chinese Academy of Agricultural Sciences (CAAS) for funding this work (the Project No. 1610242018033). And also we thank Tsingke Biotech Co., Ltd. (Changsha, China) for sequencing the PCR products of 16S rDNA gene sequences.
Author contributions
XY and XC designed and conducted the work. ZS, XZ, and JZ finished the experiment including lab work, data analysis, and manuscript writing. SM corrected and approved the final manuscript.
Compliance with ethical standards
Conflict of interest
No conflict of interest was declared.
Contributor Information
Xiai Yang, Email: yangxiai@caas.cn.
Xiaojun Chen, Email: yangxiai@caas.cn.
Zhiqiang Song, Email: 623486365@qq.com.
Xiaowei Zhang, Email: 402656682@qq.com.
Jifang Zhang, Email: 408718544@qq.com.
Shiyong Mei, Email: hbvegbt@163.com.
References
- Abdallah RAB, Tlili SM, Nefzi A, Khiareddine HJ, Remadi MD. Biotcontrol of Fusarium wilt and growth promotion of tomato plants using endophytic bacteria isolated from Nicotianaglauca organs. Biol Control. 2016;97:80–88. doi: 10.1016/j.biocontrol.2016.03.005. [DOI] [Google Scholar]
- Ben L, Faina K. Plant growth promoting rhizobacteria. Annu Rev Microbiol. 2009;1:541–556. doi: 10.1146/annurev.micro.62.081307.162918. [DOI] [PubMed] [Google Scholar]
- Beneduzi A, Ambrosini A, Passaglia LMP. Plant growth-promoting rhizobacteria (PGPR): their potential as antagonists and biocontrol agents. Genet Mol Biol. 2012;35:1044–1051. doi: 10.1590/S1415-47572012000600020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bevivino A, Peggion V, Chiarini L, Tabacchioni S, Cantale C, Dalmastri C. Effect of Fusarium verticillioides on maize-root-associated Burkholderia cenocepacia populations. Res Microbiol. 2005;156:974–983. doi: 10.1016/j.resmic.2005.05.007. [DOI] [PubMed] [Google Scholar]
- Bowers JH, Parke JL. Epidemiology of Pythium damping-off and Aphanomyces root rot of peas after seed treatment with bacterial agents for biological control. Phytopathology. 1993;83:1466–1473. doi: 10.1094/Phyto-83-1466. [DOI] [Google Scholar]
- Cartwright DK, Chilton WS, Benson DM. Pyrrolnitrin and phenazine production by Pseudomonas cepacia, strain 5.5B, a biocontrol agent of Rhizoctonia solani. Appl Microbiol Biotechnol. 1995;43:211–216. doi: 10.1007/BF00172814. [DOI] [Google Scholar]
- Chapman KS, Sundin GW, Beckerman JL. Identification of resistance to multiple fungicides in field populations of Venturia inaequalis. Plant Dis. 2011;95:921–926. doi: 10.1094/PDIS-12-10-0899. [DOI] [PubMed] [Google Scholar]
- Chin TFC, Woeng A, Bloemberg GV, Lugtenberg BJ. Phenazines and their role in biocontrol by Pseudomonas bacteria. New Phytol. 2003;157:503–523. doi: 10.1046/j.1469-8137.2003.00686.x. [DOI] [PubMed] [Google Scholar]
- Coenye T, Vandamme P. Diversity and significance of Burkholderia species occupying diverse ecological niches. Environ Microbiol. 2003;5:719–729. doi: 10.1046/j.1462-2920.2003.00471.x. [DOI] [PubMed] [Google Scholar]
- de los Santos-Villalobos S, Barrera-Galicia GC, Miranda-Salcedo MA, José Peña-Cabriales J. Burkholderia cepacia XXVI siderophore with biocontrol capacity against Colletotrichum gloeosporioides. World J Microb Biotechnol. 2012;28:2615–2623. doi: 10.1007/s11274-012-1071-9. [DOI] [PubMed] [Google Scholar]
- Directive 2002/32/EC of the European parliament and of the council. On undesirable substances in animal feed. Section II: Mycotoxins
- Eljounaidi K, Lee SK, Bae H. Bacterial endophytes as potential biocontrol agents of vascular wilt diseases—review and future prospects. Biol Control. 2016;103:62–69. doi: 10.1016/j.biocontrol.2016.07.013. [DOI] [Google Scholar]
