Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Mar 13.
Published in final edited form as: Appl Microbiol Biotechnol. 2019 Jun 11;103(15):6107–6117. doi: 10.1007/s00253-019-09934-5

Bioengineering of a single long noncoding RNA molecule that carries multiple small RNAs

Hannah Petrek 1, Neelu Batra 1, Pui Yan Ho 1, Mei-Juan Tu 1, Ai-Ming Yu 1
PMCID: PMC7068804  NIHMSID: NIHMS1566105  PMID: 31187211

Abstract

Noncoding RNAs (ncRNAs), including microRNAs (miRNAs), small interfering RNAs (siRNAs), and long noncoding RNAs (lncRNAs), regulate target gene expression and can be used as tools for understanding biological processes and identifying new therapeutic targets. Currently, ncRNA molecules for research and therapeutic use are limited to ncRNA mimics made by chemical synthesis. We have recently established a high-yield and cost-effective method of producing bioengineered or biologic ncRNA agents (BERAs) through bacterial fermentation, which is based on a stable tRNA/pre-miR-34a carrier (~ 180 nt) that accommodates target small RNAs. Nevertheless, it remains a challenge to heterogeneously express longer ncRNAs (e.g., > 260 nt), and it is unknown if single BERA may carry multiple small RNAs. To address this issue, we hypothesized that an additional human pre-miR-34a could be attached to the tRNA/pre-miR-34a scaffold to offer a new tRNA/pre-miR-34a/pre-miR-34a carrier (~ 296 nt) for the accommodation of multiple small RNAs. We thus designed ten different combinatorial BERAs (CO-BERAs) that include different combinations of miRNAs, siRNAs, and antagomirs. Our data showed that all target CO-BERAs were successfully expressed in Escherichia coli at high levels, greater than 40% in total bacterial RNAs. Furthermore, recombinant CO-BERAs were purified to a high degree of homogeneity by fast protein liquid chromatography methods. In addition, CO-BERAs exhibited strong anti-proliferative activities against a variety of human non-small cell lung cancer cell lines. These results support the production of long ncRNA molecules carrying different warhead small RNAs for multi-targeting which may open avenues for developing new biologic RNAs as experimental, diagnostic, and therapeutic tools.

Keywords: Noncoding RNA, microRNA, siRNA, Bioengineering, Lung cancer

Introduction

Small noncoding RNAs, including miRNAs derived from the genome and siRNAs introduced exogenously, can govern target gene expression through translational inhibition and/or mRNA degradation mechanisms (Ambros 2004; Esteller 2011). Further research on functional ncRNAs supports their important roles in the etiology and progression of diseases which may be translated into novel diagnostics and therapeutics (Levin 2019; Yu et al. 2019). Currently, ncRNA agents used for research and development are mainly produced by chemical synthesis or in vitro transcription (Bramsen and Kjems 2012; Khvorova and Watts 2017; Yu et al. 2019), besides those using plasmid- or virus-based materials (Liu and Berkhout 2011). However, the latter consists of DNA molecules that depend upon host cell integration and procession to generate target ncRNAs. Synthetic RNA molecules are readily accessible, whereas chemo-engineered RNA mimics contain large amounts and various types of chemical modifications (Bramsen and Kjems 2012; Khvorova and Watts 2017; Yu et al. 2019). It is also noteworthy that chemo-engineered RNA molecules with the same sequences of nucleobases obtained from different companies are actually distinct molecules as each preferably carries different degrees and/ or types of chemical modifications at different positions. These modifications might not even be disclosed to investigators, except those made through custom synthesis. By contrast, in vitro transcription with a DNA template and RNA polymerase follows natural means to produce RNA molecules, whereas it lacks other cellular machineries required for post-processing and modification of the resulting RNAs. As a result, synthetic RNA molecules made in test tubes via chemical or enzymatic reactions undoubtedly exhibit their own physicochemical and biological properties and differ explicitly from natural RNAs transcribed from the genome and folded in living cells (Ho and Yu 2016; Yu et al. 2019).

With the demand for biologic RNA molecules that resemble natural RNAs formed and folded in living cells, production of ncRNAs via microbial fermentation holds great potential for a wide variety of applications. This process may revolutionize biological and medical research as well as drug development similar to how recombinant DNA and protein engineering technologies did (Leader et al. 2008; Rosano and Ceccarelli 2014). There is also growing interest in fermentation production or combinatorial biosynthesis of small molecules for the development of new drugs (Hutchinson 1998; Knight et al. 2003) and biofuels (Zhang et al. 2019). However, heterogeneous overexpression of target RNAs has been challenging because RNA molecules are highly susceptible to RNases within host microorganisms or cells and thus becomes hard to accumulate significant levels. Using a tRNA (Gaudin et al. 2003; Ponchon et al. 2009; Ponchon and Dardel 2007) or rRNA (Liu et al. 2010; Zhang et al. 2009) scaffold has proved to mitigate some challenges and permit heterogeneous expression of a number of recombinant RNA molecules through microbial fermentation (Chen et al. 2015; Gaudin et al. 2003; Li et al. 2015; Nelissen et al. 2012; Paige et al. 2011, 2012; Pitulle et al. 1995), whereas most target chimeric RNAs and the tRNA itself are revealed to be unexpressed or accumulated to a negligible level (Chen et al. 2015; Ho et al. 2018). Following the identification of unique hybrid tRNA/pre-miRNA molecules, a novel tRNA/pre-miRNA-based technology has been established for a consistent, high-yield, and large-scale production of bioengineered or biologic RNA agents (BERAs) that carry specific miRNAs, siRNAs, or other small RNA warheads. For example, tRNA/pre-miR-34a, in which miR-34a duplexes can be substituted by another miRNA or siRNA of interest, achieves a surprisingly high-level expression and accumulation of target BERAs in Escherichia coli (Chen et al. 2015; Ho et al. 2018). Further studies have demonstrated that BERAs, purified from total bacterial RNAs by spin columns or anion exchange fast protein liquid chromatography (FPLC) methods, are functional in human cells to specifically release target miRNA or siRNA for the modulation of gene expression and cellular processes including cancer cell proliferation, tumor progression, and metastasis (Alegre et al. 2018; Chen et al. 2015; Ho et al. 2018; Jian et al. 2017; Jilek et al. 2019; Li et al. 2018,2019; Tu et al. 2019; Zhao et al. 2016).

