Skip to main content
NCBI home page
Cell Stress & Chaperones logoLink to Cell Stress & Chaperones
. 2020 Feb 14;25(2):345–355. doi: 10.1007/s12192-020-01077-1

Inhibition of hepatitis C virus genotype 4 replication using siRNA targeted to the viral core region and the CD81 cellular receptor

Reem M Aljowaie 1,✉, Fahad N Almajhdi 1, Hebatallh H Ali 2, Mohammad S El-Wetidy 2, Medhat K Shier 2,3
PMCID: PMC7058739  PMID: 32060691

Abstract

Hepatitis C virus (HCV) is one of the most important causative agents of hepatitis worldwide. The current study aimed to evaluate the silencing effect of the small interference RNA (siRNA) molecules designed against the core region of HCV genotype 4 (HCV-4) and the CD81 gene, which is the cellular receptor for HCV in the human hepatocytes. RT-PCR was used to measure the changes in both the viral HCV core and the cellular CD81 genes induced by the specific siRNA molecules. Additionally, the fluctuations in either the viral or the cellular proteins of the target regions were tested by flow cytometry and immunofluorescence. The results showed the effectiveness of the used siRNA molecules against the target genes in either RNA or protein levels. The effect of 100 nM of siCD81 and 40 nM of siCore was more evident at 24 and 48 h post-transfection. The combination of the two siRNA molecules resulted in an extra inhibitory effect of the HCV core at both the RNA (85.6%) and protein (98.5%) levels. The current study suggested that targeting of the CD81 cellular receptor and/or the viral HCV core region by the small interference molecules might be a suitable choice in the suppression of HCV-4 replication. This might assist the development of new antiviral medications and provides a new alternative strategy for the targeting and treatment of HCV genotype 4.

Keywords: siRNA, Hepatitis C virus, Gene silencing, CD81 receptor, HCV core protein

Introduction

Hepatitis C virus (HCV) is a bloodborne pathogen and one of the most important causative agents of hepatitis, and approximately 170 million people around the world are chronically infected with this virus. HCV can affect normal liver functions and causes chronic infection in most of the cases (50–80%). Moreover, HCV infection leads to inflammatory disease and cirrhosis (Bawazir et al. 2017). Despite the healthcare improvements in transfusion practices as well as health efforts and measures focusing on limiting the transmission and spread of HCV, there is an increase of HCV infection around the world. Thus, HCV exists as a major public health problem and represents a global economic burden. HCV-G1 is the most prevalent genotype worldwide (49. 1%), mainly in Europe and North America, followed by HCV-G3 (17.9%) in Europe and Australia and HCV-G4 (16.8%) in Africa and Middle East (Petruzziello et al. 2016). The prevalence of HCV in Saudi Arabia is variable between 15 and 90%, which is reported from the medical records of different hemodialysis centers (Abdel Gader et al. 2011; Karkar 2007), where genotype 4 is the most prevalent followed by genotype 1 and both are highly pathogenic and difficult to be treated (Bawazir et al. 2017). Up to nowadays, no available preventive vaccines to HCV besides the current therapies are suboptimal. Recently, HCV-specific direct-acting antiviral (DAA) compounds (such as grazoprevir, sofosbuvir, and elbasvir) have been accepted for clinical application (Lindenbach et al. 2005).

The updated guidelines of the World Health Organization (WHO) in 2018 suggested the usage of pan-genotypic DAAs for most of HCV infected patients, despite the high costs and limitations of these medications. In 2017, more than 70 million HCV patients were reported globally while only 5 million had been treated with DAAs (World Health Organization and Zoratti 2018). HCV-G1 is well treated by the second-generation DAA and reached viral eradication rates to more than 90% while HCV-G3 is not susceptible to the first-generation of DAA, protease inhibitors, with limited response to sofosbuvir (Petruzziello et al. 2016). NS5A inhibitor-based DAAs (ledipasvir or daclatasvir) are less effective in some HCV subtypes from Africa and Middle East, including HCV genotype 4r (Vermehren et al. 2018). As shown by Dietz et al., the failure of the treatment regimens consists of daclatasvir/sofosbuvir or ledipasvir/sofosbuvir was more frequent in HCV-G4 especially in subtypes 4a and 4d, the most prevalent subtypes in Egypt and Saudi Arabia, due to S282T mutation which evaluate a predictable viral resistance (Dietz et al. 2018).

HCV core protein is a valuable structure protein in HCV which has potential roles in correct virion morphogenesis, nucleocapsid formation, disease progression, and HCV infectivity. Core protein interferes in the signaling of many cellular pathways, modulate gene transcription, and affect cellular proliferation and ceasing to carry out its functions. Moreover, HCV core can affect cellular metabolism that leads to oxidative stress and liver steatosis which, usually, ended with hepatocellular carcinoma (HCC) (Jahan et al. 2011a; Khaliq et al. 2010). Furthermore, the genome sequence coding for the core protein is highly conserved within the different HCV genotypes (Lindenbach et al. 2005).

