Abstract
Pseudogenes are mutated copies of protein-coding genes that cannot be translated into proteins, but a small subset of pseudogenes has been detected at the protein level. Although ubiquitin pseudogenes represent one of the most abundant pseudogene families in many organisms, little is known about their expression and signaling potential. By re-analyzing public RNA-sequencing and proteomics datasets, we here provide evidence for the expression of several ubiquitin pseudogenes including UBB pseudogene 4 (UBBP4), which encodes UbKEKS (Q2K, K33E, Q49K, N60S). The functional consequences of UbKEKS conjugation appear to differ from canonical ubiquitylation. Quantitative proteomics shows that UbKEKS modifies specific proteins including lamins. Knockout of UBBP4 results in slower cell division, and accumulation of lamin A within the nucleolus. Our work suggests that a subset of proteins reported as ubiquitin targets may instead be modified by ubiquitin variants that are the products of wrongly annotated pseudogenes and induce different functional effects.
Subject terms: Ubiquitins, Ubiquitylated proteins, Ubiquitylation, Proteomics
Ubiquitin pseudogenes are present in many organisms but whether they encode functional proteins has remained unclear. Here, the authors show that human UBB pseudogene 4 produces ubiquitin variants with amino acid compositions and cellular functions that are distinct from canonical ubiquitin.
Introduction
Although it was initially described as a mechanism targeting proteins for degradation mediated by the proteasome1, ubiquitylation can also regulate protein localization, protein–protein interactions as well as other protein functions2. Ubiquitylation is the covalent addition of the small 76 amino acids ubiquitin protein (Ub) via an isopeptide linkage between the C-termini diglycine (GG) motif of Ub and the NH2 group of lysine residues on the target protein1. The enzymatic reaction resulting in the attachment of the Ub involves a sequence of three reactions mediated by E1 activating, E2 conjugating, and E3 Ub ligase enzymes, the later determining the substrate specificity3,4. In humans, there are 2 E1 ligases, 35 E2 ligases, and over 600 predicted E3 ligases5, underlining the complexity of this posttranslational modification and the specificity mediated by the E3 ligases.
Monoubiquitylation or multimonoubiquitylation on a single protein typically regulates intra- and intermolecular interactions6. For example, monoubiquitylation of proliferating cell nuclear antigen (PCNA) on Lys164 in response to a genotoxic stress promotes the recruitment of DNA polymerases lacking proofreading activity to overcome a DNA replication block and bypass DNA lesions7. Ub itself contains seven modifiable lysine residues, and multiple cycles of ubiquitination can also occur to produce long poly-Ub chains8. These poly-Ub chains, when attached to a target protein, generates a complex Ub code which stores different information depending on the Lys residue of the Ub that is linked6. For example, Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation, while Lys-48-linked is involved in protein degradation via the proteasome9. In addition to these homogenous chains, the Ub code also includes mixed and branched chains composed of heterogeneous linkages6.
Ubiquitylated targets are recognized by Ub-binding domains (UBDs) present in proteins which transmit the information coded by the modification type to modulate various cellular processes10. The propensity of UBDs for monoubiquitylation or chains of specific length and linkage is an essential feature for their specificity of action11. Similar to Ub modifications, Ub-like modifiers (UBLs) proteins, such as SUMO or NEDD8, have their own specific E1 (activating), E2 (conjugating), and E3 (ligating) enzymes9. There is also cross-regulation between the various conjugation pathways, since some proteins can become modified by more than one Ub-like modifier, and sometimes even at the same lysine residue12. While UBLs share little amino acid identity with Ub (SUMO has only 18% amino acid identity with ubiquitin), their three-dimensional structures are virtually superimposable13.
In human, Ub is encoded by four different genes: the UBA52 and RPS27A genes code for a single copy of Ub fused into the ribosomal proteins L40 and S27A, respectively14,15. UBB and UBC genes code for poly-Ub precursors (UBB encodes for three repeats and UBC for nine repeats in human)16. These precursors are processed into single Ubs by deubiquitinating enzymes (DUBs), proteases involved in removing Ub from ubiquitylated proteins, as well as cleaving Ub precursors17. Additional genes potentially coding for Ub have been identified, but are labeled as pseudogenes18. A pseudogene is defined as a copy of a gene that has lost the capacity to produce a functional protein19. Because of the similarities with the known Ub producing genes, those pseudogenes are assumed to be the products of integrations of reverse transcribed mRNAs, or arose from crossing over of ancestral alleles. The accepted conclusion is that they are either not transcribed or that they do not encode functional proteins, yet, ribosome profiling and proteogenomics approaches with customized protein databases including unannotated, pseudogenes, or alternative open reading frames (ORFs) recently detected these proteins20–25. Importantly, these proteins are usually not accounted for in current protein databases and, as such, are usually not identified in proteomic studies26.
Here, we show that a subset of Ub pseudogenes are expressed, and are functionally different from canonical Ub. They are attached to different protein targets and do not appear to specifically target proteins for proteasomal degradation. Proteins modified by this Ub variant include lamins, and knockout (KO) cells display a nucleolar accumulation of lamins and slower cell growth.
Results
UBB pseudogene expression
RNA-sequences annotated as noncoding are increasingly detected as translated and functionally characterized27,28. In particular, ribosome profiling and mass spectrometry (MS)-based proteogenomics confirmed that several pseudogene-derived long noncoding RNAs are the important sources of ORFs22,25,29. Yet, pseudogene function at the protein level is rarely considered30. In human, there are four Ub genes, UBB, RPS27A, UBA52, and UBC, as well as at least 52 pseudogenes of these genes (Supplementary Table 1). While over half of Ub pseudogenes-derived RNAs have not been detected, some can be detected in tissues alongside Ub RNAs (Fig. 1a and Supplementary Figs. 1–3). This suggests that at least some of those pseudogenes could potentially result in mRNA translation and production of proteins. In particular, UBB pseudogene 4 (UBBP4), RPS27A pseudogene 16 (RPS27AP16), and UBA52 pseudogene 8 (UBA52P8) are ubiquitously expressed at relatively high levels in several different datasets (Illumina Body Map, GTEx Portal and NIH Consortium) (Supplementary Figs. 1–3)31.
UBB has five pseudogenes called UBB pseudogenes 1–5, or UBBP1–532,33 (Fig. 1b). UBBP1, UBBP2, UBBP3, and UBBP5 are processed pseudogenes resulting from reverse transcribed mRNA integration into the genome34, but UBBP4 contains an intron and lacks a poly-A tail reminiscent of an integrated reverse transcript and is thus annotated as a transcribed unprocessed pseudogene35. Interestingly, evidence of expression of proteins encoded by UBBP4 were reported and we sought to elucidate these observations29,36. Because of the presence of a premature stop codon within the first Ub repeat in addition to having a frameshift in the third, it was concluded that UBBP4 was unproductive (Fig. 1b)32. However, since isolation and early sequencing of that cDNA back in 1988, its sequence within the current consensus human genome differs and does not contain the stop codon reported within the first Ub subunit, indicating that the mRNA can produce a poly-Ub precursor. The sequencing of PCR products from both genomic DNA and reversed transcribed mRNA confirmed the absence of the stop codon within the first ubiquitin repeat of UBBP4, as well as the transcription and splicing of the intron in three different commonly used cell lines (HEK293, HeLa, and U2OS) (Supplementary Fig. 4). Analysis of RNA-Seq data from ENCODE from nine different cell lines also indicates transcription at both exons (Supplementary Fig. 5)37, and the presence of elongating ribosomes from ribosome profiling studies (Supplementary Fig. 6)38 suggests that the mRNA produced from UBBP4 is actively translated into proteins. These data confirm that UBBP4 is ubiquitously transcribed and that the mRNA is actively translated into proteins by ribosomes.
