The NADPH oxidase in Volvariella volvacea and its differential expression in response to mycelial ageing and mechanical injury

Abstract

NADPH oxidases are enzymes that have been reported to generate reactive oxygen species (ROS) in animals, plants and many multicellular fungi in response to environmental stresses. Six genes of the NADPH oxidase complex components, including vvnoxa, vvnoxb, vvnoxr, vvbema, vvrac1 and vvcdc24, were identified based on the complete genomic sequence of the edible fungus Volvariella volvacea. The number of vvnoxa, vvrac1, vvbema and vvcdc24 transcripts fluctuated with ageing, and the gene expression patterns of vvnoxa, vvrac1 and vvbema were significantly positively correlated. However, the expression of vvnoxb and vvnoxr showed no significant difference during ageing. In hyphae subjected to mechanical injury stress, both O₂⁻ and H₂O₂ concentrations were increased. The expression of vvnoxa, vvrac1, vvbema and vvcdc24 was substantially upregulated, but vvnoxb and vvnoxr showed no response to mechanical injury stress at the transcriptional level. Additionally, the transcription of vvnoxa, vvrac1, vvbema and vvcdc24 could be repressed when the intracellular ROS were eliminated by diphenyleneiodonium (DPI) chloride and reduced glutathione (GSH) treatments. These results indicated a positive feedback loop involving NADPH oxidase and intracellular ROS, which might be the reason for the oxidative burst during injury stress.

Introduction

Reactive oxygen species (ROS) are one of the most important molecular signals and play a critical role in the development, ageing and cell-environment interactions in most organisms [1–5]. NADPH oxidase is a major source of ROS in animals, plants and many multicellular fungi [6–9]. Unlike plants, the fungal NADPH oxidases are assembled from six main subunits, including NoxA, NoxB, NoxR, Bem1, Rac1 and Cdc24 [10]. Fungal NoxA and NoxB are homologous to the phagocyte NADPH oxidase (Phox) catalytic subunit gp91^phox and are the core catalytic subunits in superoxide production; NoxA plays a vital role in virulence, sexual development, hyphal fusion and defence responses, and NoxB is mainly involved in ascospore germination and appressorium development [11]. NoxR is homologous to the mammalian p67^phox protein and acts as a scaffold for the NADPH oxidase complex; it is involved in the activation of the NoxA and NoxB enzymes [12, 13]. Two polarity proteins, Bem1 and Cdc24, play a critical role in localising NoxR to the sites of fungal hyphal morphogenesis and growth, suggesting a potential link between the establishment of fungal polarity and control of cellular differentiation by the Nox complex [10]. Additionally, the Rho family small GTPase Rac1 can be recruited to activate NADPH oxidase [14], and Cdc24 may act as a guanine nucleotide exchange factor involved in Rac1 activation [15].

Volvariella volvacea is one of the main commercial edible mushrooms cultivated in tropical and subtropical regions, especially on mainland China [16, 17]. The mycelia of V. volvacea have a high rate of growth at suitable temperatures (28–35 °C), but the mycelia can undergo autolysis or death during storage at temperatures below 4 °C [18]. Thus, the spawn of V. volvacea is susceptible to ageing, which may affect the yield and quality of the fruiting body. Similar to Agaricus bisporus, V. volvacea fruiting bodies are cultured in a bed and can be harvested 2–3 times [19, 20]. However, mechanical injury of the mycelia often occurs during the harvesting of the fruiting body, causing the wilting of the peripheral primordia and resulting in yield reduction. Several studies have demonstrated that NADPH oxidase can generate ROS signalling and is involved in the ageing and wounding response [21–23]. However, the NADPH oxidase–encoding genes of V. volvacea have not been identified to date. Considering the importance of NADPH oxidase in fungal development and stress responses, the coding genes of the NADPH oxidase subunits were identified based on the complete genomic sequence of V. volvacea. The transcriptional levels of six subunit-encoding genes of the NADPH oxidase were investigated during mycelial ageing and mechanical injury response.