The cluster of differentiation 81 (CD81) is a tetraspanin membrane protein consisting of 236 amino acid that plays an important role in many cellular functions and is the best-characterized receptor for the entry of HCV (Khaliq et al. 2011; Tawar et al. 2016). CD81 interacts with E2 envelope protein for pH-dependent fusion, as the efficiency of HCV entry is mainly proportional to CD81 expression in the infected cells (Shulla and Randall 2012).

The RNA interference (RNAi) is mediated by double-stranded short interference RNAs (siRNAs) which had been shown to have an imperative role in the regulation of the gene expression in a sequence-specific way. The main idea of using RNAi as therapeutic agents is to knock down the targeted genes and inhibit the gene expression with high sensitivity and specific manner (Ashfaq et al. 2011).

The current study aimed to evaluate the use of RNA interference for the inhibition of HCV core as well as the cellular CD81 gene expression, and hence, this might be used as a therapeutic strategy for one of the most common causes of chronic hepatitis and its progressions to liver cirrhosis and HCC, especially in Saudi Arabia.

Materials and methods

Cell culture

Under the aseptic conditions, the human hepatoma cell line 7 (Huh-7 cells) (CLS Cell Lines Service GmbH, Eppelheim, Germany) were grown in the Dulbecco’s modified Eagle’s medium (DMEM), Cat. No. 41966-029 (GIBCO, MA, USA), supplemented with 1% penicillin/streptomycin, 1% glutamine, Cat. No. 25030-024 (GIBCO, MA, USA), and 10% fetal bovine serum (FBS). The cells were incubated at 37 °C and 5% CO2 while the medium was renewed every 3 days.

HCV infection and optimization of multiplicity of infection (MOI)

Huh-7 cells were inoculated by the human sera containing HCV-4 (1 × 106 copies/ml) in a dose-dependent manner, as described before (Shier et al. 2016). Briefly, cells were incubated in a CO2 incubator at 37 °C with 500 μl of the infectious medium at different doses (0, 0.05, 0.1, and 0.15 copy/ml) for 90 min, then 4.5 ml of fresh DMEM complete medium was added and incubated overnight. On the next day, the cells were washed with PBS and re-incubated with complete growth medium. Cells were harvested at two time intervals (24 and 48 h), according to the experimental design.

Design and synthesis of small interfering RNA molecules

The small interfering RNA (siRNA) molecules against the CD81 host cellular receptor in addition to the scrambled control were designed by Block-it™ RNAi Designer https://rnaidesigner.thermofisher.com/rnaiexpress/). The siRNA molecule against the HCV core region was used as described before (Shier et al. 2019). The sequences of the designed oligonucleotides against CD81 were as follows: siCD81 sense strand: 5′GCCCAACACCUUCUAUGUAAA′3, siCD81 antisense strand: 5′UCAUAGAAGGUGUUGGGCAA′3, the scrambled siCD81 sense strand: 5′GCCCACACUUCUAUACGUAAA′3, and siCD81 antisense strand: 5′UACGUAUAGAAGUGUGGGCAA′3. Scrambled siRNA had no specific sequence and no homology with any known gene and was used as a control. All molecules were synthesized and obtained from Applied Biosystems Inc. (Applied Biosystems, Thermo Fisher Scientific, CA, USA).

Effect of the siRNA molecules on the cellular viability

The cytotoxic effect of the siRNA molecules was assessed by MTT assay using Vybrant® MTT Cell Proliferation Assay Kit, Cat. No. M6494 (Invitrogen, CA, USA), according to the manufacturer instructions.

Transfection of siRNA CD81 cellular receptor and HCV core siRNA molecules into Huh-7 cells

For CD81 siRNA transfection experiments, non-infected Huh-7 cells were grown to semi-confluence and transfected by Lipofectamine 2000, Cat. No. 11668-027 (Invitrogen, CA, USA), according to the manufacturer instructions, using three different concentrations of siCD81 25, 50, and 100 nM and scrambled siCD81 (as a control). After two separate time points, (24 and 48 h), the cells were infected by HCV-4 serum at a concentration of 0.1 copies/cell for another 48 h. For HCV core siRNA transfection experiments, Huh-7 cells were infected with HCV-4 serum at a concentration of 0.1 copies/cell for 48 h of infection, then siCore and siCore were transfected to the cells at three different concentrations 10, 20, and 40 nM and incubated for 24 and 48 h. For combined CD81 and core siRNA transfection experiment, Huh-7 cells were transfected with 100 nM of siCD81 for 48 h followed by HCV-4 inoculation at the concentration of 0.1 copies/cell for another 48 h of infection, and finally, the infected cells were transfected with 40 nM of siCore for more 48 h.