As novel ncRNA bioengineering technology opens new avenues for basic and translational research (Ho and Yu 2016; Pereira et al. 2017; Yu et al. 2019), high-yield expression of target RNAs (e.g., accounting for > 20% of total bacterial RNA) has been limited to those shorter than 260 nt. This is likely attributed to the increase of unstructured regions within a long ncRNA molecule (e.g., > 260 nt) that are misfolded and readily degraded by bacterial RNases. Furthermore, it is unknown whether a single BERA is able to carry multiple small RNAs. Therefore, in this study, we aimed to challenge the tRNA/pre-miRNA-based biotechnology by incorporating another pre-miR-34a into the tRNA/pre-miR-34a carrier, which led to a new tRNA/pre-miR-34a/pre-miR-34a entity, approximately 300 nt in length, for the accommodation of multiple small RNAs. After designing ten different combinatorial BERAs (CO-BERAs) that are comprised of various combinations of miRNAs, siRNAs, and antagomirs, we constructed individual CO-BERA expression plasmids. Further studies demonstrated that all CO-BERAs were successfully overexpressed in E. coli at extraordinarily high levels, greater than 40% of total bacterial RNAs. After being purified to a high degree of homogeneity by FPLC methods and introduced to human carcinoma cells, recombinant CO-BERAs exhibited potent anti-proliferative activities against a panel of human non-small cell lung cancer (NSCLC) cell lines. These findings establish the feasibility of fermentation production of a single biologic RNA molecule containing two warhead small RNAs that hold promise for multi-targeting.

Materials and methods

Bacterial culture

E. coli strains DH5α (Thermo Fisher Scientific, Waltham, MA) and HST08 (Clontech Laboratories, Mountain View, CA) were grown in Luria broth (LB) for plasmid preparation and 2XYT media for RNA production, respectively. The media were supplemented with 100 μg/ml ampicillin.

Human cell culture

Human lung carcinoma cell lines A549 (ATCC: CRM-CCL-185), H1975 (ATCC: CRL-5908), H23 (ATCC: CRL-5800), H1650 (ATCC: CRL-5883), and H1299 (ATCC: 5803) were purchased from American Type Culture Collection (Manassas, VA). Cell lines were maintained in RPMI 1640 (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum, 100 U/ml penicillin sodium, and 100 μg/ml streptomycin sulfate (Thermo Fisher Scientific) grown at 37 °C in a humidified atmosphere with 5% CO2.

Construction of CO-BERA expression plasmids

The sequences of all miRNAs were obtained from miRBase (http://www.mirbase.org/), and the optimized pre-miR-34a as well as anti-miR-21, NRF2-siRNA, let-7c, and miR-124 sequences were adopted from our recently study (Ho et al. 2018; Li et al. 2018). CO-BERA sequences (Table 1) were generated by substituting miR-34a duplexes with target miRNA or siRNA sequences, as illustrated in Fig. 1a, and corresponding coding sequences were synthesized in the pUC57 vector by GenScript Corporation (Piscataway, NJ). Target inserts were released from the plasmids after digestion with EcoRI and PstI (New England Biolabs, Ipswich, MA). Following gel purification using USB PrepEase Gel Extraction Kit (Affymetrix, Inc. Cleveland, OH), each insert was ligated to the EcoRI- and PstI-digested vector pBSTNAV (Ho et al. 2018; Ponchon et al. 2009) with T4 Rapid Ligation Kit (Thermo Fisher Scientific). The plasmids were then transformed into DH5α competent cells and selected with ampicillin. Colonies were expanded, and CO-BERA expression plasmids were isolated with a Miniprep Kit (Qiagen, Hilden, Germany). All target CO-BERA expression plasmids were confirmed by sequencing analysis (GenScript, Piscataway, NJ).

Table 1.

Sequences of individual CO-BERAs designed and heterogeneously expressed in this study