Materials and methods

Fungi

The tested strain H1521 of V. volvacea is preserved in the Agricultural Culture Collection of China (ACCC) with preservation no. ACCC52633. It was generated by a cross between the homokaryotic strains PYd15 (ACCC52631) and PYd21 (ACCC52632).

Gene identification and sequence analysis

The amino acid sequences of NoxA (GenBank ID BAE72680.1), NoxB (BAE72682.1), NoxR (BAF36501.1), Rac1 (BAF36499.1), BemA (BAI50706.1) and Cdc24 (BAI50707.1) from the filamentous fungus Epichloë festucae [10] were downloaded from the GenBank database and locally blasted with the 11,534 amino acid sequences of the V. volvacea strain PYd21 genome (GenBank assembly accession, GCA_000355865.1) using BLASTP; the e value was set as 1 × 10⁻². The matched sequences were submitted to NCBI for domain verification. The amino acid sequences of the NADPH oxidase subunits were also annotated from the genomes of Aspergillus nidulans FGSC A4 (GCF_000149205.1), Coprinopsis cinerea okayama7#130 (GCA_000182895.1), Fusarium graminearum PH-1 (GCA_000240135.3), Magnaporthe oryzae 70-15 (GCA_000002495.2) and Neurospora crassa OR74A (GCA_000182925.2) using the same method.

The DNA sequences of the NADPH oxidase–encoding genes of V. volvacea were validated by mapping with the clean reads of the PYd21 genome sequencing by the ZOOM software with 0 mismatched base pair(s) according to published methods [24]. The corrected gene sequences were used as references to map against the transcriptome sequence clean reads of balanced mixed mRNA of eight samples (i.e. the mycelia of PYd15, PYd21 and H1521 and the primordium, button-stage stipe, egg-stage stipe, elongated-stage stipe and maturation-stage stipe after fruiting of H1521) for transcript and intron region identification according to published methods [25, 26] using the ZOOM software [27]. All intron regions of these genes were experimentally verified by RT-PCR amplification and Sanger sequencing. The sequences without intronic regions were submitted to NCBI ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/) to predict the initiator and terminator codons.

Bioinformatics analysis

The transmembrane helix regions (TM) of the proteins were predicted using TMHMM version 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). The conserved domains of the amino acid sequences were coloured according to previous results [10, 28, 29] using GeneDoc software [30] after multiple sequence alignment based on the MUSCLE method [31].

Sample treatments

The mycelia of H1521 were inoculated on glass papers, which were placed directly on the surface of solid potato dextrose agar (PDA) plates (Φ = 6 cm) and cultured at 34 °C in the dark.

For ageing treatments, the mycelia were cultured for 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 days and were preincubated in 0.02 mol/L (pH = 8) PBS (phosphate-buffered saline) buffer for 90 min.

For mechanical injury treatments, the mycelia were cultured for 3 days and preincubated in 0.02 mol/L (pH = 8) PBS or 50 μmol/L DPI (diphenyleneiodonium chloride; Sigma, St. Louis, MO, USA) for 30 min; the solution was removed, and the mycelia were locally cut with a sterile scalpel for mechanical injury treatment; then, the mycelia were exposed to 0.02 mol/L (pH = 8) PBS or 10 mmol/L GSH (glutathione; Beyotime Institute of Biotechnology, Shanghai, China) for 60 min.

All incubation solutions were prepared in 0.02 mol/L (pH = 8) PBS and kept at 34 °C before use. All treatments were performed at 34 °C. According to our previous studies, the mycelia incubated in 0.02 mol/L (pH = 8) PBS for 90 min at 34 °C suffered from the least stresses, and the concentrations of the treatments with GSH and DPI were suitable for investigating the role of ROS signalling in the mycelia of H1521 [25, 32]. All treatments were repeated in three independent experiments.

RNA preparation and cDNA synthesis

After treatment, the incubation solution and the inoculation agar blocks were quickly removed, and the mycelia were sampled and immediately frozen in liquid nitrogen. The total RNA of the samples was extracted using an E.Z.N.A.™ Plant RNA kit (from Omega Bio-Tek, Norcross, GA, USA) according to the common sample extraction method. TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (from TransGen Biotech) and TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One Step gDNA Removal) kits (from TransGen Biotech, Beijing, China) were used for cDNA synthesis.