RNA extraction and RT-PCR

Total cellular RNA was extracted using TRIZOL® Reagent, Cat. No.15596-018 (Invitrogen, CA, USA) following the manufacturer protocol. RT-PCR was performed using the one-step RT-PCR kit, Cat. No. 210212 (QIAGEN, Hilden, Germany). In this study, two primer sets were used against the HCV-4 core region (Shier et al. 2017) and CD81 cellular receptor (Houldsworth et al. 2014). Amplification conditions were as follows: 50 °C for 30 min, 94 °C for 15 min, 40 cycles of 94 °C for 30 s, 58 °C (for HCV core region) or 52 °C (for CD81 cellular receptor) for 1 min, and 72 °C for 1 min, and 72 °C for 10 min. PCR products were analyzed using 1.5% agarose gel electrophoresis and visualized by the gel documentation system, GEL DOC XR (Bio-Rad, PA, USA). The PCR band intensities were determined using ImageJ software version 1.47 (National Institute of Health, MD, USA). All experiments were performed in triplicates.

Immunofluorescence

Immunofluorescence was used to evaluate the effect of specific siRNA on the CD81 (100 nM) and HCV core (40 nM). Protein expression levels were examined after 48 h. Huh-7 cells (control and transfected) were grown in the Millicell® Ez slide, Cat. No. PEZGSO416 (Millipore, MA, USA), and detection was performed as described before (Shier et al. 2016). Specific primary antibodies including Anti-TAPA1 mouse monoclonal antibody for CD81 protein, Cat. No. ab79559 (Abcam, Cambridge, UK), and Anti-HCV Antigen Rabbit polyclonal AB for HCV core protein, Cat. No. ab 1033 (Abcam, Cambridge, UK), were used. The relevant secondary antibodies Goat Anti-mouse IgG H&L (FITC), Cat. No. ab6785 (Abcam, Cambridge, UK), and Goat Anti-Rabbit IgG H&L (FITC), Cat. No. ab 6717 (Abcam, Cambridge, UK), were used for CD81 and HCV core protein detection, respectively.

Flow cytometry

Flow cytometry was used to investigate the HCV core protein expression. CD81 and HCV core protein in both infected non-treated cells and the cells transfected with siRNA CD81 (25, 50, 100 nM) and siRNA core (10, 20, and 40 nM) for 24 and 48 h were examined, using intracellular staining and indirect flow cytometry. Detection was performed as described before (Shier et al. 2016).

Statistical analysis

The levels of the statistical significance were assessed by one-way ANOVA using SPSS software version 14.0 (SPSS Inc. Chicago, IL, USA). A P value < 0.05 was considered to be statistically significant.

Results

The effect of siRNA molecules in the HCV infected and non-infected Huh-7 cells

The inhibitory effect of siCD81 was tested against the CD81 cellular receptor in the non-infected cells and HCV core gene in the infected cells, respectively, versus the scrambled molecules, as described above [Fig. 1]. The siCD81 molecule showed a non-significant effect on the cellular viability as shown in Fig. 1a. The results showed that siCD81 inhibited the expression of CD81 gene in a dose-dependent manner while the band intensities at 24 h post-transfection showed a slight decrease occurred at the concentration of 100 nM (11.2%) compared with other concentrations 25 nM (0.43%) and 50 nM (0.55%) that exhibited faint signals. At 48 h post-transfection, the silencing effect was significantly stronger at 100 nM showing a significant decline of 65.9% (P value < 0.001) of the band intensity compared to 30% at 50 nM (P value < 0.01) [Fig. 1b, c]. The Huh-7 cells transfected by siCD81 were tested for the possible effect on the expression of the HCV core gene. Results showed that the levels of the HCV core slightly decreased at 100 nM dose by 17% 24 h post-transfection, while after 48 h, PCR band intensity showed a highly significant decline by 66.5% (P value < 0.001) compared to the positive control cells [Fig. 1d, e].

Fig. 1.