Name Sequence (underlined: tRNA, bold: sequence relating to insert #1, green: target miRNA/siRNA, red: complementary sequence)
htRNALeu/miR-34a/miR-124 ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCGGCCA
GCUGUGAGUGUUUCUUUAAGGCACGCGGUGAAUGCCGUUGUGAG
CAAUAGUAAGGAAGCGGUGUUCCCGUCGUGCCUUCUAGAAGUGC
UGCACGUUGUUGGCCCGUAAGGAAGCAAUCAGCAAGUAUACUGCC
CUAGAAGUGCUGCACGUUGUUGGCCCGAUCCAAUGGACAUAUGUC
CGCGUGGGUUCGAACCCCACUCCUGGUACCA
htRNALeu/miR-124/miR-34a ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUAAGGCACGCGGUGAAUGCCGUUGUGAGCGGCCAG
CUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGC
AAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCU
GCACGUUGUUGGCCCGUAAGGAAGCGGUGUUCCCGUCGUGCCUUC
UAGAAGUGCUGCACGUUGUUGGCCCGAUCCAAUGGACAUAUGUCC
GCGUGGGUUCGAACCCCACUCCUGGUACCA
htRNALeu/let-7c/miR-124 ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUGAGGUAGUAGGUUGUAUGGUUUGUGAGCGGCCA
GCUGUGAGUGUUUCUUUAAGGCACGCGGUGAAUGCCGUUGUGAG
CAAUAGUAAGGAAGCGGUGUUCCCGUCGUGCCUUCUAGAAGUGC
UGCACGUUGUUGGCCCGUAAGGAAGAACUGUACACCUUACUACCU
UUCAGAAGUGCUGCACGUUGUUGGCCCGAUCCAAUGGACAUAUG
UCCGCGUGGGUUCGAACCCCACUCCUGGUACCA
htRNALeu/let-7c/miR-34a ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUGAGGUAGUAGGUUGUAUGGUUUGUGAGCGGCCA
GCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAG
CAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGC
UGCACGUUGUUGGCCCGUAAGGAAGAACUGUACACCUUACUACCU
UUCAGAAGUGCUGCACGUUGUUGGCCCGAUCCAAUGGACAUAUG
UCCGCGUGGGUUCGAACCCCACUCCUGGUACCA
htRNASer/miR-124/miR-34a GCAGCGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUAAGGCACGCGGUGAAUGCCGUUGUGAGCGGCCAG
CUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGC
AAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCU
GCACGUUGUUGGCCCGUAAGGAAGCGGUGUUCCCGUCGUGCCUUC
UAGAAGUGCUGCACGUUGUUGGCCCAAUCCAAUGGGGUCUCCCCG
CGCAGGUUCGAACCCUGCUCGCUGCGCCA
htRNASer/let-7c/miR-124 GCAGCGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUGAGGUAGUAGGUUGUAUGGUUUGUGAGCGGCCA
GCUGUGAGUGUUUCUUUAAGGCACGCGGUGAAUGCCGUUGUGAG
CAAUAGUAAGGAAGCGGUGUUCCCGUCGUGCCUUCUAGAAGUGC
UGCACGUUGUUGGCCCGUAAGGAAGAACUGUACACCUUACUACCU
UUCAGAAGUGCUGCACGUUGUUGGCCCAAUCCAAUGGGGUCUCCC
CGCGCAGGUUCGAACCCUGCUCGCUGCGCCA
htRNASer/let-7c/miR-34a GCAGCGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUGAGGUAGUAGGUUGUAUGGUUUGUGAGCGGCCA
GCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAG
CAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGC
UGCACGUUGUUGGCCCGUAAGGAAGAACUGUACACCUUACUACCU
UUCAGAAGUGCUGCACGUUGUUGGCCCAAUCCAAUGGGGUCUCCC
CGCGCAGGUUCGAACCCUGCUCGCUGCGCCA
htRNALeu/miR-34a/anti-miR-21 ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUCAACAUCAGUCUGAUAAGCUAUGUGAGCGGCCAG
CUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGC
AAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCU
GCACGUUGUUGGCCCGUAAGGAAGUAGCUUAUAAGAAUGAUGUUG
CAGAAGUGCUGCACGUUGUUGGCCCGAUCCAAUGGACAUAUGUCC
GCGUGGGUUCGAACCCCACUCCUGGUACCA
htRNALeu/NRF2-siRNA/miR-34a ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUAAUUGUCAACUACUGUCAGUUUGUGAGCGGCCAG
CUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGC
AAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCU
GCACGUUGUUGGCCCGUAAGGAAAACUGACAGAGUAUGACAAUUC
UAGAAGUGCUGCACGUUGUUGGCCCGAUCCAAUGGACAUAUGUCC
GCGUGGGUUCGAACCCCACUCCUGGUACCA
htRNASer/NRF2-siRNA/miR-34a GCAGCGAUGGCCGAGUGGUUAAGGCGUUGGACUGGCCAGCUGUG
AGUGUUUCUUUAAUUGUCAACUACUGUCAGUUUGUGAGCGGCCAG
CUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGC
AAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCU
GCACGUUGUUGGCCCGUAAGGAAAACUGACAGAGUAUGACAAUUC
UAGAAGUGCUGCACGUUGUUGGCCCAAUCCAAUGGGGUCUCCCCG
CGCAGGUUCGAACCCUGCUCGCUGCGCCA

Underlined sequences represent tRNA, either leucine or serine, followed by two consecutive pre-miR-34a sequences (Ho et al. 2018), where mature miR-34a sequences were replaced with target warhead small RNAs highlighted in red whose complementary sequences are in green

Fig. 1.

Fig. 1

Novel combinatorial bioengineered RNA agent (CO-BERA) is highly expressed in E. coli HST08. a Illustration of the designed CO-BERA (~ 297 nt in length) which consists of two optimized pre-miR-34a sequences preceding each of the inserts, different from BERA (~ 180 nt in length) that consists of only one pre-miR-34a. Red represents target sequence and green represents complementary sequence. b Denaturing urea PAGE analysis of total RNA extracted from the HST08 cells transformed with plasmids encoding individual CO-BERAs, with a ladder and wild-type (WT) HST08 cells for references. Successful overexpression of each target CO-BERA is demonstrated by the appearance of a new strong band in transformed HST08 cells, as compared with the WT cells

Expression of recombinant CO-BERA in E. coli

Plasmids with confirmed sequences were transformed into HST08 as previously described (Ho et al. 2018; Li et al. 2014; Wang et al. 2015). Total RNAs were extracted by a Tris-HCl-saturated phenol extraction method, quantified with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and analyzed for recombinant CO-BERA expression by separating 0.1 μg total bacterial RNA per lane on a denaturing urea (8 M) PAGE (8%) gel with a RiboRuler low-range RNA ladder (Thermo Fisher Scientific) for reference. PAGE gels were stained with ethidium bromide and imaged using the ChemiDoc MP Imaging System (Bio-Rad, Hercules, CA).