UBBP4 encodes four different Ub variants
UBBP4 displays two ORFs (Figs. 1b and 2a). The first ORF includes three potential Ub variants termed Ubbp4A1, Ubbp4A2, and Ubbp4A3. Ubbp4A1 differs from the canonical Ub by eight amino acids, while Ubbp4A2 has only one amino acid substitution, from a threonine to a serine (Fig. 2a). Ubbp4A3 cannot be a functional variant as it contains a frameshift and lacks the C-terminal diglycine required for attachment to other proteins (Fig. 2a). The second ORF contains another variant, Ubbp4B1 (Figs. 1b and 2a). Re-analysis of MS data with the proteogenomics database OpenProt36 identifies unique peptides matching to Ubbp4A1, Ubbp4A2, and Ubbp4B1 in several proteomics studies39–46, confirming the translation of these Ub variants (Fig. 2b). Interestingly, those unique peptides are also observed in interactome MS-studies (Fig. 2b)40,42,43, suggesting that proteins can be modified by UBBP4-derived Ub variants.
Ub variants are conjugated to protein targets
To determine whether these Ub variants can be attached to other proteins, plasmids expressing HA-tagged Ubbp4A1, Ubbp4A2, Ubbp4A3, and Ubbp4B1 were transfected in cells, and whole cell lysates were separated by SDS-PAGE and immunoblotted with an HA antibody (Fig. 2c). Ubbp4A2 and Ubbp4B1 transfected cells display a large number of high-molecular weight proteins recognized by the HA antibody, similar to that observed with cells transfected with Ub. In contrast, Ubbp4A1 and Ubbp4A3, display only the monomer (unattached) (Fig. 2c), suggesting that the L73R change in Ubbp4A1 could affect the ability to be activated by the E1, and that the lack of the diglycine at the C-terminal of Ubbp4A3 prevents the covalent addition of ubiquitin to other proteins (Fig. 2a). Treatment of cells with the proteasome inhibitor MG132 results in the accumulation of higher molecular weight proteins in cells expressing Ub, as well as Ubbp4A2, but not Ubbp4B1 (Fig. 2d). Interestingly, while the cellular localization of Ub and Ubbp4B1 appears to be both nuclear and cytoplasmic, Ubbp4B1 shows a more prominent nuclear localization (Fig. 2e). Moreover, treatment with MG132 results in the accumulation of ubiquitin-modified proteins within cytoplasmic foci reminiscent of aggregates (Fig. 2e), and this accumulation is not observed with Ubbp4B1. These observations indicate that proteins modified with ubiquitin accumulate when the proteasome is inhibited, consistent with one of the main function for ubiquitin modification. It also support the observation that proteins modified by Ubbp4B1 are not targeted for proteasomal degradation. These results suggest that protein modification by Ubbp4B1 has different faith and functions.
Proteomic identification of UbKEKS targets
UBBP4 thus encodes a variant of Ub (Ubbp4B1), which we proposed to name UbKEKS, because it differs from the canonical ubiquitin by four amino acids: Q2K, K33E, Q49K, and N60S (Fig. 2a). More importantly, this variant holds potential for different ubiquitin chains (K2 and K49), as well as missing K33. Because K49 is located adjacent to the major proteasomal degradation signal (poly-K48 chains)47, this suggests a mechanism of modification that could explain the lack of protein degradation of proteins modified by UbKEKS. The expression of HA-tagged UbKEKS results in its covalent attachment onto other proteins as revealed by immunoblotting, and interestingly, the pattern of proteins modified is different when compared with Ub (Figs. 2d and 3a). In order to identify proteins modified by or interacting with UbKEKS, tetracyclin inducible stable cell lines expressing either HA-tagged Ub, or HA-tagged UbKEKS were used for affinity purification, followed by MS-based protein identification. These experiments were performed in either denaturing or nondenaturing conditions. The rationale was to differentiate the identification of proteins directly modified by Ub or UbKEKS, and to identify proteins interacting with these small modifiers. In order to accurately define UbKEKS specific modifications compared with Ub, SILAC-labeled cells were used to compare nonmodified (light), Ub-modified (medium), and UbKEKS-modified (heavy) proteins (Fig. 3b). Mixing the immunoprecipitates prior to MS identification allows to quantify enrichment of proteins in either the Ub or UbKEKS expressing cells, in relation to control cells and with each other (Fig. 3b). Proteins identified as using HA-Ub versus HA-UbKEKS confirmed our initial observation by immunoblotting that the protein targets of UbKEKS are different from targets of Ub, demonstrating a specificity in protein substrates (Fig. 3c, d and Supplementary Data 1). Moreover, under nondenaturing conditions, most subunits of the proteasome were enriched only with Ub, confirming that Ub targets proteins to the proteasome, but not UbKEKS (Supplementary Fig. 7 and Supplementary Data 1).
Lamins are modified by UbKEKS
Amongst the proteins identified specifically with UbKEKS are the nuclear lamins (lamin A, B1, and B2) (Fig. 3c, d and Supplementary Data 1), which constitute the major architectural proteins of the nuclear lamina48. Mutations in lamins cause a number of related genetic diseases termed laminopathies. Ubiquitylation of lamins may contribute to the regulation of these mechanisms involved in causing these diseases49,50. Interestingly, the nuclear localization of UbKEKS appears more intense at the nuclear periphery, consistent with lamins being a major target for modification by UbKEKS (Fig. 2e). Co-immunoprecipitations of lamin A or B2 with either HA-tagged Ub, or HA-tagged UbKEKS confirms that lamin A and B2 are modified preferentially by UbKEKS when compared with Ub (Fig. 4a, b). To determine whether UbKEKS is essential for cell function, KO of UBBP4 was performed using a CRISPR/Cas9 approach with paired guide RNAs designed to delete 715 bp (strategy 1) or 1659 bp (strategy 2) (Fig. 4c and Supplementary Table 2). Clones were obtained from both strategies showed a significant delay in cell growth (Fig. 4d). Interestingly, UBBP4 KO cells also showed an accumulation of lamin A within nucleoli compared with WT cells (Fig. 4e), indicating that modification of lamin A by UbKEKS could be involved in regulating its subcellular localization. The nucleoli of UBBP4 KO cells are also enlarged (Fig. 4f, g), suggesting that accumulation of lamin A could interfere with nucleolar function, such as ribosome biogenesis. The localization of lamin A in the nucleolus observed in the KO cells, as well as the size of the nucleolus, was rescued 72 h following transient transfection of a plasmid encoding HA-UbKEKS (clone 4.3 and 2.7) (Supplementary Fig. 8, compare transfected versus nontransfected cells).
Absolute quantification of Ubiquitin and UbKEKS
Absolute quantification of Ubiquitin and UbKEKS was performed using the AQUA method51. There are four unique peptides for UbKEKS that have been detected in several large-scale studies (Fig. 2b)39–46. Of those, three have miscleavages and included the N-terminal methionine which is often found modified (see peptide sequences in Fig. 2b). This left only one peptide that had no miscleavage, no internal lysine or arginine and was detected in five independent studies. We analyzed the product ions of the synthetic peptides to identify which ion showed the highest intensity (Supplementary Fig. 9a). While the y6++, y5, and y6 ion intensities were relatively high for Ub, only the y6 seemed suitable for quantification for UbKEKS. To be consistent, we chose one ion for each of Ub and UbKEKS for quantification. In some of the quantification, an early eluting peak was observed in presence of the cell extract (Fig. 5 and Supplementary Figs. 9 and 10). This peak is not observed when the heavy peptide is analyzed alone, and is only present when a cell extract is added (Supplementary Fig. 9b). This was confirmed to not be related to UbKEKS, as the signal of that early eluting peak did not increase when analyzing a whole cell extracts from cells overexpressing UbKEKS (Supplementary Fig. 9b), while the signal for UbKEKS co-eluting with the heavy peptide did increase. This confirmed that the early eluting peak is a contaminant peak originating from the cell extracts, but it is not UbKEKS.
