Skip to main content
Data in Brief logoLink to Data in Brief
. 2020 Feb 29;29:105367. doi: 10.1016/j.dib.2020.105367

Data on analysis of OCC-1 transcript levels in pluripotent and differentiated states of P19 cells

Zahra Hosseininia a,b, Sara Soltanian c, Naser Mahdavi-Shahri d, Hesam Dehghani a,b,
PMCID: PMC7068043  PMID: 32190725

Abstract

We investigated the expression of OCC-1 at mRNA level during retinoic acid (RA) induced differentiation of mouse embryonic carcinoma P19 pluripotent cancer cells by quantitative real time PCR (qPCR). By employing four-fold serial dilutions of P19 cDNA, standard curves were generated for the reference gene (L37) and the gene of interest (OCC-1). PCR efficiencies for L37 and OCC-1 were calculated. Since the amplification efficiencies of these two genes were unequal, the standard curve method was used for the relative quantification of OCC-1. Data analysis revealed that the expression of OCC-1 was reduced by about 69% after 4-day treatment with RA, when significant down-regulation of key pluripotency factors, including OCT4 and Nanog was observed [1].

Keywords: OCC-1, P19, Pluripotency, Differentiation, Retinoic acid


Specifications Table

Subject Molecular Biology
Specific subject area Down-regulation of OCC-1 after RA-induced differentiation in P19 cells
Type of data Table
Graph
Figure
Text file
How data were acquired Cell culture, differentiation of P19 cells, RT-PCR, RT-qPCR
Data format Raw and analyzed data
Parameters for data collection Differentiation induction of embryonic carcinoma (EC) P19 cells with retinoic acid (RA).
Description of data collection The expression of OCC-1 was measured in undifferentiated control and RA-induced differentiated P19 cells by RT-qPCR.
Data source location Laboratory of Biotechnology, Division of Biotechnology, Faculty of Veterinary Medicine, AND Research Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad, Iran.
Data accessibility All data are presented in this article
Value of the Data
  • To our knowledge, these data for the first time report the presence and expression of OCC-1 in P19 cells which are pluripotent cancer cells. These data are useful because detection of pluripotency associated genes can serve as markers for evaluating the malignancy status of tumor cells.

  • The data will be valuable for researchers who are interested in identifying new isoforms and functions of mouse OCC-1 and the probable role in cancer and pluripotency state.

  • OCC-1 was reported as a pluripotency-associated gene in human [2] and these data reinforce this relationship in mouse. Thus, these data will stimulate other scientists to reveal the underlying relationship between different isoforms of OCC-1 and pluripotency and probable role of OCC-1 in pluripotency network.

1. Data description

In mouse, the Ensembl database reports three isoforms including two coding (1500009L16Rik-201 and 1500009L16Rik-203) and one non-coding RNA on the chromosome 10 (1500009L16Rik-202) (Fig. 1). The expression of OCC-1 in EC P19 cells was analyzed by RT-PCR. PCR reaction with OCC-1 specific primers yielded a 100-bp fragment which was verified by Sanger sequencing (Fig. 1, and Table 1). In order to quantify and compare the relative mRNA levels of OCC-1 before and after RA-induced differentiation of P19 cells, three biological replicates for both untreated (control) and RA-treated (test) P19 cells were subjected to RNA extraction and cDNA synthesis. Then, quantitative real-time PCR (RT-qPCR) was performed in triplicates (Fig. 2). Fourfold serial dilutions of P19 cDNA was used to generate standard curves for OCC-1 and L37. Slope of standard curves was used to calculate amplification efficiencyies of L37 and OCC-1 (Fig. 3 and Table 2). Data analysis using standard curve method showed that transcript level of OCC-1 was reduced to approximately 69% in 4 day- RA-treated P19 cells in comparison with undifferentiated P19 cells (Fig. 2 and Table 3).

Fig. 1.

Fig. 1

The schematic representation of the OCC-1 gene on the mouse chromosome 10. OCC-1 gene and OCC-1 neighboring genes on chromosome 10 (a, b). Among the three predicted isoforms of OCC-1 gene (c), our PCR reaction could amplify a region from two coding isoforms of 1500009L16Rik-201 and 1500009L16Rik-203. The red arrows show the forward and reverse primers (d). The probe-binding site is shown as a red bar (d).

Table 1.

Sequences of primers and probes used in the study.

Gene Primer and probe sequence (5′–3′) Product length (bp)
Overexpressed in Colon Carcinoma-1 protein (OCC-1)
NM_001145198.1
OCC-1_F: ATGGCGTCTAGTCAAACA
OCC-1_R: CCAAGTTCCTTCCAAATTCA
OCC-1 Probe:
FAM-ATCCAGCCGTCATGTTATCTTCCT-TAMRA
100 bp
Ribosomal protein L37 (Rpl37)
NM_026069.3
L37_F: GCAGATTCAGACATGGATTC
L37_R: GGAAGAAGCGTAGGATCC
L37 Probe:
HEX-TCATATAACCGAACTCTGAACCGATGT-BHQ1
200 bp

Fig. 2.