Fig. 1

Open in a new tab

RT-PCR for the effect of siCD81 on gene expression in Huh-7 cells. a MTT assay for the effect of siCD81 on cellular viability. b, c The effect of siCD81 and siCD81 on CD81 gene expression in non-infected cells. d, e The effect of siCD81 and siCD81 on HCV core gene in infected cells

The siCore molecule showed a non-significant effect on the cellular viability as shown in Fig. 2a. The effect of siCore against the expression of HCV core gene in the infected cells showed a significant decline at 40 nM, 24 h post-transfection by 38.2%, and at 20 nm and 40 nm, 48 h post-transfection by 36.3% and 77.6%, respectively (P value < 0.001) [Fig. 2b, c]. In another set of experiments, a combinational approach by using siRNA against the CD81 cellular receptor and HCV core region was established in this particular experiment, and only the optimal doses of siRNA were used. Huh-7 cells were first transfected by 100 nM of siCD81 for 48 h and then infected by HCV serum using optimum dose (0.1 copies/cell) for 48 h, followed by transfection with 40 nM siCore for 48 h. siRNA against CD81 and core region individually gave a varied reduction in HCV core RNA expression after 48 h post-transfection. The reduction was up to 63.8% by 100 nM of siCD81 and 71.2% by 40 nM of siCore (P value < 0.001). The decline in HCV core expression was significantly higher in the combination situation (P value < 0.001) that causes PCR up to 85.6% decrease compared with the abovementioned conditions as well as the positive control and the scrambled siRNAs [Fig. 2d, e].

Fig. 2.

Fig. 2

Open in a new tab

RT-PCR for the effect of siRNAs on HCV core gene in infected Huh-7 cells. a MTT assay for the effect of siCore on cellular viability. b, c The effect of siCore and siCore on HCV core RNA expression. d, e The effect of siRNA combination on HCV core RNA expression

Effect of siRNA on the expression of expressed proteins, CD81, and HCV viral core proteins

The expression of the CD81 protein in the transfected cells was examined using immunofluorescence. Fluorescence was observed at two time intervals, 24 and 48 h post-transfection. Cells transfected by 50 nM and 100 nM fluorescence reveal a slight decrease in CD81 protein expression. After 48 h, fluorescence in all transfected cells with different siCD81 concentrations showed less intense fluorescence [Fig. 3a] compared with non-infected cells. By following the same experimental conditions, CD81 protein was detected and quantified by indirect extracellular flow cytometry. The overlay histogram presents clearly that CD81 protein levels were decreased when cells were transfected with different concentrations of siCD81. At 24 h post-transfection, protein levels were decreased by 13.4% (25 nM), 63.8% (50 nM), and 88.7% (100 nM), while at 48 h post-transfection, a dramatic decrease was shown in cells transfected with 100 nM (97.5%), 50 nM (83%), and 25 nM (20%) compared with the positive control and cells transfected with scrambled siCD81 in the same conditions as an experimental control [Fig. 3b].

Fig. 3.

Fig. 3

Open in a new tab

Effect of siCD81 on CD81 protein expression. a Results of immunofluorescence at two time intervals and three siCD81 doses. b Results of flow cytometry at two time intervals and three siCD81 doses

The expression of HCV core protein in infected Huh-7 cells was tested with and without siCD81 transfection by the immunofluorescence and flow cytometry [Fig. 4]. The results showed a strong and bright expression of the HCV core proteins in most of the infected cells compared to the non-infected. In the cells transfected with siCD81, the fluorescent intensity decreased by increasing the siCD81 doses and incubation time. It was noticed that the maximum inhibitory effect was at 48 h post-transfection from the 100 nM dose of siCD81, compared with the 25 and 50 nM doses [Fig. 4a]. The intracellular staining of HCV core protein in infected Huh-7 cells was quantified using indirect flow cytometry. The inhibitory effect of siCD81 on the expression of the HCV core protein in infected cells was evident, compared to experimental control using scrambled siCD81. The core protein expression decreased to the levels of 11.8%, 48.65%, and 78% (24 h post-transfection) and to 55.1%, 79.3%, and 93% (48 h post-transfection) when treated by siCD81 at the doses of 25, 50, and 100 nM, respectively (Fig. 4b).

Fig. 4.

Fig. 4

Open in a new tab

Effect of siCD81 on HCV core protein expression in infected Huh-7 cells. a Results of immunofluorescence at two time intervals and three siCD81 doses. b Results of flow cytometry at two time intervals and three siCD81 doses

The inhibitory effect resulted from the combination between the siRNAs against CD81 cellular receptor and HCV-4 core proteins

The effect of siCore against the expression of HCV core protein was examined as well. The HUH-7 cells transfected with siCore molecule did not reveal any significant changes in the fluorescence signal resulted from the doses of 10 nM and 20 nM of siCore molecule; however, the 40 nM dose showed a slight decrease in the fluorescence intensity, in both the 24-h and 48-h transfection setting, compared to the untreated positive control and scrambled siCore at 40 nM dose, as well (Fig. 5a). HCV core protein expression was quantified using indirect flow cytometry. Overlay histograms clarified the silencing effect on core protein expression due to using siCore compared with experimental control. It was noticed that the levels of HCV core protein decreased to 5.2%, 9.3%, and 10.3% at 24 h post-transfection and 14.9%, 36.9%, and 87.7% at 48 h post-transfection in the cells transfected with siCore at 10, 20, and 40 nM, respectively [Fig. 5b].