To measure the amount of ubiquitin and UbKEKS, exponentially growing HeLa WT were harvested and lysed. Following tryptic digestion, the Heavy Arginine (U-13C6, 15N4; mass difference: +10 Da) labeled AQUA Ub (EGIPPDQQR) and UbKEKS (IQDEEGIPPDQQR) peptides were spiked into the samples at a final concentration of 1.66 fmol/μl. The peptides were analyzed by a mass spectrometer using a PRM method with an inclusion list containing the m/z values corresponding to the monoisotopic form of the heavy and light peptides of Ub (520.2/525.2) and UbKEKS (762.8/767.8). For quantification, the most intense fragment ion (y6) was used for both peptides (Fig. 5a and Supplementary Fig. 9a). The amount of Ub and UbKEKS proteins were calculated using the light to heavy peptide ratio and measured according to the concentration of spiked in AQUA peptides. The concentrations of Ub measured was 142 fmol/μg of total protein (Supplementary Fig. 10 and Supplementary Data 2), which is consistent with previous reports measuring Ub with a similar approach (99 fmol/μg in HeLa, 115 fmol/μg in HEK293 and 111 fmol/μg in HCT116)52,53. The concentration of UbKEKS in cells as expected was significantly lower, in the order of 0.23 fmol/μg. By comparison, quantification of Nedd8, Sumo1, and Sumo2 using a similar approach is 11, 0.7, and 20 fmol/μg, respectively53.
Absolute quantification of Ub and UbKEKS on lamins
To measure the amount of endogenous Ub and UbKEKS on lamin A and lamin B2, wild type and UbKEKS KO HeLa cells (clone 4.3) were transfected with either GFP-lamin A or GFP-lamin B2, and the GFP-tagged proteins were immunoprecipitated. Following digestion, AQUA Ub and UbKEKS peptides were spiked into the samples. The peptides were analyzed by a mass spectrometer using the same PRM method as described above (Fig. 5b). The ratio of UbKEKS to Ub on lamin A and lamin B2 were calculated (Fig. 5c and Supplementary Data 3). Interestingly, the ratio measured an ~20:1 ratio of Ub:UbKEKS on both lamin A and lamin B2, suggesting that modification of lamins remains majoritarily by endogenous Ub instead of UbKEKS, although the ratio is much higher compared with the 700:1 ratio measured in whole cell extracts. The amount of UbKEKS decreased significantly in the KO cells, further validating the CRISPR/Cas9-mediated KO of the UBBP4 gene expression (Fig. 5c and Supplementary Data 3). Because UbKEKS was quantified on shorter gradients in order to increase the peak intensity of UbKEKS by reducing the peak width, we did have a slight overlap in signal from the early eluting contaminant, which does provide some signal when performing the quantification (Fig. 5 and Supplementary Fig. 9c). As demonstrated on the LMNA pulldown experiments comparing the WT and KO cells, we can see that the peak corresponding to UbKEKS in the WT cells is perfectly co-eluting with the AQUA peptide (black arrow), and this peak is not observed in the KO cells (Supplementary Fig. 9c). However, the quantification does not measure a complete KO of UbKEKS, because we did have some signal trailing from that early eluting peak (see the red trail left in the HeLa 4.3, Supplementary Fig. 9c). We can thus conclude that cells that are KO for UbKEKS are not likely to have remnants of UbKEKS, which was also confirmed by genomic sequencing.
Discussion
Here, we establish that UBBP4 is a genuine protein-coding gene with two functional ORFs encoding Ub variants. In particular, our results strongly suggest that UbKEKS does not target proteins for degradation by the proteasome, but modifies proteins, including lamins which localization are different in the absence of UbKEKS. The identification and demonstration that a pseudogene for ubiquitin can encode functional modifiers that are slightly different obviously raises several interesting biochemical questions about UbKEKS. Engineered ubiquitin variants have been developed as probes to determine interaction with components of different proteins involved in the ubiquitin system54. These mutagenesis studies revealed several substitution that were important for interaction with UBDs, but also to generate potent inhibitors of E3 ligases and DUBs55,56. Interestingly, while the residues that are different between Ub and UbKEKS do not appear critical for the HECHT or RING E3 ligases, residues 2 and 49 are important for USP binding57, which could suggest partial resistance to Ub-specific proteases.
Considering the breadth of functions associated with the different polyubiquitin chains, the presence of two additional lysines (K2 and K49) raises the possibility of chains with different functions. It is possible to identify sites of modification of ubiquitin by analyzing the diglycine remnant on lysines following trypsin digestion by MS. Analysis of the immunoprecipitates followed by MS identification of proteins in cells transfected with UbKEKS using diglycine modification of lysines as a variable modification did identify K49, as well as K48/K49 modified UbKEKS-specific peptides, supporting the formation of different ubiquitin chains (see peptides file, PRIDE repository). Interpretation of the signals encoded by ubiquitylation depends on the recognition of mono-Ub or Ub-chains through UBDs10,11,58. The observation that UbKEKS does not promote proteasomal degradation like Ub may be the result of a loss of recognition by the proteasome receptors, the presence of K49, or chains forming on K49. Another interesting observation is the possibility that UbKEKS acts as a Ub-chain terminator like SUMO159. This could be consistent with the much lower amount of UbKEKS compared with Ub (approximately a 700-fold difference), which is also the case for SUMO1 compared with SUMO2 and SUMO3, but to a lesser extent53. This is suggested by the presence of more defined UbKEKS chains at +1 and +2 on lamins compared with Ub, which presents higher molecular weights modifications indicative of poly-Ub chains (Fig. 4a, b).
The specificity for target proteins modified by UbKEKS compared with Ub as demonstrated by the different protein profiles seen by immunoblotting of cell extracts transfected by both (Fig. 2c, d), as well as by identification of modified proteins by MS (Fig. 3), suggest that the machinery involved in the modification can differentiate between the two ubiquitin variants. It will certainly be interesting to identify whether some E2 or E3 enzymes have different affinity for ubiquitin variants, and therefore can preferentially attach one of the variant instead of Ub. The large difference in stoichiometry between Ub and UbKEKS would suggest that such an E2 or E3 would have a much higher affinity for UbKEKS, and it remains to be seen whether a subset of those enzymes are specific for UbKEKS, or whether a yet undiscovered domain will be identified. Several proteins modified by UbKEKS were identified (Fig. 3), such as lamins, PCNA and histones, but also several E2 and E3 ligases. For example, Ubr5, an E3 ligase, acts as a regulator of DNA damage response by acting as a suppressor of RNF168, an E3 ubiquitin ligase that promotes accumulation of Lys-63-linked histone H2A and H2AX at DNA damage sites. Interestingly, histone H2A was identified as one of the top candidates after PCNA and lamins in our SILAC AP-MS experiment (Fig. 3), suggesting a role in the regulation of recognition and signaling of DNA damage. Another E3 ligase identified, RNF138, has recently been involved in DNA repair60. In their study, the authors performed a MS experiment to identify proteins interacting with RNF138, and identified UBBP4 as their top hit (their Supplementary Data 1), suggesting that RNF138 could be an E3 ligase specific for UbKEKS.
The quantification of Ub and UbKEKS on lamin A and B2 suggest that those proteins are modified mostly by ubiquitin by a ratio of 20:1. However, the amount of UbKEKS is much higher on lamins when compared with the amount of Ub:UbKEKS in cells which is 700:1, confirming that lamins can be specifically targeted for modification by UbKEKS. At least 20 ubiquitylation sites on lamin A have been identified in large-scale studies61, and it is not possible to determine at this point whether one of them is a specific site for UbKEKS, or whether UbKEKS competes with Ub for modification of lamins. Several E3 ligases have been identified that are able to modify lamins, including RNF12349 and HECW250. Overexpression of RNF123 results in delayed cell-cycle progression, and HECW2 has also been shown to target PCNA, which was also identified as a protein modified by UbKEKS.