Real-time quantitative RT-PCR expression analysis

The gene expression patterns were detected by the real-time quantitative RT-PCR assay using TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) performed on a CFX96 real-time fluorescence quantitative PCR machine (Bio-Rad, Hercules, CA, USA). The relative gene expression levels were calculated by using the 2^−ΔΔCt method [33]. Endosomal SPRY domain protein (spryp)–encoding and alpha tubulin (α-tub)–encoding genes were used as the reference genes [34, 35]. The qPCR primers were designed using the Primer Premier 6.0 and synthesised by Sangon Biotech Co., Ltd. (Shanghai) (see Table 1 for the primer sequences).

Table 1.

Primers used in real-time quantitative RT-PCR

Gene	Forward sequence(5′–3′)	Reverse sequence(5′–3′)
vvnoxa	TCAAGCACAGCAGGCAAGC	GGAACCAACCGAAGGAAGGAG
vvnoxb	TTTTGGTTGGTTCGGGTATTG	GAGCTTGGCCGTGAGGTAGAT
vvnoxr	CGCCTAGTCGTTCCCAGTCAC	GCTCTTCCGAATTTCGCTGTC
vvrac1	GCAGTCTTGAACCCTCCACC	GCACACTGAAGCCAAAACTCG
vvbema	CAGTATCAGACAACGCAGCAGAC	TGTGGGTTAGCAGCCGAAATCG
vvcdc24	TCTTCTTGGGCAATGTAACTCAG	GTCATCTCCTTTCCACCACACA
vvspryp	CTCCTCCTCCAATAACCCCCATC	TCAGAGTCTATTCCTTGCCTATCCG
vvα-tub	ACTTGGTTCCTTTCCCTCGTATTCAC	GCCATGTATTTGCCTTCCCTAG

The vvspryp and vvα-tub primers were synthesised according to Tao’s sequences [34].

Histochemical detection of ROS

There are two main ROS signalling molecules: superoxide anion (O₂⁻) and hydrogen peroxide (H₂O₂). O₂⁻ was visually detected by using NBT (nitroblue tetrazolium; Amresco, Fountain Parkway, Solon, OH, USA) staining, and H₂O₂ was visually detected by TMB (3,3′,5,5′-tetramethylbenzidine dihydrochloride hydrate; Sigma, St. Louis, MO, USA) staining as described previously [36, 37]. Briefly, after stress treatments, the mycelia on the surface of the PDA plates were directly incubated with 0.05% NBT in 0.05 mol/L phosphate-buffered saline (pH 7.5) for 30 min and 0.2 mg/mL TMB in 50 mmol/L Tris-acetate buffer (pH 5.0) for 15 min, respectively. The pictures were taken with a Nikon P500 digital camera.

Statistical analysis

The significance of the difference in relative gene expression levels between the control and treatments was analysed using Student’s t test. The correlations of gene expression were analysed using the Pearson correlation coefficient method by SPSS Statistics v20 software with a two-tailed test. The graphs were generated by GraphPad Prism version 5.01.

Results

Identification and sequence characteristics of the NADPH oxidase subunits in V. volvacea