Fig. 5.

Fig. 5

Open in a new tab

Effect of siCore on HCV core protein expression. a Results of immunofluorescence at two time intervals and three siCore doses. b Results of flow cytometry at two time intervals and three siCore doses

The combined transfection of siCD81 and siCore showed a stronger inhibitory effect at 48 h post-transfection. The fluorescence intensity of the HCV core protein was, notably, very feeble compared with fluorescence in transfected cells, the positive control, and the scrambled siRNAs [Fig. 6a]. The flow cytometry showed the effectiveness of the combination strategy between the two molecules, compared with the experimental controls. The results of the HCV core protein levels in the transfected cells, compared to the positive control and the cells transfected with the scrambled molecules, showed that the combination of both siRNA molecules caused reduction to 98.5% compared to 91.3% in the cells transfected by siCD81 and to 94.8% in the cells transfected by siCore [Fig. 6b].

Fig. 6.

Fig. 6

Open in a new tab

Effect of siCD81 (100 nM) and siCore (40 nM) combination on HCV core protein expression in infected Huh-7 cells 48 h post-transfection. a Results of immunofluorescence. b Results of flow cytometry

Discussion

Among the attractive and promising therapeutic methods, RNA interference was one of the most specific tools used to degrade the targeted genes mRNA at both of the post-transcriptional and pre-translational levels (Liu et al. 2006). The HCV cellular entry is a complicated multistep process that involves a combined action of many cellular factors with the HCV envelope proteins (Molina et al. 2008). CD81 is an important member of a tetraspanin protein superfamily that integrates with other tetraspanins to organize the signaling proteins at the cell surface; besides, it is involved in different cellular functions including adherence, motility, proliferation, and morphology (Helle and Dubuisson 2008; Zhang et al. 2004). CD81 interacts with high affinity to the HCV glycoprotein E2 and, consequently, it plays an essential role in the early steps of HCV entry (Jahan et al. 2011c). HCV and CD81 interaction might establish chronic HCV infection by escaping the innate immune response and diluting immune response via polyclonal expansion (Rosa et al. 2005).

Our results indicated that siRNA inhibited CD81 expression in a dose-dependent manner. The highest level of inhibition was recognized when the cells were transfected with 100 nM of siCD81 (11.2% at 24 h and 65.9% at 48 h post-transfection). Comparable results were demonstrated at the protein level by immunofluorescence and flow cytometric analysis using specific CD81 antibodies. We found that upon the usage of 100 nM dose of siCD81, the CD81 protein levels decreased to 88.7% and 97.5% at 24 and 48 h post-transfection, respectively. Determination of siRNA optimum concentration is important to promote the inhibition of interesting genes (Xing et al. 2012). However, the outcomes of the current study did not support the previous research by Elbashir et al. which had suggested that siRNA effect occurs only when using concentration lower than 0.05 nM and higher concentration (25 to 100 nM) did not enhance the silencing effect of siRNAs (Elbashir et al. 2001).

To investigate the role of silencing CD81 cellular receptor on HCV-4 infection, we analyzed the inhibitory effect of siCD81 on the HCV core RNA expression and protein levels using the same different doses as before. Our results demonstrated that 100 nM of siCD81 can produce more reduction in the core RNA levels (16.9% and 66.5% after 24 and 48 h post-transfection) compared with transfected Huh-7 cells by scramble siCD81 and infected Huh-7 control cells. Furthermore, the inhibition effect of siCD81 had the same reduction pattern in both infected and non-infected Huh-7 cells, in a dose-dependent manner. HCV core protein levels also showed a dramatic reduction in the cells transfected with siCD81, which was administrated by the immunofluorescence staining and flow cytometry using specific core antibodies. Flow cytometric analysis displayed a reduction in the levels of HCV core protein levels by 78% and 93% in the Huh-7 cells treated with 100 nM of siCD81, at 24 and 48 h post-transfection. These results confirm the important role of CD81 as a receptor for HCV virions in the infection process in agreement with the findings of McKeating et al. and Jahan et al. (Jahan et al. 2011b; McKeating et al. 2004). Thus, the degradation of CD81 mRNA did not only suppress the CD81 protein production but it could block the HCV core protein production and the whole viral replication, as well. Our results are consistent with the observations by Henry et al. and Pan et al. who suggested that RNAi silencing effect of CD81 could inhibit the Huh-7 cells binding to the viral E2 protein (Henry et al. 2006; Pan et al. 2009). Thus, targeting cellular receptors like CD81 by siRNA can provide an exciting alternative therapy in HCV-4 treatment or development of the current medications.