Fig. 2

OCC-1 copy number before and after RA treatment. Quantitative RT-PCR analysis showed significant down-regulation of OCC-1 copy number after 4 days of RA treatment of P19 cells. The aggregated P19 cells after 4 days of treatment with RA are named EB4. The OCC-1 copy number was normalized by L37 as a reference gene.

Fig. 3.

Fig. 3

Standard curve for OCC-1. A) Standard curve for OCC-1 is drawn by using log copy number (X axes) and CT (Y axes). B) Fourfold serial dilutions of P19 cDNA was used to draw OCC-1 standard curve. Copy number of OCC-1 product in each dilution was calculated according to this estimate that there are 1.9 × 1012 mRNA molecules with an average size of 1000 base in 1 μg of total RNA (Table 2).

Table 2.

Estimation of copy number of OCC-1 and L37.

RNA (Nanogram) aCopy number of mRNA Average size (bp)
(Bustin et al., 1999) 1000 1.9∗10ˆ12 1000
OCC-1 1000 1.9∗10ˆ13 100
L37 1000 0.38∗10ˆ12 200
a

The copy number of amplicons in 1 μg total RNA for each gene is calculated based on the estimation that there are 1.9 × 1012 mRNA molecules with an average size of 1000 base in 1 μg of total RNA (explained in Experimental Design, Materials, and Methods).

Table 3.

Quantification of OCC-1 transcript changes following RA treatment using the standard curve method of relative quantification.

Samplea OCC-1 transcript
L37 transcript
bNorma-lized copy number of OCC-1 (x1000) Average of Norma-lized OCC-1 copy number Fold change of OCC-1 After treatment
cycle threshold (ct) quantity (log copy number) Anti-log of copy number cycle thres-hold (ct) quantity (log copy number) Anti-log of copy number
Untreated P19 1-1 22.50 12.60111421 3.9913E+12 22.86 13.14673291 1.40195E+13 284.69 1745.43 0.3 (69% reduction)
P19 1-1 22.67 12.55376045 3.57899E+12 22.90 13.13468835 1.3636E+13 262.46
P19 1-1 22.68 12.55097493 3.55611E+12 22.43 13.27621198 1.88891E+13 188.26
P19 1-2 22.28 12.66239554 4.59616E+12 25.32 12.40599217 2.54678E+12 1804.69
P19 1-2 21.00 13.0189415 1.04458E+13 25.21 12.43911472 2.74862E+12 4000.46
P19 1-2 20.92 13.04122563 1.09958E+13 25.00 12.50234869 3.17943E+12 3370.81
P19 1-3 20.96 13.03008357 1.07173E+13 25.25 12.42707016 2.67344E+12 4008.79
P19 1-3 22.07 12.72089136 5.25886E+12 23.53 12.94498645 8.81021E+12 596.90

P19 1-3
21.50
12.87966574
7.57994E+12
24.00
12.80346281
6.36008E+12
1191.79

Treated (B4) P19 4-1 23.36 12.36155989 2.29911E+12 23.28 13.02026498 1.04777E+13 219.42 524.08
P19 4-1 22.80 12.51754875 3.29267E+12 23.50 12.95401987 8.99539E+12 366.04
P19 4-1 23.00 12.46183844 2.89627E+12 23.66 12.90584161 8.05085E+12 408.98
P19 4-2 21.79 12.79888579 6.29341E+12 22.10 13.37557964 2.37454E+13 121.97
P19 4-2 22.33 12.64846797 4.45111E+12 21.49 13.55925926 3.62459E+13 122.80
P19 4-2 22.00 12.74038997 5.50035E+12 22.21 13.34245709 2.20017E+13 249.99
P19 4-3 21.65 12.83788301 6.88467E+12 24.31 12.71128018 5.14375E+12 1338.45
P19 4-3 22.29 12.65961003 4.56678E+12 24.18 12.74850653 5.60411E+12 814.89
P19 4-3 22.10 12.71253482 5.15864E+12 24.41 12.68143972 4.80219E+12 1074.22
a

Samples identified as P19 1-1, 1–2 and 1–3 are three replicates of undifferentiated P19 control cells, and samples identified as P19 4–1, 4–2 and 4–3 are three replicates of 4-day RA-treated differentiated aggregates of P19 (EB4) cells.

b

Normalized OCC-1 copy numbers were acquired by dividing OCC-1 transcript copy numbers to L37 transcript copy numbers.

2. Experimental design, materials, and methods

2.1. Cell culture and RA-induced differentiation

P19 cells were obtained from Pasteur Institute (Tehran, Iran). They were subjected to differentiation by seeding at a density of 0.2 × 106 in 8-cm diameter bacteriological petri dishes at the presence of α-MEM medium supplemented with 0.5μM RA. After 4 days of RA treatment, differentiated aggregates (EB4) were formed and used for RNA extraction.