The fact that the identification of diglycine residues on lysines by MS, and that antibodies recognizing ubiquitin are also likely cross-reacting with UbKEKS suggest that other proteins reported as modified by Ub could be instead modified by UbKEKS (Fig. 3c, d and Supplementary Data 1) as well as other ubiquitin variants (Supplementary Fig. 11). Indeed, at least five other Ub pseudogenes (UBA52P6, RP11-367G18.2, UBBP3, CTD-3214H19, and RPS27AP1) have strong evidences at the mRNA or protein levels for the expression of unique ubiquitin variants, adding to the potential complexity of this modification. In addition to showing that the diversity of the Ub code has been underestimated, our results are a reminder that proteins coded in genes and transcripts originally annotated as noncoding remain to be discovered36.
Methods
Sequencing of UBBP4 from genomic DNA and mRNA
Genomic DNA was extracted using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich), and RNA was isolated using TRIzol Reagent (Invitrogen) from one 100 mm petri cultures of 293, U2OS or HeLa cells. The isolated RNA was reversed transcribed using 1 μg of RNA and 50 μM oligo-dT with the ProtoScript II reverse transcriptase (New England Biolabs), and incubated at 42 °C for 60 min. The genomic DNA specific to UBBP4 was amplified by PCR using a first oligonucleotide within the intron, and a second oligonucleotide 3′ of the exon 2 within the noncoding genomic region (see Supplementary Fig. 4) (ATCTAGGTCAAAATGCGGATCTTCGT and ATGACAAAACACCAAGTATGCTACCATT). The amplified expected product of the genomic DNA is 1092 base pairs. The reversed transcribed mRNA including both exons was amplified using oligonucleotides from the 5′ to the 3′ untranslated regions of the mRNA (GCTGGTGCTGCAAGAAAGTT and TGCTACCATTCAACGAAACCT). The spliced sequence expected is 1456 base pairs.
Following PCR amplification, the products were separated on 1% agarose gels, and the DNA of the expected size were cut and extracted, followed by blunt cloning into pUC19 digested with SmaI. A blue-white colony selection with X-galactosidase was performed, and ten clones for each cell line were then sequenced (Université Laval Sequencing Platform).
Analysis of expression from RNAseq data
The Expression Atlas (http://www.ebi.ac.uk/gxa)62 containing manually curated RNA-sequencing studies was queried using the human UBA52, RPS27A, and UBB genes as well as the annotated pseudogenes, with data from the GTEx Portal, the Illumina Body Map and the Human Protein Atlas. The expression profile across different tissues using the GTEx Portal data is displayed in transcripts per million or fragments per kilobase of exon model per million reads mapped in Fig. 1 and Supplementary Fig. 1.
Mass spectrometry identification of UBBP4 proteins
Identification of unique peptides specific for pseudogenes or alternative ORFs was performed by re-analyzing previous proteomics experiments with an extended database including these additional putative proteins using available data from several large-scale studies. The information and the peptides identified can be searched in the database OpenProt, which includes all the details regarding the peptides identified25. Only unique peptides were considered valid for the identification of UBBP4 proteins. The studies in which each of the unique peptides were identified are from several independent large-scale experiments39–46.
Cloning and plasmids
HA-Ub or HA-UbKEKS were synthesized as gblocks (Integrated DNA Technologies) and inserted into pcDNA 3.1 (Addgene) in XhoI-BamHI. Ha-UbKEKS has the C-terminal cysteine, which is normally found on the UBBP4 gene. lamin A and B2 were amplified by PCR using oligonucleotides that included AttB recombination sites from a cDNA library generated by RT-PCR with an oligo-dT following isolation of mRNA by Trizol on U2OS cells (see Supplementary Table 2 for oligonucleotide sequences). The PCR product were then incorporated by recombination into pDONR 221 (Life Technologies) using BP recombinase and subsequently into pDEST47 using LR recombinase (Life Technologies).
Cell culture, transfection, and immunoblotting
HEK293, HeLa, or U2OS cells (ATCC CRL-1573, CCL-2, and HTB-96) were grown as adherent cells in Dulbecco’s Modified Eagle Medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (Invitrogen), 100 U/ml penicillin/streptomycin and 2 mM GlutaMax. Cells were transfected with a control plasmid (pcDNA), or plasmids expressing HA-Ub or HA-UbKEKS using Lipofectamine LTX (ThermoFisher Scientific), and treated or not with the proteasome inhibitor MG132 at a final concentration of 5 μM for 24 h. Cells were lysed directly in LDS sample buffer, resolved by SDS-PAGE, and transferred to nitrocellulose. Immunoblotting was performed with either a HA antibody (Invitrogen #26183, 1:1000)) actin antibody (Sigma #A5441, 1:2000) or a GFP antibody (Roche #11814460001, 1:1000). Uncropped scans of all blots can be found in the Source Data file and in Supplementary Fig. 12.
Co-immunoprecipitations
Cells were transfected with GFP-LMNA or GFP-LMNB2 and a control plasmid (pcDNA 3.1), and plasmids expressing HA-Ub or HA-UbKEKS using Effectene (QIAGEN). Following transfection, cells were harvested by scraping in PBS and lysed in high-salt (HS) buffer (1% NP-40, 50 mM Tris ph7.5, 300 mM NaCl, 150 mM KCl, 5 mM EDTA, 1 mM DTT, 10 mM NaF, 10% glycerol, Roche Complete Protease Inhibitor Cocktail) for 10 min on ice. The lysates were then centrifugated for 10 min at 13,000 × g at 4 °C and equal amount of proteins were incubated with GFP-Trap agarose beads from ChromaTek (Martinsried, Germany) for 2 h at 4 °C. Beads were then washed three times with HS buffer.
CRISPR-Cas9-mediated UBBP4 KO
CRISPR-Cas9-mediated UBBP4 KO HeLa cells were generated according to63 the minor modifications. Briefly, sgRNAs were designed using the Broad Institute sgRNA Designer (CRISPRko) tool (http://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design)64. Good sgRNA candidates were further confirmed with the CCTOP tool (http://crispr.cos.uni-heidelberg.de/)65 and were verified to not have predicted off target within UBB, UBC, UBA52, and RPS27, as well as other UBB pseudogenes. For sgRNA-sequences, see Supplementary Table 2. The sgRNA inserts were prepared by annealing the top and bottom oligos and cloned into the pSpCas9(BB)-2A-GFP plasmid (Addgene #48138, Cambridge, MA)63. The resulting plasmids were verified by sequencing. Two strategies using pairs of sgRNAs designed to excise the CDS of UBBP4 were used (Fig. 4c). Enrichment for Cas9–2A-GFP expressing cells and isolation of clonal cell populations were performed 24 h after transfection by single-cell FACS sorting. Successfully edited clones KO for UBBP4 were confirmed by PCR and sequencing. Genomic DNA was amplified with oligonucleotides spanning the edited/deleted genomic regions (Supplementary Data 2). Clones producing PCR products with the expected sizes according to the planned deletions were directle sequenced. CRISPR-ID66 and TIDE67 were then used to confirm the complete KO.
Carboxyfluorescein succinimidyl ester cell growth assay
The control and KO cells lines were labeled with the cell proliferation tracer carboxyfluorescein succinimidyl ester (CFSE) (Biolegend). A total of 125,000 cells were resuspended in 1 ml PBS and 1 ml of PBS containing 10 μM of CFSE was added. The cells were incubated at 37 °C for 20 min and the incorporation was stopped by adding 10 ml of complete DMEM as described above. Following centrifugation, the supernatant was removed and the cells were resuspended in complete DMEM, incubated for 10 min at room temperature and the cells were seeded into 60 mm dishes. At each time point (24, 48, 72, and 96 h), the cells were harvested using 500 μl of trypsin followed by two washes with ice-cold PBS. The cells were fixed in 100% ethanol and conserved at −20 °C. The quantification of CFSE was measured by flow cytometry (BD Fortessa cytometer, Becton Dickinson) and the analysis was achieved with the FlowJo software (LLC).