The subunits of NADPH oxidase and the interactions of each subunit have been identified in the filamentous fungus Epichloë festucae [10]. A BLASTP search was performed in the V. volvacea strain PYd21 genome database using the E. festucae NADPH oxidase amino acid sequences, and six homologous proteins were annotated, including VvNoxA, VvNoxB, VvNoxR, VvBemA, VvRac1 and VvCdc24. The ORF of the vvnoxa gene is 2044 bp long and is interrupted by seven introns; the resulting protein consists of 559 amino acids. The ORF of the vvnoxb gene consists of 2414 bp and is interrupted by seven introns; the resulting protein consists of 618 amino acids. Both VvNoxA and VvNoxB contain six N-terminal transmembrane (TM) helix domains, four heme-coordinated His residues, two FAD-binding domains and four NADPH-binding domains; VvNoxB has an N-terminal extension of approximately 70 amino acids compared with VvNoxA (Fig. 1 and Figure S1). The vvnoxr ORF region has a size of 2122 bp and is interrupted by eight introns; the resulting protein consists of 543 amino acids and contains four tetratricopeptide repeat (TPR) domains, an activation domain, a proline-rich region and a PB1 domain (Fig. 1 and Figure S2). The ORF of the vvrac1 gene contains 966 bp with seven introns encoding 194 amino acids with five G-box elements of the GDP/GTP-binding motif (Fig. 1 and Figure S3). The vvbema ORF region has a size of 2154 bp and has only one intron; the resulting protein consists of 694 amino acids and contains two SH3 domains, a Phox homology (PX) domain and a PB1 domain (Fig. 1 and Figure S4). The vvcdc24 ORF region has a size of 3398 bp and is interrupted by six introns; the resulting protein consists of 996 amino acids and contains an N-terminal calponin homology (CH) domain, a Dbl-homologous(DH) domain characteristic of DH-GEFs and a C-terminal PB1 domain (Fig. 1 and Figure S5). All gene sequences were submitted to NCBI, and the GenBank ID numbers are MF140462-MF140466 and KU900113, respectively.

Fig. 1.

Domain structure of V. volvacea NoxA, NoxB, NoxR, Rac1, BemA and Cdc24. The transmembrane (TM) regions, FAD-binding, NADPH-binding, tetratricopeptide repeat (TPR), activation, proline-rich (P-rich) region, Phox and Bem1 (PB1), GDP/GTP-binding motif element (G-box), Src homology 3 (SH3), phox homology (PX), calponin homology (CH) and Dbl-homologous (DH) domains are indicated according to the multiple sequence alignment

The transmembrane helices of each subunit were predicted using TMHMM Server v. 2.0; the results showed that the catalytic subunits of VvNoxA and VvNoxB include seven and six transmembrane (TM) helices, respectively, but there are no transmembrane helices in VvBemA, VvNoxR, VvRac1 and VvCdc24 (Figure S6A to S6F). Five N-terminal transmembrane segments (TM1–TM5) were conserved in both NoxA and NoxB proteins of six filamentous fungi, but the TM6 segment was absent in NoxA of five ascomycetes (Figure S1).

Differential expression of NADPH oxidase–encoding genes during mycelial ageing

Mycelial ageing is a common problem of edible fungi because it decreases the mushroom yield. To test the transcriptional responses of six NADPH oxidase–encoding genes to mycelial ageing, V. volvacea colonies were collected at 3 (when the mycelia first fully cover the culture dish), 4, 5, 6, 7, 8, 9, 10, 11 and 12 days of growth. Real-time quantitative RT-PCR results showed that the transcript levels of vvnoxa, vvrac1, vvbema and vvcdc24 fluctuated with increasing age; however, the subunits of vvnoxb and vvnoxr showed no significant difference in expression during ageing (Fig. 2). In detail, the expression of vvbema was significantly upregulated at 4, 5, 7, 8, 9, 11 and 12 days, and the expression of vvnoxa and vvcdc24 was significantly upregulated at 7, 9, 11 and 12 days. vvcdc24 was also significantly upregulated at day 8, and vvrac1 was significantly upregulated at days 11 and 12 (Fig. 2). Pearson’s correlation coefficient analysis showed that the expression patterns of vvnoxa, vvrac1 and vvbema were significantly positively correlated with each other during mycelial ageing (Table 2).

Fig. 2.

The gene expression levels of six NADPH oxidase subunit genes relative to their expression on day 3 of growth. Data represent the mean ± SEM of three independent experiments. The symbols above the error bars indicate significant differences from day 3 (#, vvnoxa; ※, vvrac1; *, vvbema; &, vvcdc24; * and &, p < 0.05; ##, **, && and ※※, p < 0.01; and ### and ※※※, p < 0.001)

Table 2.