HCV core protein is a valuable structural protein that has potential roles in virion morphogenesis, nucleocapsid formation, disease progression, and HCV infectivity. Core protein can modulate many cellular signaling pathways, besides its optimum roles in retardation of cellular proliferation and in cellular death. Furthermore, core protein can influence lipid metabolism which induces multi-specific CD4+, CD8+ T cell, and host immune response (Liu et al. 2006). In the current study, we assessed the possibility of knockdown of HCV-4 core gene expression by using siRNA in the infected Huh-7 cells. At 24 and 48 h post-transfection, a 40 nM dose of siCore, efficiently, displayed a maximum inhibition in core RNA level (38.2% and 77.6%) compared to the control cells. Flow cytometric data showed a reduction in protein levels (10.3% and 87.7%) at 24 and 48 h post-transfection. These results are compatible with immunofluorescence data, which showed a very feeble fluorescence at 48 h post-transfection. Our findings agreed with those of Khaliq et al. and Ansar et al. who demonstrated a 70% inhibition in HCV-1a RNA level at 48 h post-transfection by using 20 μM of siRNA molecule to target HCV core in Huh-7 cells (Ansar et al. 2011; Khaliq et al. 2010).

HCV core region consists of 573 nucleotides (191 aa) while the siRNA molecule, designed in this study, targeted 29–47 nt (9–15 aa) (370–388 nt in HCV) region which is located at N-terminal end (1–50 aa) of the core protein. This domain has different important roles including RNA and DNA binding and nuclear localization. Our results demonstrate that siRNA targeted N-terminal in the HCV-4 core could inhibit the HCV RNA expression to approximately 80%, as well as to reduce the protein levels to 88% at 48 h post-transfection. Consistent with this result, Khaliq et al. reported that siRNAs targeted N-terminal and C-terminal in HCV-3a core region were all knockdown RNA expression up to 60–80%, but at protein levels, siRNA against N-terminal region showed a remarkable inhibition up to 70% when compared with siRNA targeted C-terminal (Khaliq et al. 2011).

To prevent the viral mutations that might lead to drug resistance development, targeting multiple sites such as cellular receptors involved in HCV entry and structural HCV genes such as core at the same time might be great combinatorial components for siRNA. Studies have demonstrated the occurrence of resistant mutants with the isolated use of siRNA; however, the use of two molecules together was effective in eliminating the development of resistance (Braga et al. 2017). In the combination approach of this study, we used siRNAs targeting CD81 cellular receptor and HCV-4 core region in their optimum dose. The combination between siCD81 (100 nM) and siCore (40 nM) presented a reduction in core RNA to 85.6% compared with the treatment with each siRNA individually (63.8% by siCD81 and 71.2% by siCore), at 48 h post-transfection. Besides, compatible results are shown in protein levels using immunofluorescence and flow cytometry. The combination effect of siRNAs presented a decrease in core protein levels up to 98.5% compared with individually transfected cells (up to 91.3% by siCD81 and 94.8% by siCore) after 48 h post-transfection. These combined results demonstrate an additive inhibitory effect in the levels of the viral core protein, in infected Huh-7 cells, due to the knockdown of the CD81 gene and further inhibition of HCV-4 entry, as well as the silencing of core gene which was accompanied with lower expression of the HCV-4 core protein. The results of this study were in line with those of previous observations that reported the feasibility of using combination approach between cellular receptors, structural proteins, and important elements that support HCV infection (Jahan et al. 2011a; Jahan et al. 2011b; Jahan et al. 2011c; Khaliq et al. 2011; Xing et al. 2012). Remarkably, a combination strategy was applied between IFN-α and RNAi approach, while HCV treatment with IFN-α did not interfere with RNAi silencing effect by targeting the CD81 cellular receptor (Pan et al. 2009).

Conclusion

siRNAs targeting the cellular receptor, CD81, and the HCV core region could achieve an excellent suppression of HCV-4 replication in Huh-7 cells. These findings might assist the development of a new alternative strategy in the treatment and prevention of HCV progression.

Funding information

This research project was supported by a grant from the “Research Center of the Female Scientific and Medical Colleges,” Deanship of Scientific Research, King Saud University [Grant Number: KSU –16-599].

Compliance with ethical standards

The ethical approval was obtained from the Ethics Committee at the College of Science, King Saud University, Riyadh, KSA (Ref. No. KSU –SE-17-4) in compliance with the Helsinki Declaration (https://www.wma.net/policies-post/wma-declaration-of-helsinki-ethical-principles-for-medical-research-involving-human-subjects/).