Immunofluorescence
Cells (15 × 103) were seeded onto glass coverslips and grown for 24 h. Cells were rinsed twice with ice-cold PBS, fixed with 4% paraformaldehyde in PBS for 20 min on ice and washed twice with PBS. The cells were permeabilized with 0.15% Triton X-100 in PBS for 5 min and incubated with 10% goat serum in PBS for 20 min. The cells were then incubated in primary antibodies overnight for LMNA (Abcam #ab133256, 1:1000) and HA (Invitrogen #26183, 1:1000) or 2 h for Nucleolin (Abcam #ab136649, 1:2000) at room temperature in 10% goat serum in PBS. The cells were rinsed twice with PBS and incubated with AlexaFluor 488 goat anti-mouse (Invitrogen #A11001, 1:800) or anti-rabbit (Invitrogen #A11008, 1:800) at room temperature for 1 h. Following two PBS washes, the nuclei were stained by DAPI (1 μg/μl) for 10 min at room temperature, washed twice with PBS mounted with Immuno-mount (ThermoFisher Scientific). The quantification of nucleoli area was achieved with CellProfiler (https://cellprofiler.org/). Briefly, the nuclei and nucleoli were identified through a primary object identification module using DAPI and Nucleolin staining, respectively. Each nucleolus was reported to the parental nucleus with the related objects module and the area was determine using the Measure object size shape module.
Identification of Ub and UbKEKS modified proteins
HeLa cells were grown in DMEM depleted of arginine and lysine (Life Technologies A14431-01) and supplemented with 10% dialyzed fetal bovine serum (Invitrogen, 26400-044), 100 U/ml penicillin/streptomycin and 2 mM GlutaMax. Arginine and lysine were added in either light (Arg 0, Sigma, A5006; Lys 0, Sigma, L5501), medium (Arg 6, Cambridge Isotope Lab (CIL), CNM-2265; Lys 4, CIL, DLM-2640), or heavy (Arg 10, CIL, CNLM-539; Lys 8, CIL, CNLM-291) form to a final concentration of 28 μg/ml for arginine and 49 μg/ml for lysine. L-proline was added to a final concentration of 10 μg/ml to prevent arginine to proline conversion. Cells grown in each SILAC medium were transfected with a control plasmid (pcDNA), or plasmids expressing HA-Ub or HA-UbKEKS using GeneCellin (Bulldog Bio). Following transfection, cells were harvested separately by scraping in PBS, and then lysed in HS buffer (1% NP-40, 50 mM Tris ph7.5, 300 mM NaCl, 150 mM KCl, 5 mM EDTA, 1 mM DTT, 10 mM NaF, 10% glycerol, Roche Complete Protease Inhibitor Cocktail) for 10 min on ice. Alternatively, cells were lysed in denaturing buffer (2% SDS, 150 mM NaCl, 10 mM Tris-HCl, pH 8.0 with 2 mM sodium orthovanadate, 50 mM sodium fluoride, and Roche Complete Protease Inhibitor Cocktail), incubated at 95 °C for 10 min, sonicated and diluted with nine volumes of dilution buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton). The lysates were then centrifuged for 10 min at 13,000 × g at 4 °C and equal amount of proteins were incubated with an HA antibody (12CA5 monoclonal antibody, Millipore Sigma #11583816001) for 2 h at 4 °C. Beads were then washed three times with IP buffer and two times with PBS. After the last wash, the beads from the three SILAC conditions were resuspended in PBS and combined before removing the remaining PBS. The beads were then resuspended in sample buffer and processed for on-beads digestion. For each immunoprecipitations, proteins on beads were reduced in 10 mM DTT, boiled and alkylated in 15 mM iodoacetamide. The proteins were digested overnight with trypsin (Trypsin Gold, Mass Spectrometry Grade, Promega Corporation, WI, USA). The resulting tryptic peptides were extracted by 1% formic acid, then 60% CH3CN/0.1% formic acid, lyophilized in a speedvac, and resuspended in 1% formic acid. These experiments were performed in biological triplicates (n = 3).
SILAC-based quantitative proteomics
Trypsin-digested peptides were loaded and separated onto a nanoHPLC system (Dionex Ultimate 3000). A total of 10 µl of the sample (2 µg) was first loaded with a constant flow of 4 µl/min onto a trap column (Acclaim PepMap100 C18 column, 0.3 mm id × 5 mm, Dionex Corporation, Sunnyvale, CA). Peptides were then eluted off towards an analytical column heated to 40 °C (PepMap C18 nano column (75 µm × 50 cm)) with a linear gradient of 5–35% of solvent B (90% acetonitrile with 0.1% formic acid) over a 4 h gradient at a constant flow (200 nl/min). Peptides were then analyzed by an OrbiTrap QExactive mass spectrometer (Thermo Fischer Scientific Inc.) using an EasySpray source at a voltage of 2.0 kV. Acquisition of the full scan MS survey spectra (m/z 350–1600) in profile mode was performed in the Orbitrap at a resolution of 70,000 using 1,000,000 ions. Peptides selected for fragmentation by collision-induced dissociation were based on the ten highest intensities for the peptide ions from the MS survey scan. The collision energy was set at 35% and resolution for the MS/MS was set at 17,500 for 50,000 ions with maximum filling times of 250 ms for the full scans and 60 ms for the MS/MS scans. All unassigned charge states as well as singly, seven and eight charged species for the precursor ions were rejected, and a dynamic exclusion list was set to 500 entries with a retention time of 40 s (10 ppm mass window). To improve the mass accuracy of survey scans, the lock mass option was enabled. Data acquisition was done using Xcalibur version 2.2 SP1.48. Identification and quantification of proteins identified by MS were done using the MaxQuant software version 1.5.2.868. Biological replicates were done three times and combined together for the MaxQuant analysis. Quantification was done with light (Lys 0 and Arg 0), medium (Lys 4 and Arg 6), and heavy (Lys 8 and Arg 10) labels and considering a trypsin digestion of the peptides with no cleavages on lysine or arginine before a proline. A maximum of two missed cleavages were allowed with methionine oxidation and protein N-terminal acetylation as variable modifications of proteins and carbamidomethylation as fixed modification. The maximum number of modifications allowed per peptide was set to five. Mass tolerance was set to a maximum of 7 ppm for the precursor ions and 20 ppm for the fragment ions. The minimum length of peptides to be considered for quantification was set to seven amino acids and the false discovery rate threshold set to 5%. The minimum number of peptides to be used for the identification of proteins was set to one but only proteins identified with two or more peptides were considered in further analysis. Protein quantification was calculated using both unique and razor peptides. Significant enrichment was performed using a Student t test with a cutoff of p < 0.01.
Absolute quantification of Ub and UbKEKS in cell extracts
Exponentially growing HeLa WT cells were lysed in 8 M urea (in 10 mM HEPES). A total of 100 μg of the cell extracts were reduced in 10 mM DTT, boiled and alkylated in 7.5 mM 2-Chloroacetamide for 30 min in dark. The urea concentration in the lysate was reduced to 2 M with the addition of 50 mM NH4HCO3 and the samples were subjected to overnight trypsin digest (Trypsin Gold, MS Grade, Promega Corporation, WI, USA). Following digestion the extracted peptides were desalted using zip-tips, dried in speedvac and resuspended in 1% formic acid.