Correlation analysis of gene expression patterns during mycelial ageing

Gene	vvnoxb	vvnoxr	vvrac1	vvbema	vvcdc24
vvnoxa	0.198	0.185	0.795**	0.770**	0.594
vvnoxb		0.667*	0.067	− 0.293	− 0.276
vvnoxr			− 0.011	− 0.363	− 0.178
vvrac1				0.841**	0.312
vvbema					0.539

“**” and“*” indicate significant correlation at the 0.01 and 0.05 levels, respectively (2-tailed)

Mechanical injury regulates NADPH oxidase subunit gene expression by modulating ROS production

To investigate the injury stress response mechanism, relative gene expression levels and the intracellular ROS concentration were detected after injury treatment. The results showed that both O₂⁻ and H₂O₂ concentrations were increased after mechanical injury. Compared with the transcript levels of controls, the transcript levels of vvnoxa, vvrac1, vvbema and vvcdc24 were substantially upregulated after injury treatment, with 2.1-, 4.9-, 9.2- and 2.2-fold increases in relative expression, respectively. However, vvnoxb and vvnoxr showed no significant difference in expression between the control and injury treatments (Fig. 3).

Fig. 3.

Analysis of NADPH oxidase subunit gene expression and ROS accumulation in response to mechanical injury. a The relative expression of six NADPH oxidase subunit genes after different treatments. Each column represents the mean of three experimental values ± SEM. The symbols above the error bars indicate significant differences from the control (*p < 0.05 and **p < 0.01). b Histochemical detection of ROS (NBT for O₂⁻ detection, TMB for H₂O₂ detection). The control, hyphae were incubated in PBS buffer for 1.5 h; the DPI + GSH (DG) treatment, hyphae were incubated in 50 μmol/L DPI for 0.5 h and then switched to 10 mmol/L GSH and incubated for 1 h; the injury treatment, hyphae were incubated in PBS buffer for 0.5 h and subjected to localised cutting with a sterile scalpel; the hyphae were incubated in PBS buffer for 1 more hour; the DPI + injury + GSH (DIG) treatment, hyphae were incubated for 0.5 h in 50 μmol/L DPI and subjected to localised cutting with a sterile scalpel. Then, the incubation solution was switched to 10 mmol/L GSH, and samples were incubated for 1 h

It has been demonstrated that ROS generated by NADPH oxidase can act as a second messenger that induces defence genes in response to wounding stress in both plants and animals [21, 38]. To further understand the relationship between mechanical injury stress, NADPH oxidase subunit genes and ROS signalling molecules in V. volvacea, the NADPH oxidase–specific inhibitor diphenyleneiodonium (DPI) chloride and the H₂O₂scavenger–reduced glutathione (GSH) were used to maintain the intracellular ROS concentration at a low level (Fig. 3b). Real-time quantitative RT-PCR results showed that DPI preincubation and GSH incubation significantly inhibited mechanical injury stress–inducedvvnoxa, vvrac1, vvbema and vvcdc24 expression (Fig. 3a). These results could be taken as evidence that mechanical injury regulates NADPH oxidase subunit gene expression by increasing ROS production.

Pearson’s correlation coefficient analysis showed that the expression patterns of vvnoxa, vvrac1, vvbema and vvcdc24 were significantly positively correlated with each other in response to injury and ROS elimination treatments (Table 3).

Table 3.

Correlation analysis of gene expression patterns in response to injury and ROS elimination treatments

Gene	vvnoxb	vvnoxr	vvrac1	vvbema	vvcdc24
vvnoxa	0.537	− 0.601	0.980*	0.987*	0.985*
vvnoxb		− 0.443	0.567	0.575	0.604
vvnoxr			− 0.443	− 0.480	− 0.489
vvrac1				0.999**	0.998**
vvbema					0.999**

“**” and “*” indicate significant correlation at the 0.01 and 0.05 levels, respectively (2-tailed)