Conflict of interest

The authors declare that they have no conflict of interest.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Abdel Gader AG, Osman AM, Al Gahtani FH, Farghali MN, Ramadan AH, Al-Momen AK. Attitude to blood donation in Saudi Arabia. Asian J Transfus Sci. 2011;5:121–126. doi: 10.4103/0973-6247.83235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S. Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA. Virol J. 2011;8:203. doi: 10.1186/1743-422X-8-203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ashfaq UA, Yousaf MZ, Aslam M, Ejaz R, Jahan S, Ullah O. siRNAs: potential therapeutic agents against hepatitis C virus. Virol J. 2011;8:276. doi: 10.1186/1743-422X-8-276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bawazir A, AlGusheri F, Jradi H, AlBalwi M, Abdel-Gader A-G. Hepatitis C virus genotypes in Saudi Arabia: a future prediction and laboratory profile. Virol J. 2017;14:208. doi: 10.1186/s12985-017-0873-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Braga ACS, Carneiro BM, Batista MN, Akinaga MM, Rahal P. Inhibition of hepatitis C virus using siRNA targeted to the virus and Hsp90. Cell Stress Chaperones. 2017;22:113–122. doi: 10.1007/s12192-016-0747-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dietz J, Susser S, Vermehren J, Peiffer KH, Grammatikos G, Berger A, Ferenci P, Buti M, Müllhaupt B, Hunyady B, Hinrichsen H, Mauss S, Petersen J, Buggisch P, Felten G, Hüppe D, Knecht G, Lutz T, Schott E, Berg C, Spengler U, von Hahn T, Berg T, Zeuzem S, Sarrazin C, European HCV Resistance Study Group Patterns of resistance-associated substitutions in patients with chronic HCV infection following treatment with direct-acting antivirals. Gastroenterology. 2018;154:976–988. doi: 10.1053/j.gastro.2017.11.007. [DOI] [PubMed] [Google Scholar]
  7. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001;411:494–498. doi: 10.1038/35078107. [DOI] [PubMed] [Google Scholar]
  8. Helle F, Dubuisson J. Hepatitis C virus entry into host cells. Cell Mol Life Sci. 2008;65:100–112. doi: 10.1007/s00018-007-7291-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Henry SD, van der Wegen P, Metselaar HJ, Tilanus HW, Scholte BJ, van der Laan LJ. Simultaneous targeting of HCV replication and viral binding with a single lentiviral vector containing multiple RNA interference expression cassettes. Mol Ther. 2006;14:485–493. doi: 10.1016/j.ymthe.2006.04.012. [DOI] [PubMed] [Google Scholar]
  10. Houldsworth A, Metzner MM, Demaine A, Hodgkinson A, Kaminski E, Cramp M. CD81 sequence and susceptibility to hepatitis C infection. J Med Virol. 2014;86:162–168. doi: 10.1002/jmv.23726. [DOI] [PubMed] [Google Scholar]
  11. Jahan S, Khaliq S, Ijaz B, Ahmad W, Hassan S. Role of HCV Core gene of genotype 1a and 3a and host gene Cox-2 in HCV-induced pathogenesis. Virol J. 2011;8:155. doi: 10.1186/1743-422X-8-155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jahan S, Khaliq S, Samreen B, Ijaz B, Khan M, Ahmad W, Ashfaq UA, Hassan S. Effect of combined siRNA of HCV E2 gene and HCV receptors against HCV. Virol J. 2011;8:295. doi: 10.1186/1743-422X-8-295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Jahan S, Samreen B, Khaliq S, Ijaz B, Khan M, Siddique MH, Ahmad W, Hassan S. HCV entry receptors as potential targets for siRNA-based inhibition of HCV. Genet Vaccines Ther. 2011;9:15. doi: 10.1186/1479-0556-9-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Karkar A. Hepatitis C in dialysis units: the Saudi experience. Hemodial Int. 2007;11:354–367. doi: 10.1111/j.1542-4758.2007.00192.x. [DOI] [PubMed] [Google Scholar]
  15. Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Pervaiz A, Samreen B, Khan M, Hassan S. Inhibition of core gene of HCV 3a genotype using synthetic and vector derived siRNAs. Virol J. 2010;7:318. doi: 10.1186/1743-422X-7-318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S. Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes. Arch Virol. 2011;156:433–442. doi: 10.1007/s00705-010-0887-6. [DOI] [PubMed] [Google Scholar]
  17. Lindenbach BD, Evans MJ, Syder AJ, Wölk B, Tellinghuisen TL, Liu CC, Maruyama T, Hynes RO, Burton DR, McKeating J, Rice CM. Complete replication of hepatitis C virus in cell culture. Science. 2005;309:623–626. doi: 10.1126/science.1114016. [DOI] [PubMed] [Google Scholar]