2.2. Quantitative real-time PCR (RT-qPCR)

Total RNA was isolated using the Total RNA Isolation Kit (DENAzist Asia Co., Mashhad, Iran) according to the manufacture's protocol. The quality and quantity of RNA were evaluated by agarose gel electrophoresis and Nanodrop spectrophotometry. First strand cDNA was generated in the presence of 1mM dNTPs, 0.5 μg Oligo(dT)18 primer, 1x reverse transcription buffer, and 200 U of reverse transcriptase in a total volume of 20 μl. The reaction was incubated for 60 min at 42 °C followed by enzyme inactivation at 72 °C for 10 min.

The primers and hydrolysis probes for RT-qPCR were designed using “Beacon Designer” software (Table 1). qPCR reaction was performed in a total volume of 25 μl which contained 1 μl cDNA, 1x PCR buffer, 0.4 mM dNTPs, 1.5 mM MgCl2, 200 nM probe, 200 nM of each primer, and 0.04 U of Taq DNA polymerase in a Rotor Gene Q real time thermocycler (Qiagen, USA). All reaction components were purchased from Genet Bio (Daejeon, South Korea). The thermocycler program for OCC-1 and L37 was an initial step of 94 °C (3 min), followed by 40 cycles of 94 °C (30 s), 58 °C (30 s), and 72 °C (30 s).

In order to calculate the PCR efficiency, standard curves for OCC-1 and L37 were generated by employing fourfold serial dilutions of P19 cDNA. The PCR reactions at each serial dilution were performed in triplicates. It is estimated that there are 1.9 × 1012 mRNA molecules with an average size of 1000 base in 1 μg of total RNA [3]. Accordingly, we estimated the copy number data of amplicons in 1 μg total RNA for each gene (Table 2). The standard curves were plotted with the data of Ct values on the “Y” axis and the log10 copy number of each transcript on the “X” axis (Fig. 3). The slope (S) of the lines were used to calculate PCR efficiencies. The correlation (R2) was 0.99 for OCC-1 and L37 and the amplification efficiencies for OCC-1 and L37 were 89.8% and 100%, respectively. Since the amplification efficiencies of the reference gene (L37) and the gene of interest (OCC-1) were unequal, the standard curve method for relative quantification was used [4].

Three biological replicates were considered for both untreated (control) and RA-treated (test) P19 cells. The value data of Ct for each triplicate was extrapolated onto the standard curve to calculate the copy number data of the transcripts in each group (Table 3). Here, L37 was used as the internal reference gene because its transcription did not change after RA-treatment [1]. To determine changes in the transcript levels of the target gene (OCC-1) after RA treatment, the data were analyzed by the following equations [5]:

 Normalized target (test sample)=Copy number of OCC1Copy number of L37
Normalized target (control sample)=copy number of OCC1copy number of L37
Fold difference in the level of target transcript=Normalized target (test sample)Normalized target (control sample)

As the data in Table 3 indicated, a 69% reduction for OCC-1 was acquired.

2.3. Statistical analysis

A minimum of three replicate experiments were performed for all data. Analysis using Mann Whitney test demonstrated a statistical difference between the control and test groups at a p-value of less than 0.05.

Acknowledgments

This work was supported by a Ferdowsi University of Mashhad grant to HD (No. 22534).

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.dib.2020.105367.

Conflict of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.xml (414B, xml)

References

  • 1.Hosseininia Z., Soltanian S., Mahdavi-shahri N., Dehghani H. Down-regulation of HaIr1 during induced differentiation of embryonal carcinoma P19 cells. Biocell. 2019;43:145–154. [Google Scholar]
  • 2.Guttman M., Donaghey J., Carey B.W., Garber M., Grenier J.K., Munson G., Young G., Lucas A.B., Ach R., Bruhn L., Yang X., Amit I., Meissner A., Regev A., Rinn J.L., Root D.E., Lander E.S. lincRNAs act in the circuitry controlling pluripotency and differentiation. Nature. 2011;477:295–300. doi: 10.1038/nature10398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bustin S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 2000;25:169–193. doi: 10.1677/jme.0.0250169. [DOI] [PubMed] [Google Scholar]
  • 4.Liu W., Saint D.A. A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Anal. Biochem. 2002;302:52–59. doi: 10.1006/abio.2001.5530. [DOI] [PubMed] [Google Scholar]
  • 5.Fan H., Robetorye R.S. Real-time quantitative reverse transcriptase polymerase chain reaction. Methods Mol. Biol. 2010;630:199–213. doi: 10.1007/978-1-60761-629-0_13. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.xml (414B, xml)

Articles from Data in Brief are provided here courtesy of Elsevier

RESOURCES