Purification of CO-BERAs by fast protein liquid chromatography

CO-BERAs were purified from total RNAs using an NGC Quest 10 Plus Chromatography fast protein liquid chromatography (FPLC) system (Bio-Rad, Hercules, CA). All CO-BERAs were initially purified using ENrich-Q 10 × 100 (Bio-Rad, Hercules, CA). FPLC fractions were analyzed by urea-PAGE to verify RNA separation and purity. Fractions containing target CO-BERA were pooled, precipitated in ethanol, and desalted/concentrated in nuclease-free water using an Amicon Ultra 2-ml centrifugal filter (30 kDa; EMD Millipore, Billerica, MA). In some cases, the concentrated CO-BERAs contained some impurities and were subjected for a second purification using either ENrich-Q 10 × 100, Bio-Scale Mini Macro-Prep DEAE, or Bio-Scale Mini CHT Type II (Bio-Rad, Hercules, CA) depending on which column yielded the purest product. Likewise, the fractions were assessed by urea-PAGE analysis, and target fractions were thus combined, desalted, and concentrated.

RNA separation on ENrich-Q 10 × 100 and Bio-Scale Mini Macro-Prep DEAE was conducted with buffer A (10 mM sodium phosphate, pH 7.0) and buffer B (buffer A + 1 M sodium chloride, pH 7.0) while Bio-Scale Mini CHT Type II was achieved by using buffer C (5 mM sodium phosphate, pH 7.0) and buffer D (150 mM sodium phosphate, pH 7.0). FPLC traces were monitored at 260/280 nm using a UV-visible detector, and fractions were collected accordingly. Specifically, around 5–10 mg of RNA was loaded onto the ENrich-Q column and separated through a gradient elution at a flow rate of 2 ml/min, i.e., 100% buffer A for 4 min, followed by 55% buffer B for 10 min, a gradient of 55–72% buffer B for 20 min, 72–74% buffer B for 8 min, 100% buffer B for 10 min, and then 100% buffer A for 10 min. Around 5 mg of RNA was loaded onto the Bio-Scale Mini Macro-Prep DEAE for separation by gradient elution at 2 ml/min, i.e.,100% buffer A for 12 min, then switched to 50% buffer B for 5 min, a gradient of 50–60% buffer B for 25 min, 60–75% buffer B for 10 min, 100% buffer B for 5 min, and finally 100% buffer A for 5 min. Lastly, around 0.5 mg RNA was loaded onto the Bio-Scale Mini CHT Type II for separation by gradient elution at 2.5 ml/min, i.e., 100% buffer C for 2 min, followed by 73–90% buffer D for 18 min, 100% buffer D for 5 min, then 100% buffer C for 5 min.

Quantitative measurement of the purity of FPLC-isolated CO-BERA

The purity of FPLC-isolated RNA was quantitatively determined by an optimal high-performance liquid chromatography (HPLC) method with a XBridge® Oligonucleotide BEH C18 column (2.1 × 50 mm, 2.5-μm particle size; Waters, Milford, MA) on a Shimadzu LC-20AD HPLC system, as we described previously (Wang et al. 2015).

Endotoxin quantification

Endotoxin levels in FPLC-purified CO-BERAs were quantitated by using Limulus Amebocyte Lysate Pyrogent-5000 kinetic assay (Lonza, Walkersville, MD), following the manufacturer’s instructions. In brief, a SpectraMax3 plate reader (Molecular Devices, Sunnyvale, CA) was used to measure the absorbance at a 340-nm wavelength. Endotoxin standards provided in the kit were used to generate a standard curve, and endotoxin levels were calculated as endotoxin units (EU)/microgram RNA.

Cell viability assay

Cells were seeded at 3000 or 5000 cells per well in a 96-well pate, and after overnight incubation, cells were transfected with 15 nM ncRNA or control tRNA using Lipofectamine 3000 (Thermo Fisher Scientific) as well as empty Lipofectamine 3000 as vehicle control. Cell viability was measured using MTT assay 72 h post-transfection, as we described (Ho et al. 2018; Jilek et al. 2019; Wang et al. 2015). All experiments were carried out in triplicate and repeated at least once in separate cultures.

Results

Design of CO-BERAs and construction of plasmids

Using the novel tRNA/pre-miRNA-based ncRNA bioengineering technology, we were able to produce a variety of target BERAs in milligram quantities from 1 liter of bacterial culture (Chen et al. 2015; Ho et al. 2018; Li et al. 2014, 2019; Wang et al. 2015). However, it was unknown if this technology would allow us to produce an RNA molecule longer than 260 nt that carries multiple-target small RNAs. To address this issue, we designed ten new CO-BERA molecules (Table 1) based on our BERA technology, where another pre-miR-34a was fused consecutively onto the tRNA/pre-miR-34a carrier, and the resulting tRNA/pre-miR-34a/pre-miR-34a carrier, around 296 nt in length, permitted the loading of two target small RNAs through substituting intrinsic miR-34a duplexes (Fig. 1a). To increase the diversity of CO-BERAs, our designs included either a human serine or leucine tRNA followed by two optimized human pre-miR-34a (Ho et al. 2018) carrying different combinations of NRF2-siRNA, anti-miR-21–5p, let-7c-5p, miR-124–3p, and miR-34a-3p (Table 1). Corresponding coding sequences were synthesized and cloned into the pUC57 vector and consequently subcloned into the target pBSTNAV vector (Ho et al. 2018; Li et al. 2014; Ponchon et al. 2009; Ponchon and Dardel 2007), which were confirmed by sequencing before proceeding to heterogeneous expression in HST08 E. coli.