  18. Liu M, et al. RNA interference effectively inhibits mRNA accumulation and protein expression of hepatitis C virus core and E2 genes in human cells. Biosci Biotechnol Biochem. 2006;70:2049–2055. doi: 10.1271/bbb.60001. [DOI] [PubMed] [Google Scholar]
  19. McKeating JA, Zhang LQ, Logvinoff C, Flint M, Zhang J, Yu J, Butera D, Ho DD, Dustin LB, Rice CM, Balfe P. Diverse hepatitis C virus glycoproteins mediate viral infection in a CD81-dependent manner. J Virol. 2004;78:8496–8505. doi: 10.1128/JVI.78.16.8496-8505.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Molina S, Castet V, Pichard-Garcia L, Wychowski C, Meurs E, Pascussi JM, Sureau C, Fabre JM, Sacunha A, Larrey D, Dubuisson J, Coste J, McKeating J, Maurel P, Fournier-Wirth C. Serum-derived hepatitis C virus infection of primary human hepatocytes is tetraspanin CD81 dependent. J Virol. 2008;82:569–574. doi: 10.1128/JVI.01443-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Pan Q, et al. Combined antiviral activity of interferon-alpha and RNA interference directed against hepatitis C without affecting vector delivery and gene silencing. J Mol Med (Berl) 2009;87:713–722. doi: 10.1007/s00109-009-0470-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Petruzziello A, Marigliano S, Loquercio G, Cozzolino A, Cacciapuoti C. Global epidemiology of hepatitis C virus infection: an up-date of the distribution and circulation of hepatitis C virus genotypes. World J Gastroenterol. 2016;22:7824–7840. doi: 10.3748/wjg.v22.i34.7824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Rosa D, Saletti G, de Gregorio E, Zorat F, Comar C, D'Oro U, Nuti S, Houghton M, Barnaba V, Pozzato G, Abrignani S. Activation of naive B lymphocytes via CD81, a pathogenetic mechanism for hepatitis C virus-associated B lymphocyte disorders. Proc Natl Acad Sci U S A. 2005;102:18544–18549. doi: 10.1073/pnas.0509402102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shier MK, El-Wetidy MS, Ali HH, Al-Qattan MM. Hepatitis c virus genotype 4 replication in the hepatocellular carcinoma cell line HepG2/C3A. Saudi J Gastroenterol. 2016;22:240–248. doi: 10.4103/1319-3767.182461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Shier MK, Iles JC, El-Wetidy MS, Ali HH, Al Qattan MM. Molecular characterization and epidemic history of hepatitis C virus using core sequences of isolates from Central Province, Saudi Arabia. PLoS One. 2017;12:e0184163. doi: 10.1371/journal.pone.0184163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Shier MK, Ali HH, El-Wetidy MS, Al-Qattan MM, Al-Fageeh MB. Effect of RNA interference on the hepatitis C virus core expression in HepG2/C3A cells using genotype 4 isolates from Saudi patients. J Coll Physicians Surg Pak. 2019;29:852–859. doi: 10.29271/jcpsp.2019.09.852. [DOI] [PubMed] [Google Scholar]
  27. Shulla A, Randall G. Hepatitis C virus-host interactions, replication, and viral assembly. Curr Opin Virol. 2012;2:725–732. doi: 10.1016/j.coviro.2012.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Tawar RG, Schuster C, Baumert TF. HCV receptors and virus entry. In: Hepatitis C virus I. Springer; 2016. pp. 81–103. [Google Scholar]
  29. Vermehren J, Park JS, Jacobson IM, Zeuzem S. Challenges and perspectives of direct antivirals for the treatment of hepatitis C virus infection. J Hepatol. 2018;69:1178–1187. doi: 10.1016/j.jhep.2018.07.002. [DOI] [PubMed] [Google Scholar]
  30. World Health Organization, Zoratti M. (2018) Guidelines for the care and treatment of persons diagnosed with chronic hepatitis C virus infection: web annex 3.1: adult hepatitis C virus treatment systematic review. https://apps.who.int/iris/handle/10665/277215 [PubMed]
  31. Xing XK, Li SJ, He JL, Chen Z. Inhibition of hepatitis C virus replication by single and dual small interfering RNA using an HCV-infected cell model. Biotechnol Lett. 2012;34:295–301. doi: 10.1007/s10529-011-0761-y. [DOI] [PubMed] [Google Scholar]
  32. Zhang J, Randall G, Higginbottom A, Monk P, Rice CM, McKeating JA. CD81 is required for hepatitis C virus glycoprotein-mediated viral infection. J Virol. 2004;78:1448–1455. doi: 10.1128/jvi.78.3.1448-1455.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier

RESOURCES