Discussion

The model of the fungal NADPH oxidase complex is similar to the animal complex; however, the receptor subunit p22^phox was not identified in fungi for a long period of time. Recently, a p22^phox homologous protein named NoxD was discovered in several fungal genomes, and some evidence points to the interaction between NoxA and NoxD, suggesting a potential role for NoxD in the NADPH oxidase complex [39, 40]. Additionally, another tetraspanin, Pls1, has also been reported to be an adaptor for the NoxB complex in Podospora anserina and Botrytis cinerea [41, 42]. Based on these new discoveries, the traditional model of the fungal NADPH oxidase was modified to include two independent complexes with the membrane-binding subunits of NoxA/NoxD and NoxB/Pls1 [43]. Using the BLASTP method, we identified a protein homologous to NoxD (GME928) and two proteins homologous to Pls1 (GME485 and GME7492) in V. volvacea. All three proteins contain four potential transmembrane domains (Figure S6G to S6I), and the two Pls1 homologues show 88.12% similarity with each other. However, both NoxD and Pls1 lack functional protein domains [39, 42]; additional experimental evidence is needed to confirm that these three proteins of V. volvacea are the subunits of the NADPH oxidase complex.

Ageing or senescence is a common phenomenon in the world. Some evidence suggests that senescence is a general cellular response to stress, and ROS generated by NADPH oxidase play a critical role during the natural course of senescence [44, 45]. Our results showed that the expression levels of four NADPH oxidase subunits encoding genes vvnoxa, vvrac1, vvbema and vvcdc24 were upregulated during ageing, which may promote the production of reactive oxygen species and be involved in the ageing response.

Hernández-Oñate et al. [23] demonstrated that injury can stimulate ROS production through Nox1 and suggested that H₂O₂ may also act as a signal molecule in response to injury in fungi. Our histochemical detection results showed that both O₂⁻ and H₂O₂ concentrations were increased in injured mycelia, which indicated that both signalling pathways mediated by O₂⁻ and H₂O₂ might be involved in the injury response. Moreover, the expression of vvnoxa, vvrac1, vvbema and vvcdc24 was upregulated after mycelial injury, suggesting a close relationship between NADPH oxidase and injury stress. An oxidative burst often occurs after stress treatment, and it can mediate the acquisition of tolerance to both biotic and abiotic stresses [45]. Lin et al. [46] reported that a positive feedback loop involving NADPH oxidase, H₂O₂ and ZmMPK5 is involved in ABA signalling. Gémes et al. [47] also discovered that an NADPH oxidase/polyamine oxidase feedback loop controls oxidative burst under salinity. In this study, the transcription of NADPH oxidase subunit genes could be significantly repressed when intracellular ROS was eliminated by DPI and GSH during mechanical injury. These results provide evidence that intracellular ROS could positively regulate the expression of NADPH oxidase subunit genes, which might be the reason for oxidative burst in response to injury stress. Interestingly, the expression of vvnoxa, vvnoxr, vvrac1, vvbema and vvcdc24 was upregulated when intracellular ROS were eliminated. ROS are signalling molecules necessary for cellular differentiation and development [1, 48]. When ROS are eliminated, NADPH oxidase might be activated to maintain a basal level of ROS, which is essential for cell survival.

In addition, the expression of vvnoxa, vvrac1 and vvbema showed a significant positive correlation with each other in ageing and injured samples, which indicated a similar expression regulation mechanism of these genes in response to ageing and injury stresses. However, the expression levels of vvnoxb and vvnoxr showed no significant difference in both aged and injured samples. Thus, VvNoxB and VvNoxR may not respond to ageing and injury stresses at the transcriptional level. Needless to say, more studies are needed to reveal the mechanism of NADPH oxidase in ageing and injury stresses in V. volvacea.

Author contributions

XBG and YJJ conceived and designed the experiments; YJJ, TZJ, LYY, LZY, LY, HX and XWN performed the experiments; YJJ, HQH and TYX analysed the data; YJJ, LYY and TZJ contributed reagents/materials/analysis tools; YJJ wrote the paper; XBG edited the paper; and all authors reviewed the manuscript.

Funding information

This work was financially supported by grants from the China Agriculture Research System (CARS24), the National Key Basic Research Program of China (2014CB138302) and the Scientific Research Foundation of Graduate School of Fujian Agriculture and Forestry University.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.