For quantification on a TimsTOF Pro mass spectrometer, samples were first loaded by HPLC (nanoElute, Bruker Daltonics) with a constant flow of 4 µl/min onto a trap column (Acclaim PepMap100 C18 column, 0.3 mm id × 5 mm, Dionex Corporation, Sunnyvale, CA). Peptides were then eluted off towards an analytical column heated to 50 °C (PepSep C18 ReproSil AQ column (75 µm × 25 cm, 1.9 µm beads size)) with a linear gradient of 5–30% of solvent B (100% acetonitrile with 0.1% formic acid) over a 30-min gradient at a constant flow (500 nl/min). Peptides were then analyzed by a TimsTOF Pro mass spectrometer (Bruker Daltonics) using a CaptiveSpray nano electrospray source at a voltage of 1.6 kV. Data were acquired using data-dependent auto-MS/MS with a 100–1700 m/z mass range, with MRM enabled, m/z dependent isolation window and collision energy of 42.0 eV. An inclusion list containing the m/z values corresponding to the monoisotopic form of the heavy and light peptides of Ub (520.2/525.2) and UbKEKS (762.8/767.8) was generated. The target intensity was set to 20,000, with an intensity threshold of 2500.
For quantification on a triple-quadrupole mass spectrometer, samples were reconstituted in 20 μl H2O with 3% DMSO and 0.2% formic acid, including 5.3 ng/ml Ub internal standard (IS) peptide and 1.53 ng/ml UbKEKS IS peptide. Cell lysates were cleaned on Strata-X reversed phase SPE (Phenomenex) with added IS peptides (to get final concentrations 5.3 ng/ml Ub and 1.53 ng/ml UbKEKS). Dried samples were reconstituted in 20 µl H2O with 3% DMSO and 0.2% formic acid. Acquisition was performed with a Shimadzu LCMS-8060 (Shimadzu, Kyoto, Japan) equipped with an electrospray interface, a 100 μm ID capillary and coupled to a Nexera XR (Shimadzu, Kyoto, Japan). LabSolution v5.93 software was used to control the instrument and for data processing and acquisition. Separation was performed on a reversed phase aeris peptide C18 100 mm × 2.1 mm (Phenomenex) over a 10-min gradient of 2–55% of solvent B (acetonitrile with 0.2% formic acid and 3% DMSO v/v). Optimized MRM parameters were used to monitor Ub and UbKEKS.
For quantification on an OrbiTrap mass spectrometer, peptides were loaded and separated onto a nanoHPLC system (Dionex Ultimate 3000) with a constant flow of 4 µl/min onto a trap column (Acclaim PepMap100 C18 column, 0.3 mm id × 5 mm, Dionex Corporation, Sunnyvale, CA). Peptides were then eluted off towards an analytical column heated to 40 °C (PepMap C18 nano column (75 µm × 25 cm)) with a linear gradient of 5–45% of solvent B (80% acetonitrile with 0.1% formic acid) over a 42-min gradient at a constant flow (450 nl/min). Peptides were analyzed on an OrbiTrap QExactive (Thermo Fischer Scientific) spectrometer using PRM method. Acquisition of the MS/MS spectra (m/z 350–1600) was performed in the Orbitrap. An inclusion list containing the m/z values corresponding to the monoisotopic form of the normal and equivalent AQUA peptides of Ub (520.2/525.2) and UbKEKS (762.8/767.8) was generated (heavy Arginine (U-13C6, 15N4; mass difference: +10 Da) labeled AQUA Ub (EGIPPDQQR) and UbKEKS (IQDEEGIPPDQQR) peptides (Thermo Fischer Scientific)). The collision energy was set at 28% and resolution for the MS/MS was set at 140,000 for 1,000,000 ions with maximum filling times of 250 ms with an insulation width of 0.6. Data acquisition was done using Xcalibur version 3.1.66.10.
Absolute quantification of Ub and UbKEKS on lamin A and B2
Transient transfection was performed on wild type and UbKEKS KO HeLa cells (clone 4.3) with either GFP-LMNA or GFP-LMNB2. After 48 h of transfection, cells were harvested and lysed in HS buffer for 30 min rotating at 4 °C. The lysates were then centrifuged for 10 min at 13,000 × g at 4 °C and equal amount of proteins were incubated with GFP-Trap agarose beads from (ChromoTek) overnight. Following washes elution was performed using 2xLaemli buffer supplemented with 10 mM DTT and boiled for 5 min at 95 °C. Samples were then alkylated using 50 mM 2-Chloroacetamide for 30 min in dark. Following alkylation samples were loaded on 4–12% gradient SDS-PAGE gels and proteins were separated for 45 min. After separation the gel was stained with SimplyBlue SafeStain (Invitrogen) and destained in dH2O overnight. Gel regions corresponding to the approximate molecular weight of monoubiquitylated GFP-LMNA or GFP-LMNB2 were excised and in-gel trypsin digestion was performed. Following digestion the extracted peptides were desalted using zip-tips, dried in speedvac and resuspended in 1% formic acid. Heavy Arginine (U-13C6, 15N4; mass difference: +10 Da) labeled AQUA Ub (EGIPPDQQR) and UbKEKS (IQDEEGIPPDQQR) peptides (Thermo Fischer Scientific) were spiked into the samples at a final concentration of 1.66 fmol/μl. Peptides were loaded and separated onto a nanoHPLC system (Dionex Ultimate 3000) with a constant flow of 4 µl/min onto a trap column (Acclaim PepMap100 C18 column, 0.3 mm id × 5 mm, Dionex Corporation, Sunnyvale, CA). Peptides were then eluted off towards an analytical column heated to 40 °C (PepMap C18 nano column (75 µm × 25 cm)) with a linear gradient of 5–45% of solvent B (80% acetonitrile with 0.1% formic acid) over a 42-min gradient at a constant flow (450 nl/min). Peptides were analyzed on an OrbiTrap QExactive (Thermo Fischer Scientific) spectrometer using PRM method. Acquisition of the MS/MS spectra (m/z 350–1600) was performed in the Orbitrap. An inclusion list containing the m/z values corresponding to the monoisotopic form of the heavy and light peptides of Ub (520.2/525.2) and UbKEKS (762.8/767.8) was generated. The collision energy was set at 28% and resolution for the MS/MS was set at 140,000 for 1,000,000 ions with maximum filling times of 250 ms with an insulation width of 0.6. Data acquisition was done using Xcalibur version 3.1.66.10.
Identification and quantification of Ub and UbKEKS peptides was performed on Skyline software (19.1.0.193)69. For quantification only the most intense fragment ion (y6) was used for both peptides. The amount of Ub and UbKEKS proteins were calculated using the light to heavy peptide ratio.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Supplementary information
Acknowledgements
We thank the proteomics facility of the Université de Sherbrooke for assistance with mass spectrometry. M.-L.D. is a recipient of an Alexander Graham Bell NSERC studentship. F.-M.B is a recipient of a FRQS Junior 2 scholarship. X.R. is a recipient of a Canada Research Chair in Functional Proteomics and Discovery of Novel Proteins. Funding was provided from the Canadian Institutes for Health Research, grant number #398925 to P.L., X.R., and F.-M.B. Authors P.L., X.R., M.S.S., and F.M.B. are members of the FRQS-funded “Centre de Recherche du CHUS”.
Source Data
Author contributions
S.S., M.S.S., F.-M.B., and X.R. made the initial discovery of UBBP4 as a potentially expressed protein. M.-L.D., F.-M.B., and X.R. designed the experimental approaches. M.-L.D. and F.-M.B. prepared Fig. 1. F.-M.B. prepared Fig. 2a, b and Supplementary Figs. 1–3, 5. M.-L.D. performed the experiments in Figs. 2c, d, 3b, and 4b–g and Supplementary Fig. 6. A.M. performed all the absolute quantification, including Fig. 5 and Supplementary Fig. 9, as well as the rescue in Supplementary Fig. 8. M.C.B. performed Fig. 3a. M.A.B. and J.-F.J. performed the experiment in Fig. 2e. M.A.B. performed the statistical analysis of Fig. 3c and Supplementary Data 1. M.B. generated the CRISPR KO cells. J.F. performed the experiment in Fig. 4a. A.T. performed the experiment in Supplementary Fig. 4. S.S. prepared Supplementary Fig. 7. D.L. prepared some of the plasmids used in this study and setup the CFSE cell growth assays. F.-M.B. and M.-L.D. wrote the main paper text.