All target CO-BERAs are highly expressed in E. coli

To determine if long ncRNA CO-BERA can be overexpressed heterogeneously, total RNA was extracted from E. coli transformed with individual CO-BERA expression plasmids and analyzed by urea-PAGE. The results (Fig. 1b) showed that all ten CO-BERAs were successfully expressed in bacteria, as manifested by the appearance of new corresponding RNA bands when compared with the wild-type bacteria. Interestingly, these CO-BERAs in similar lengths (Table 2) undoubtedly contain different secondary and higher-order structures as exhibited by variable levels of PAGE mobility (Fig. 1a), similar to our findings on BERAs (Ho et al. 2018; Jilek et al. 2019). While the expression levels of these CO-BERAs also varied slightly, each accounted for over 40% of total bacterial RNAs, as estimated from the intensities of RNA bands (Fig. 1b) as well as more quantitatively from the FPLC peak areas (Fig. 2a). In addition, the amounts of total RNAs extracted from 1 liter of bacterial culture were variable between CO-BERAs, ranging from approximately 50 mg for htRNALeu/miR-124/miR-34a to 12.6 mg for htRNASer/let-7c/miR-124 (Table 2).

Table 2.

Yields, purities, and endotoxin levels of individual FPLC-isolated CO-BERAs. The yield was defined as the amount of purified CO-BERA per liter bacterial culture, and the purity of isolated CO-BERA was quantified by an optimal HPLC method (Wang et al. 2015). The molecular weights of individual CO-BERAs were calculated with OligoCalc (http://biotools.nubic.northwestern.edu/OligoCalc.html). Endotoxin levels were determined by using the Limulus Amebocyte Lysate Pyrogent-5000 kinetic assay

Name Length (nt) Molecular Weight (g/mol) Total RNA extracted from 1L culture (mg) Target CO-BERA purified from 1 L culture (mg) Purity (%) Endotoxin activity (EU/μg RNA)
1 htRNALeu/miR-34a/miR-124a 297 96,008.1 48.4 21.3 99.0 0.15
2 htRNALeu/miR-124/miR-34aa 297 96,583.4 50.0 22.0 99.0 3.31
3 htRNALeu/let-7c/miR-124b 298 96,300.3 21.6 4.3 96.7 1.60
4 htRNALeu/let-7c/miR-34ac 298 96,278.3 21.3 10.7 95.6 1.34
5 htRNASer/miR-124/miR-34aa 296 95,684.9 22.2 4.4 99.4 1.44
6 htRNASer/let-7c/miR-124d 297 95,977.0 12.6 0.5 92.3 0.33
7 htRNASer/let-7c/miR-34aa 297 95,955.1 22.0 13.2 99.6 0.71
8 htRNALeu/miR-34a/anti-miR-21c 294 96,010.2 17.6 0.2 95.1 1.11
9 htRNALeu/NRF2-siRNA/miR-34aa 297 95,931.1 20.0 6.4 99.6 0.19
10 htRNASer/NRF2-siRNA/miR-34aa 296 95,607.9 13.3 1.3 99.0 6.32
a

ENrich Q only;

b

ENrich Q then CHT Type II;

c

ENrich Q then DEAE;

d

ENrich Q then ENrich Q

Fig. 2.

Fig. 2

FPLC purification of CO-BERAs using one or two columns in sequence. a CO-BERAs were separated from total bacterial RNA on an anion exchange ENrich Q column. A few CO-BERAs requiring re-purification were proceeded to further FPLC separation by using either b ENrich Q again, c DEAE, or d CHT Type II. Shown are representative FPLC traces

CO-BERAs are purified to a high degree of homogeneity by FPLC methods

To isolate recombinant CO-BERAs from bacterial RNAs, we sought to optimize the anion exchange FPLC method utilized for the purification of BERAs (Ho et al. 2018). Through elution with a refined salt gradient for a longer period of time (Fig. 2a), we were able to purify target CO-BERAs from bacterial RNAs to a high degree of homogeneity in a single run with six out of ten CO-BERAs greater than or equal to 99.0% pure (Table 2), as quantitatively determined by HPLC method and evaluated by urea-PAGE analysis (Fig. 3). Nevertheless, the other four CO-BERAs were less than 90% pure after single-run FPLC separation with the strong anion exchange column and thus processed for further purification. Re-purification using either the same strong anion exchange column or a weak anion exchange column (Fig. 2b, c) offered satisfactory 95–97% pure CO-BERAs (Table 2). CO-BERAs htRNASer/let-7c/miR-124 and htRNALeu/let-7c/miR-124 turned out be extremely hard to purify; and re-purification with a strong anion exchange (Fig. 2b) or ceramic hydroxyapatite column (Fig. 2d) resulted in 96.7% pure htRNALeu/let-7c/miR-124 and 92.3% pure htRNASer/let-7c/miR-124 molecules (Table 2). Meanwhile, overall yields were also lower following two-column purifications, in addition to its association with a lower amount of total RNA from 1 liter of bacterial fermentation (Table 2). By contrast, the majority of target CO-BERAs purified with single-run strong anion exchange FPLC method were over 10 mg from 1 liter of bacterial culture, and 4–7 mg was usually obtained when re-purification was conducted (Table 2). In addition, FPLC-purified CO-BERAs exhibited low endotoxin activities (Table 2), as measured by the Limulus Amebocyte Lysate Pyrogent-5000 kinetic assay. As one CO-BERA htRNASer/NRF2-siRNA/miR-34a had an endotoxin level of 6.32 EU/μg RNA, all other CO-BERAs showed an endotoxin activity less than 4 EU/μg RNA. Together, these results demonstrated a successful large-scale purification of recombinant CO-BERAs by single- or multi-column FPLC methods that generally offer multi-milligrams of over 95% pure CO-BERAs with minimal endotoxin activities from 1 liter of bacterial fermentation.

Fig. 3.