- Fravel DR. Commercialization and implementation of biocontrol. Annu Rev Phytopathol. 2005;43:337–359. doi: 10.1146/annurev.phyto.43.032904.092924. [DOI] [PubMed] [Google Scholar]
- Garau G, Yates RJ, Deiana P, Howieson JG. Novel strains of nodulating Burkholderia have a role in nitrogen fixation with papilionoid herbaceous legumes adapted to acid, infertile soils. Soil Biol Biochem. 2009;41:125–134. doi: 10.1016/j.soilbio.2008.10.011. [DOI] [Google Scholar]
- Gina S, Shreve S. Biodegradation kinetics of trichloroethylene and 1, 2-dichloroethane by Burkholderia (Pseudomonas) cepacia PR131 and Xanthobacter autotrophicus GJ10. Int Biodeter Biodegr. 1999;43:57–61. doi: 10.1016/S0964-8305(98)00069-9. [DOI] [Google Scholar]
- Haas D, Defago G. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat Rev Microbiol. 2005;3:307–319. doi: 10.1038/nrmicro1129. [DOI] [PubMed] [Google Scholar]
- Hebbar KP, Atkinson D, Tucker W, Dart PJ. Suppression of Fusarium moniliforme by maize root-associated Pseudomonas cepacia. Soil Biol Biochem. 1992;24:1009–1020. doi: 10.1016/0038-0717(92)90029-W. [DOI] [Google Scholar]
- Höfte M, Altier N. Fluorescent pseudomonads as biocontrol agents for sustainable agricultural systems. Res Microbiol. 2010;161:464–471. doi: 10.1016/j.resmic.2010.04.007. [DOI] [PubMed] [Google Scholar]
- Homma Y, Sato Z, Hirayama F, Konno K, Shirahama H, Suzui T. Production of antibiotics by Pseudomonas cepacia as an agent for biological control of soilborne plant pathogens. Soil Biol Biochem. 1989;21:723–728. doi: 10.1016/0038-0717(89)90070-9. [DOI] [Google Scholar]
- Hwang J, Chilton WS, Benson DM. Pyrrolnitrin production by Burkholderia cepacia and biocontrol of Rhizoctonia stem rot of poinsettia. Biol Control. 2002;25:56–63. doi: 10.1016/S1049-9644(02)00044-0. [DOI] [Google Scholar]
- Jennifer LP, Doug GS. Diversity of the Burkholderia cepacia complex and implications for risk assessment of biological control strains. Annu Rev Phytopathol. 2001;39:225–258. doi: 10.1146/annurev.phyto.39.1.225. [DOI] [PubMed] [Google Scholar]
- Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M, editors. Nucleic acid techniques in bacterial systematics. Chichester: Wiley; 1991. pp. 115–175. [Google Scholar]
- Lenteren JCV, Bolckmans K, Köhl J, Ravensberg WJ, Urbaneja A. Biological control using invertebrates and microorganisms: plenty of new opportunities. Biocontrol. 2017;63:39–59. doi: 10.1007/s10526-017-9801-4. [DOI] [Google Scholar]
- Ligon JM, Hill DS, Hammer P, Torkewitz N, Hofmann D, Kemf HJ, van Pée KH. Natural products with antifungal activity from Pseudomonas biocontrol bacteria. Pest Manage Sci. 2000;56:688–695. doi: 10.1002/1526-4998(200008)56:8<688::AID-PS186>3.0.CO;2-V. [DOI] [Google Scholar]
- Liu K, Newman M, McInroy JA, Hu CH, Kloepper JW. Selection and assessment of plant growth-promoting rhizobacteria for biological control of multiple plant diseases. Phytopathology. 2017;107:928–936. doi: 10.1094/PHYTO-02-17-0051-R. [DOI] [PubMed] [Google Scholar]
- Miller SCM, Lipuma JJ, Parke JL. Culture-based and non-growth-dependent detection of the Burkholderia cepacia complex in soil environments. Appl Environ Microbiol. 2002;68:3750–3758. doi: 10.1128/AEM.68.8.3750-3758.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Minerdi D, Fani R, Gallo R, Boarino A, Bonfante P. Nitrogen fixation genes in an endosymbiotic Burkholderia strain. Appl Environ Microb. 2001;67:725–732. doi: 10.1128/AEM.67.2.725-732.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mishra J, Arora NK. Secondary metabolites of fluorescent pseudomonads in biocontrol of phytopathogens for sustainable agriculture. Appl Soil Ecol. 2018;125:35–45. doi: 10.1016/j.apsoil.2017.12.004. [DOI] [Google Scholar]