Data availability
The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD014318. The source data underlying Figs. 2c–e, 3a, 4a, b, d–g, 5c, and Supplementary Fig. 8 are provided as a Source Data file. All other data are available from the corresponding authors on reasonable request.
Competing interests
The authors declare no competing interests.
Footnotes
Peer review information Nature Communications thanks the anonymous reviewers for their contribution to the pee review of this work. Peer reviewer reports are available.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Xavier Roucou, Email: xavier.roucou@usherbrooke.ca.
François-Michel Boisvert, Email: fm.boisvert@usherbrooke.ca.
Supplementary information
Supplementary information is available for this paper at 10.1038/s41467-020-15090-6.
References
- 1.Hershko A, Ciechanover A. Mechanisms of intracellular protein breakdown. Annu. Rev. Biochem. 1982;51:335–364. doi: 10.1146/annurev.bi.51.070182.002003. [DOI] [PubMed] [Google Scholar]
- 2.Komander D, Rape M. The ubiquitin code. Annu. Rev. Biochem. 2012;81:203–229. doi: 10.1146/annurev-biochem-060310-170328. [DOI] [PubMed] [Google Scholar]
- 3.Ciechanover A, Elias S, Heller H, Hershko A. “Covalent affinity” purification of ubiquitin-activating enzyme. J. Biol. Chem. 1982;257:2537–2542. [PubMed] [Google Scholar]
- 4.Hershko A, Heller H, Elias S, Ciechanover A. Components of ubiquitin-protein ligase system. Resolution, affinity purification, and role in protein breakdown. J. Biol. Chem. 1983;258:8206–8214. [PubMed] [Google Scholar]
- 5.Sun Y. E3 ubiquitin ligases as cancer targets and biomarkers. Neoplasia. 2006;8:645–654. doi: 10.1593/neo.06376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yau R, Rape M. The increasing complexity of the ubiquitin code. Nat. Cell Biol. 2016;18:579–586. doi: 10.1038/ncb3358. [DOI] [PubMed] [Google Scholar]
- 7.Wit N, et al. Roles of PCNA ubiquitination and TLS polymerases kappa and eta in the bypass of methyl methanesulfonate-induced DNA damage. Nucleic Acids Res. 2015;43:282–294. doi: 10.1093/nar/gku1301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hochstrasser M. Ubiquitin signalling: what’s in a chain? Nat. Cell Biol. 2004;6:571–572. doi: 10.1038/ncb0704-571. [DOI] [PubMed] [Google Scholar]
- 9.Mattiroli F, Sixma TK. Lysine-targeting specificity in ubiquitin and ubiquitin-like modification pathways. Nat. Struct. Mol. Biol. 2014;21:308–316. doi: 10.1038/nsmb.2792. [DOI] [PubMed] [Google Scholar]
- 10.Husnjak K, Dikic I. Ubiquitin-binding proteins: decoders of ubiquitin-mediated cellular functions. Annu Rev. Biochem. 2012;81:291–322. doi: 10.1146/annurev-biochem-051810-094654. [DOI] [PubMed] [Google Scholar]
- 11.Dikic I, Wakatsuki S, Walters KJ. Ubiquitin-binding domains—from structures to functions. Nat. Rev. Mol. Cell Biol. 2009;10:659–671. doi: 10.1038/nrm2767. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wilkinson KA, Henley JM. Mechanisms, regulation and consequences of protein SUMOylation. Biochem. J. 2010;428:133–145. doi: 10.1042/BJ20100158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bayer P, et al. Structure determination of the small ubiquitin-related modifier SUMO-1. J. Mol. Biol. 1998;280:275–286. doi: 10.1006/jmbi.1998.1839. [DOI] [PubMed] [Google Scholar]
- 14.Redman KL, Rechsteiner M. Identification of the long ubiquitin extension as ribosomal protein S27a. Nature. 1989;338:438–440. doi: 10.1038/338438a0. [DOI] [PubMed] [Google Scholar]
- 15.Webb GC, Baker RT, Coggan M, Board PG. Localization of the human UBA52 ubiquitin fusion gene to chromosome band 19p13.1-p12. Genomics. 1994;19:567–569. doi: 10.1006/geno.1994.1108. [DOI] [PubMed] [Google Scholar]
- 16.Wiborg O, et al. The human ubiquitin multigene family: some genes contain multiple directly repeated ubiquitin coding sequences. EMBO J. 1985;4:755–759. doi: 10.1002/j.1460-2075.1985.tb03693.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Nijman SM, et al. A genomic and functional inventory of deubiquitinating enzymes. Cell. 2005;123:773–786. doi: 10.1016/j.cell.2005.11.007. [DOI] [PubMed] [Google Scholar]
- 18.Baker RT, Board PG. The human ubiquitin gene family: structure of a gene and pseudogenes from the Ub B subfamily. Nucleic Acids Res. 1987;15:443–463. doi: 10.1093/nar/15.2.443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Pink RC, et al. Pseudogenes: pseudo-functional or key regulators in health and disease? RNA. 2011;17:792–798. doi: 10.1261/rna.2658311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Aspden JL, et al. Extensive translation of small open reading frames revealed by Poly-Ribo-Seq. Elife. 2014;3:e03528. doi: 10.7554/eLife.03528. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Delcourt V, Staskevicius A, Salzet M, Fournier I, Roucou X. Small proteins encoded by unannotated ORFs are rising stars of the proteome, confirming shortcomings in genome annotations and current vision of an mRNA. Proteomics. 2017;18:e1700058. doi: 10.1002/pmic.201700058. [DOI] [PubMed] [Google Scholar]
- 22.Ji Z, Song R, Regev A, Struhl K. Many lncRNAs, 5’UTRs, and pseudogenes are translated and some are likely to express functional proteins. Elife. 2015;4:e08890. doi: 10.7554/eLife.08890. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Nesvizhskii AI. Proteogenomics: concepts, applications and computational strategies. Nat. Methods. 2014;11:1114–1125. doi: 10.1038/nmeth.3144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Vanderperre B, et al. Direct detection of alternative open reading frames translation products in human significantly expands the proteome. PLoS ONE. 2013;8:e70698. doi: 10.1371/journal.pone.0070698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Samandi S, et al. Deep transcriptome annotation enables the discovery and functional characterization of cryptic small proteins. Elife. 2017;6:1–32. doi: 10.7554/eLife.27860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Brosch M, et al. Shotgun proteomics aids discovery of novel protein-coding genes, alternative splicing, and “resurrected” pseudogenes in the mouse genome. Genome Res. 2011;21:756–767. doi: 10.1101/gr.114272.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Couso JP, Patraquim P. Classification and function of small open reading frames. Nat. Rev. Mol. Cell Biol. 2017;18:575–589. doi: 10.1038/nrm.2017.58. [DOI] [PubMed] [Google Scholar]
- 28.Na CH, et al. Discovery of noncanonical translation initiation sites through mass spectrometric analysis of protein N termini. Genome Res. 2018;28:25–36. doi: 10.1101/gr.226050.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kim MS, et al. A draft map of the human proteome. Nature. 2014;509:575–581. doi: 10.1038/nature13302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Xu J, Zhang J. Are human translated pseudogenes functional? Mol. Biol. Evol. 2016;33:755–760. doi: 10.1093/molbev/msv268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Petryszak R, et al. Expression Atlas update-an integrated database of gene and protein expression in humans, animals and plants. Nucleic Acids Res. 2016;44:D746–D752. doi: 10.1093/nar/gkv1045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Cowland JB, Wiborg O, Vuust J. Human ubiquitin genes: one member of the UbB gene subfamily is a tetrameric non-processed pseudogene. FEBS Lett. 1988;231:187–191. doi: 10.1016/0014-5793(88)80728-2. [DOI] [PubMed] [Google Scholar]