Fig. 3

Verification of the purity of FPLC-isolated CO-BERAs by gel electrophoresis analysis and quantitatively by HPLC method. a PAGE analysis showed that majority of the isolated CO-BERAs are very pure with no or minimal impurity. b HPLC analysis quantitatively determined the purities of individual CO-BERAs, among which most CO-BERAs are around 99% pure and only one CO-BERA is < 95% pure (see Table 2 for details)

Biologic CO-BERA molecules inhibit human NSCLC cell viability

We thus assessed and compared the anti-proliferation activities of these recombinant CO-BERAs against human NSCLC cells. A panel of five different NSCLC cell lines, namely, A549, H1975, H23, H1650, and H1299, was chosen to represent a variety of genetic backgrounds and simulate the heterogeneity of NSCLC. Cell variability was determined at 72 h after transfection with 15 nM of individual CO-BERAs, control tRNA (namely, LSA and SSA), or vehicle. Our data (Fig. 4a–e) showed that all CO-BERAs showed remarkable anti-proliferation activities in these NSCLC cell lines, as compared with vehicle and tRNA controls. The same CO-BERA exhibited variable levels of suppression of the viability of different cell lines, while different CO-BERAs demonstrated variable degrees of inhibition of the same cell line (Fig. 4). Among them, htRNALeu/miR-34a/miR-124 and htRNALeu/let-7c/miR-124 consistently exhibited the greatest extents of anti-proliferation activities against all NSCLC cell lines (e.g., > 80% inhibition of A549 cells and > 50% suppression of all others), which may be pursued for future studies.

Fig. 4.

Fig. 4

Anti-proliferative activities of CO-BERAs against various human NSCLC cell lines. Cell viability of five different NSCLC cell lines (a–e) was reduced by 15 nM of purified CO-BERAs to various degrees, as compared with Lipofectamine 3000 only (vehicle), leucine (LSA), or serine (SSA) tRNA controls. Data were normalized to vehicle control. Values are mean ± SD (N = 3). *P < 0.05, as compared with vehicle, LSA, and SSA controls (1-way ANOVA with Bonferroni post-tests)

Discussion

A new microbial fermentation-based method was established in this study which for the first time achieved high-level heterogeneous expression of novel long ncRNA molecules around 300 nt in length, namely, CO-BERAs, carrying two small RNAs warheads. CO-BERAs were designed by utilizing the unique stable tRNA/pre-miR-34a scaffold, which we identified recently (Chen et al. 2015; Ho et al. 2018), to assemble another human pre-miRNA for the accommodation of additional small RNAs for multi-targeting purposes. All ten CO-BERAs, consisting of different combinations of NRF2-siRNA, miR-34a, miR-124, let-7c, and anti-miR-21, were successfully expressed in the common E. coli strain HST08, each accounting for greater than 40% of total bacterial RNA. These small RNAs were chosen for their tumor suppressive properties in NSCLC, and our results suggest that this approach may be employed to accommodate other small RNAs of interest. The majority of recombinant CO-BERAs could be purified to a high degree of homogeneity, generally greater than 99% pure as quantified by HPLC and less than 3 EU/μg RNA endotoxin activity as determined by Limulus Amebocyte Lysate kinetic assay, through the single-run strong anion exchange FPLC method while some others required re-purification and thus showed variable overall yields. While biologic CO-BERAs exhibited potent anti-proliferative activities against a panel of human NSCLC cell lines, further studies are highly warranted to define their multi-targeting mechanisms and effectiveness in controlling tumor progression in animal models.

Bioengineered or recombinant RNA molecules as well as CO-BERAs described in this study are made and folded in living cells, distinguished from chemo-engineered RNA mimics with extensive and various modifications (Bramsen and Kjems 2012; Ho and Yu 2016; Khvorova and Watts 2017; Yu et al. 2019) that have been dominating RNA research and drug development. Interestingly, protein research has been directly ruled by bioengineered or recombinant proteins produced and folded in living cells rather than synthetic polypeptides or proteins, which has proved to be extremely successful in understanding protein structures and functions and developing novel protein therapeutics (Leader et al. 2008). It is also noted that synthetic DNAs or genes, which have become popular in genetic research (Schindler et al. 2018), are actually not comprised of any chemical modifications. Therefore, there is a need to develop novel technologies, especially microbial fermentation-based methods, for the production of biologic RNA molecules (Ho and Yu 2016; Pereira et al. 2017; Yu et al. 2019) that allow for cellular machineries to recognize and perform post-transcriptional modification and processing to necessary structures and folding. Indeed, recombinant RNAs or BERAs have none or just minimal post-transcriptional modifications, such as pseudouridine (Gaudin et al. 2003; Li et al. 2015; Nelissen et al. 2012; Ponchon et al. 2009; Ponchon and Dardel 2007; Ranaei-Siadat et al. 2014; Wang et al. 2015), which are necessary to resemble natural RNAs and pose intrinsic secondary and high-order structures. Furthermore, bioengineered RNA molecules produced heterogeneously in microbial fermentation have been demonstrated to be biologically functional in vitro and in vivo by various studies (Chen et al. 2015; Ho et al. 2018; Jian et al. 2017; Jilek et al. 2019; Li et al. 2014, 2015, 2018, 2019; Liu et al. 2010; Nelissen et al. 2012; Paige et al. 2011, 2012; Pereira et al. 2016a, b; Pitulle et al. 1995; Tu et al. 2019; Wang et al. 2015; Zhang et al. 2009; Zhao et al. 2016). In addition, although we cannot have a direct comparison of the costs in producing the same amounts of equally pure (e.g., > 98%) chemo- and bio-engineered RNA agents, RNA bioengineering technology is proved to be cost-effective in consistent large-scale production of high-purity target RNAi molecules for research and development (Yu et al. 2019).