- Nacamulli C, Bevivino A, Dalmastri C, Tabacchioni S, Chiarini L. Perturbation of maize rhizosphere microflora following seed bacterization with Burkholderia cepacia MCI 7. FEMS Microbiol Ecol. 1997;23:183–193. doi: 10.1111/j.1574-6941.1997.tb00401.x. [DOI] [Google Scholar]
- Paulitz TC, Bélanger RR. Biological control in greenhouse systems. Annu Rev phytopathol. 2001;39:103–133. doi: 10.1146/annurev.phyto.39.1.103. [DOI] [PubMed] [Google Scholar]
- Ramesh SK, Namrata M, Singh S. Improved nutrient use efficiency increases plant growth of rice with the use of IAA-Overproducing strains of endophytic Burkholderia cepacia strain RRE25. Microb Ecol. 2013;66:375–384. doi: 10.1007/s00248-013-0231-2. [DOI] [PubMed] [Google Scholar]
- Roitman JN, Mahoney NE, Janisiewicz WJ, Benson M. A new chlorinated phenylpyrrole antibiotic produced by the antifungal bacterium Pseudomonas cepacia. J Agric Food Chem. 1990;38:538–541. doi: 10.1021/jf00092a044. [DOI] [Google Scholar]
- Saint CP, Romas P. 4-Methylphthalate catabolism in Burkholderia (Pseudomonas) cepacia Pc701: a gene encoding a phthalate-specific permease forms part of a novel gene cluster. Microbiol. 1996;142:2407–2418. doi: 10.1099/00221287-142-9-2407. [DOI] [PubMed] [Google Scholar]
- Serfling A, Wirsel SGR, Lind V, Deising HB. Performance of the biocontrol fungus Piriformospora indica on wheat under greenhouse and field conditions. Phytopathology. 2007;97:523–531. doi: 10.1094/PHYTO-97-4-0523. [DOI] [PubMed] [Google Scholar]
- Sharma GRR, Singh D, Singh R. Biological control of postharvest diseases of fruits and vegetables by microbial antagonists: a review. Biol Control. 2009;50:205–221. doi: 10.1016/j.biocontrol.2009.05.001. [DOI] [Google Scholar]
- Shields MS, Reagin MJ. Selection of a Pseudomonas cepacia strain constitutive for the degradation of trichloroethylene. Appl Environ Microbiol. 1992;58:3977–3983. doi: 10.1128/AEM.58.12.3977-3983.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sokol PA, Darling P, Woods DE, Mahenthiralingam E, Kooi C. Role of ornibactin biosynthesis in the virulence of Burkholderia cepacia: characterization of pvdA, the gene encoding L-ornithine N(5)-oxygenase. Infect Immunol. 1999;67:4443–4455. doi: 10.1128/IAI.67.9.4443-4455.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tabacchioni S, Bevivino A, Dalmastri C, Chiarini L. Burkholderia cepacia complex in the rhizosphere: a minireview. Ann Microbiol. 2002;52:103–117. [Google Scholar]
- Teniola OD, Addo PA, Brost IM, Farber P, Jany KD, Alberts JF, van Zyl WH, Steyn PS, Holzapfel WH. Degradation of aflatoxin B1 by cell-free extracts of Rhodococcus erythropolis and Mycobacterium fluoranthenivorans sp nov DSM44556T. Int J Food Microbiol. 2005;105:111–117. doi: 10.1016/j.ijfoodmicro.2005.05.004. [DOI] [PubMed] [Google Scholar]
- Van VT, Berge O, Ngô Kê S, Balandreau J, Heulin T. Repeated beneficial effects of rice inoculation with a strain of Burkholderia vietnamiensison early and late yield components in low fertility sulphate acid soils of Vietnam. Plant Soil. 2000;218:273–284. doi: 10.1023/A:1014986916913. [DOI] [Google Scholar]
- Wilson CL, Wisniewski ME. Biological control of postharvest diseases of fruits and vegetables: an emerging technology. Annu Rev Phytopathol. 1989;27:425–441. doi: 10.1146/annurev.py.27.090189.002233. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.