- 33.Salvesen G, Lloyd C, Farley D. cDNA encoding a human homolog of yeast ubiquitin 1. Nucleic Acids Res. 1987;15:5485. doi: 10.1093/nar/15.13.5485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Harrison PM, Zheng D, Zhang Z, Carriero N, Gerstein M. Transcribed processed pseudogenes in the human genome: an intermediate form of expressed retrosequence lacking protein-coding ability. Nucleic Acids Res. 2005;33:2374–2383. doi: 10.1093/nar/gki531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zerbino DR, et al. Ensembl 2018. Nucleic Acids Res. 2018;46:D754–D761. doi: 10.1093/nar/gkx1098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Brunet MA, et al. OpenProt: a more comprehensive guide to explore eukaryotic coding potential and proteomes. Nucleic Acids Res. 2019;47:D403–D410. doi: 10.1093/nar/gky936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Consortium EP. An integrated encyclopedia of DNA elements in the human genome. Nature. 2012;489:57–74. doi: 10.1038/nature11247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Michel AM, et al. GWIPS-viz: development of a ribo-seq genome browser. Nucleic Acids Res. 2014;42:D859–D864. doi: 10.1093/nar/gkt1035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Battle A, et al. Genomic variation. Impact of regulatory variation from RNA to protein. Science. 2015;347:664–667. doi: 10.1126/science.1260793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Floyd BJ, et al. Mitochondrial protein interaction mapping identifies regulators of respiratory chain function. Mol. Cell. 2016;63:621–632. doi: 10.1016/j.molcel.2016.06.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Hurwitz SN, et al. Proteomic profiling of NCI-60 extracellular vesicles uncovers common protein cargo and cancer type-specific biomarkers. Oncotarget. 2016;7:86999–87015. doi: 10.18632/oncotarget.13569. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Huttlin EL, et al. Architecture of the human interactome defines protein communities and disease networks. Nature. 2017;545:505–509. doi: 10.1038/nature22366. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Huttlin EL, et al. The BioPlex network: a systematic exploration of the human interactome. Cell. 2015;162:425–440. doi: 10.1016/j.cell.2015.06.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Lawrence RT, et al. The proteomic landscape of triple-negative breast cancer. Cell Rep. 2015;11:990. doi: 10.1016/j.celrep.2015.04.059. [DOI] [PubMed] [Google Scholar]
- 45.Park JM, et al. Integrated analysis of global proteome, phosphoproteome, and glycoproteome enables complementary interpretation of disease-related protein networks. Sci. Rep. 2015;5:18189. doi: 10.1038/srep18189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Zhang H, et al. Integrated proteogenomic characterization of human high-grade serous ovarian cancer. Cell. 2016;166:755–765. doi: 10.1016/j.cell.2016.05.069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Akutsu M, Dikic I, Bremm A. Ubiquitin chain diversity at a glance. J. Cell Sci. 2016;129:875–880. doi: 10.1242/jcs.183954. [DOI] [PubMed] [Google Scholar]
- 48.de Leeuw R, Gruenbaum Y, Medalia O. Nuclear lamins: thin filaments with major functions. Trends Cell Biol. 2018;28:34–45. doi: 10.1016/j.tcb.2017.08.004. [DOI] [PubMed] [Google Scholar]
- 49.Khanna R, Krishnamoorthy V, Parnaik VK. E3 ubiquitin ligase RNF123 targets lamin B1 and lamin-binding proteins. FEBS J. 2018;285:2243–2262. doi: 10.1111/febs.14477. [DOI] [PubMed] [Google Scholar]
- 50.Krishnamoorthy V, Khanna R, Parnaik VK. E3 ubiquitin ligase HECW2 targets PCNA and lamin B1. Biochim. Biophys. Acta Mol. Cell Res. 2018;1865:1088–1104. doi: 10.1016/j.bbamcr.2018.05.008. [DOI] [PubMed] [Google Scholar]
- 51.Gerber SA, Rush J, Stemman O, Kirschner MW, Gygi SP. Absolute quantification of proteins and phosphoproteins from cell lysates by tandem MS. Proc. Natl Acad. Sci. USA. 2003;100:6940–6945. doi: 10.1073/pnas.0832254100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Kaiser SE, et al. Protein standard absolute quantification (PSAQ) method for the measurement of cellular ubiquitin pools. Nat. Methods. 2011;8:691–696. doi: 10.1038/nmeth.1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Yang X, et al. Absolute quantification of E1, ubiquitin-like proteins and Nedd8-MLN4924 adduct by mass spectrometry. Cell Biochem. Biophys. 2013;67:139–147. doi: 10.1007/s12013-013-9625-5. [DOI] [PubMed] [Google Scholar]
- 54.Zhang W, Sidhu SS. Generating intracellular modulators of E3 ligases and deubiquitinases from phage-displayed ubiquitin variant libraries. Methods Mol. Biol. 2018;1844:101–119. doi: 10.1007/978-1-4939-8706-1_8. [DOI] [PubMed] [Google Scholar]
- 55.Gorelik M, et al. Inhibition of SCF ubiquitin ligases by engineered ubiquitin variants that target the Cul1 binding site on the Skp1-F-box interface. Proc. Natl Acad. Sci. USA. 2016;113:3527–3532. doi: 10.1073/pnas.1519389113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Zhang W, et al. Potent and selective inhibition of pathogenic viruses by engineered ubiquitin variants. PLoS Pathog. 2017;13:e1006372. doi: 10.1371/journal.ppat.1006372. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Leung I, Dekel A, Shifman JM, Sidhu SS. Saturation scanning of ubiquitin variants reveals a common hot spot for binding to USP2 and USP21. Proc. Natl Acad. Sci. USA. 2016;113:8705–8710. doi: 10.1073/pnas.1524648113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Hurley JH, Lee S, Prag G. Ubiquitin-binding domains. Biochem. J. 2006;399:361–372. doi: 10.1042/BJ20061138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Matic I, et al. In vivo identification of human small ubiquitin-like modifier polymerization sites by high accuracy mass spectrometry and an in vitro to in vivo strategy. Mol. Cell Proteom. 2008;7:132–144. doi: 10.1074/mcp.M700173-MCP200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Ismail IH, et al. The RNF138 E3 ligase displaces Ku to promote DNA end resection and regulate DNA repair pathway choice. Nat. Cell Biol. 2015;17:1446–1457. doi: 10.1038/ncb3259. [DOI] [PubMed] [Google Scholar]
- 61.Kim W, et al. Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol. Cell. 2011;44:325–340. doi: 10.1016/j.molcel.2011.08.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Papatheodorou I, et al. Expression Atlas: gene and protein expression across multiple studies and organisms. Nucleic Acids Res. 2018;46:D246–D251. doi: 10.1093/nar/gkx1158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Ran FA, et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013;8:2281–2308. doi: 10.1038/nprot.2013.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Doench JG, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 2016;34:184–191. doi: 10.1038/nbt.3437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Stemmer M, Thumberger T, Del Sol Keyer M, Wittbrodt J, Mateo JL. CCTop: an intuitive, flexible and reliable CRISPR/Cas9 target prediction tool. PLoS ONE. 2015;10:e0124633. doi: 10.1371/journal.pone.0124633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Dehairs J, Talebi A, Cherifi Y, Swinnen JV. CRISP-ID: decoding CRISPR mediated indels by Sanger sequencing. Sci. Rep. 2016;6:28973. doi: 10.1038/srep28973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014;42:e168. doi: 10.1093/nar/gku936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Cox J, Mann M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008;26:1367–1372. doi: 10.1038/nbt.1511. [DOI] [PubMed] [Google Scholar]
- 69.Pino, L. K. et al. The Skyline ecosystem: informatics for quantitative mass spectrometry proteomics. Mass Spectrom. Rev. 1–16 (2017). [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD014318. The source data underlying Figs. 2c–e, 3a, 4a, b, d–g, 5c, and Supplementary Fig. 8 are provided as a Source Data file. All other data are available from the corresponding authors on reasonable request.