In this study, we were able to achieve consistent, high-level expression of long ncRNA molecules around 300 nt in length via bacterial fermentation as previous research only offered ncRNAs less than 260 nt. The approach also allowed us to assemble two targeted small RNAs into a single long CO-BERA that may be employed for multi-targeting. Five warhead small RNAs, miR-34a, miR-124, let-7c, NRF2-siRNA, and anti-miR-21, were selected for their anti-tumor activities in NSCLC. Tumor-suppressive miRNAs miR-124, miR-34a and let-7c that target many oncogenes such as STAT3, CDK4/6, and RAS (Hatziapostolou et al. 2011; Johnson et al. 2005; Sun et al. 2008) are commonly dysregulated in NSCLC tissues or cells due to chromosomal aberrations or methylations (Hermeking 2010; Lin et al. 2010). In contrast, miR-21 that targets tumor suppressive genes such as PTEN and PDCD4 (Asangani et al. 2008; Meng et al. 2007) is usually overexpressed in NSCLC. Nuclear factor erythroid-2-related factor-2 (NRF2) is constitutively activated in NSCLC through a variety of mechanisms and plays an important role in cell proliferation and chemosensitivity (Bar-Peled et al. 2017; Yamadori et al. 2012). Restoration of tumor-suppressive miRNAs and inhibition of tumor-promoting RNAs through miRNA and antagomir agents, respectively, represent new strategies to treat cancer. Indeed, these CO-BERAs showed strong anti-proliferative activities against all human NSCLC cell lines tested, whereas the underlying multi-targeting mechanisms warrant further verification.

As each CO-BERA accounted for greater than 40% of total bacterial RNA, individual CO-BERAs led to variable amounts of total RNA from the same volume of microbial fermentation, which may be related to CO-BERAs’ structures, stabilities, and biological properties. An interesting observation is that, besides the docked small RNAs, tRNA seems to influence the yield of total RNA. Six CO-BERAs were produced with a leucine tRNA scaffold and four with serine tRNA. The average amount of total RNA extracted for the leucine tRNA-assembled CO-BERAs was 29.8 mg/L bacterial culture while the average amount for the serine tRNA-containing CO-BERAs was 17.5 mg/L. This is presumably due to the difference in their stabilities and/or possible toxicities to host bacteria as CO-BERAs are accumulated in E. coli. Furthermore, the order of small RNAs in a CO-BERA does not seem to affect the yield of total RNA as htRNALeu/miR-34a/miR-124 and htRNALeu/miR-124/miR-34a offered similar amounts of total RNAs per liter bacterial culture. Understanding the impact of different factors and their underlying mechanisms would facilitate improvement of RNA bioengineering technology and production of CO-BERAs.

Purification of CO-BERAs was achieved by using single or multi-column FPLC methods. Most CO-BERAs were 99% pure after single-run FPLC separation, yielding multi-milligrams of ready-to-use CO-BERAs from 1 liter of bacterial culture. As others required further purification on additional column, their overall yields were also lower. An extra band was obvious in the urea-PAGE gel in some of the less pure CO-BERAs, which was not visible in the untransformed E. coli. This band might represent an altered form of CO-BERA such as a truncated, post-transcriptionally modified, or alternately folded species, or simply a bacterial RNA that is upregulated due to the transformation with CO-BERA expression plasmid. Further investigation, such as RNA sequencing, may be needed to identify the nature of such “impurities.” Alternative methods may be explored or current methods may be refined to yield purer products required for more extensive structural and functional studies.

In summary, we have established a new approach to produce novel single ncRNA molecule around 300 nt in length bearing multiple warhead small RNAs that holds promise for multi-targeting. This method can be readily adapted for the production of milligram quantities of target CO-BERAs from 1 liter of bacterial culture within a few days. Most importantly, CO-BERAs are produced and folded in living cells and thus may better capture the properties of cellular RNAs. As such, this unique multiplexing of biologic RNAs shall be an invaluable addition to current tools for broad biomedical research including but not limited to the investigation of cellular regulatory mechanisms and development of ncRNA therapeutics.

Acknowledgments

Funding information

This study was supported by the National Cancer Institute (grant no. R01CA225958) and National Institute of General Medical Sciences (R01GM113888), National Institutes of Health. The authors also appreciate the access to the Molecular Pharmacology Shared Resources funded by the UC Davis Comprehensive Cancer Center Support Grant (CCSG) awarded by the National Cancer Institute (P30CA093373).

Footnotes

Ethical statement The authors confirm that the article does not contain any studies with human participants or animals.

Conflict of interest The authors are named inventors of patent applications related to RNA bioengineering technology and therapeutics that are owned by the UC Davis, and Dr. Yu is a founder of AimRNA, Inc., which has an agreement to license the intellectual property. All other authors declare that they have no conflict of interest.

References

  1. Alegre F, Ormonde AR, Snider KM,Woolard K, Yu AM,Wittenburg LA (2018) A genetically engineered microRNA-34a prodrug demonstrates anti-tumor activity in a canine model of osteosarcoma. PLoS One 13(12):e0209941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ambros V (2004) The functions of animal microRNAs. Nature 431(7006):350–355 [DOI] [PubMed] [Google Scholar]
  3. Asangani IA, Rasheed SA, Nikolova DA, Leupold JH, Colburn NH, Post S, Allgayer H (2008)MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer. Oncogene 27(15):2128–2136 [DOI] [PubMed] [Google Scholar]
  4. Bar-Peled L, Kemper EK, Suciu RM, Vinogradova EV, Backus KM, Horning BD, Paul TA, Ichu TA, Svensson RU, Olucha J, Chang MW, Kok BP, Zhu Z, Ihle NT, Dix MM, Jiang P, Hayward MM, Saez E, Shaw RJ, Cravatt BF (2017) Chemical proteomics identifies druggable vulnerabilities in a genetically defined cancer. Cell 171(3):696–709 e23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bramsen JB, Kjems J (2012) Development of therapeutic-grade small interfering RNAs by chemical engineering. Front Genet 3:154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen QX, Wang WP, Zeng S, Urayama S, Yu AM (2015) A general approach to high-yield biosynthesis of chimeric RNAs bearing various types of functional small RNAs for broad applications. Nucleic Acids Res 43(7):3857–3869 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Esteller M (2011) Non-coding RNAs in human disease. Nat Rev Genet 12(12):861–874 [DOI] [PubMed] [Google Scholar]
  8. Gaudin C, Nonin-Lecomte S, Tisné C, Corvaisier S, Bordeau V, Dardel F, Felden B (2003) The tRNA-like domains of E. coli and A. aeolicus transfer–messenger RNA: structural and functional studies. J Mol Biol 331(2):457–471 [DOI] [PubMed] [Google Scholar]
  9. Hatziapostolou M, Polytarchou C, Aggelidou E, Drakaki A, Poultsides GA, Jaeger SA, Ogata H, Karin M, Struhl K, Hadzopoulou-Cladaras M, Iliopoulos D (2011) An HNF4α-miRNA inflammatory feedback circuit regulates hepatocellular oncogenesis. Cell 147(6):1233–1247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hermeking H (2010) The miR-34 family in cancer and apoptosis. Cell Death Differ 17(2):193–199 [DOI] [PubMed] [Google Scholar]
  11. Ho PY, Yu AM (2016) Bioengineering of noncoding RNAs for research agents and therapeutics. Wiley Interdiscip Rev RNA 7(2):186–197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ho PY, Duan Z, Batra N, Jilek JL, Tu MJ, Qiu JX, Hu Z,Wun T, Lara PN, DeVere White RW, Chen HW, Yu AM (2018) Bioengineered noncoding RNAs selectively change cellular miRNome profiles for cancer therapy. J Pharmacol Exp Ther 365(3):494–506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hutchinson CR (1998) Combinatorial biosynthesis for new drug discovery. Curr Opin Microbiol 1(3):319–329 [DOI] [PubMed] [Google Scholar]
  14. Jian C, Tu MJ, Ho PY, Duan Z, Zhang Q, Qiu JX, DeVere White RW,Wun T, Lara PN, Lam KS, Yu AX, Yu AM (2017) Co-targeting of DNA, RNA, and protein molecules provides optimal outcomes for treating osteosarcoma and pulmonary metastasis in spontaneous and experimental metastasis mouse models. Oncotarget 8(19):30742–30755 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jilek JL, Zhang QY, Tu MJ, Ho PY, Duan Z, Qiu JX, Yu AM (2019) Bioengineered let-7c inhibits orthotopic hepatocellular carcinoma and improves overall survival with minimal immunogenicity. Mol Ther Nucleic Acids 14:498–508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ (2005) RAS is regulated by the let-7 microRNA family. Cell 120(5):635–647 [DOI] [PubMed] [Google Scholar]
  17. Khvorova A,Watts JK (2017) The chemical evolution of oligonucleotide therapies of clinical utility. Nat Biotechnol 35(3):238–248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Knight V, Sanglier JJ, DiTullio D, Braccili S, Bonner P,Waters J, Hughes D, Zhang L (2003) Diversifying microbial natural products for drug discovery. Appl Microbiol Biotechnol 62(5–6):446–458 [DOI] [PubMed] [Google Scholar]
  19. Leader B, Baca QJ, Golan DE (2008) Protein therapeutics: a summary and pharmacological classification. Nat Rev Drug Discov 7(1):21–39 [DOI] [PubMed] [Google Scholar]
  20. Levin AA (2019) Treating disease at the RNA level with oligonucleotides. N Engl J Med 380(1):57–70 [DOI] [PubMed] [Google Scholar]
  21. Li MM,Wang WP, Wu WJ, Huang M, Yu AM (2014) Rapid production of novel pre-microRNA agent hsa-mir-27b in Escherichia coli using recombinant RNA technology for functional studies in mammalian cells. Drug Metab Dispos 42(11):1791–1795 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li MM, Addepalli B, Tu MJ, Chen QX,Wang WP, Limbach PA, LaSalle JM, Zeng S, Huang M, Yu AM (2015) Chimeric microRNA-1291 biosynthesized efficiently in Escherichia coli is effective to reduce target gene expression in human carcinoma cells and improve chemosensitivity. Drug Metab Dispos 43(7):1129–1136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li PC, Tu MJ, Ho PY, Jilek JL, Duan Z, Zhang QY, Yu AX, Yu AM (2018) Bioengineered NRF2-siRNA is effective to interfere with NRF2 pathways and improve chemosensitivity of human cancer cells. Drug Metab Dispos 46(1):2–10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li X, Tian Y, Tu MJ, Ho PY, Batra N, Yu AM(2019) Bioengineered miR-27b-3p and miR-328-3p modulate drug metabolism and disposition via the regulation of target ADME gene expression. Acta Pharm Sin B. 10.1016/j.apsb.2018.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lin PY, Yu SL, Yang PC (2010) MicroRNA in lung cancer. Br J Cancer 103(8):1144–1148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu YP, Berkhout B (2011) miRNA cassettes in viral vectors: problems and solutions. Biochim Biophys Acta 1809(11–12):732–745 [DOI] [PubMed] [Google Scholar]
  27. Liu Y, Stepanov VG, Strych U,Willson RC, Jackson GW, Fox GE (2010) DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli. BMC Biotechnol 10:85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T (2007) MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 133(2):647–658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nelissen FHT, Leunissen EHP, van de Laar L, Tessari M, Heus HA, Wijmenga SS (2012) Fast production of homogeneous recombinant RNA-towards large-scale production of RNA. Nucleic Acids Res 40(13):e102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Paige JS, Wu KY, Jaffrey SR (2011) RNA mimics of green fluorescent protein. Science 333(6042):642–646 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Paige JS, Nguyen-Duc T, Song W, Jaffrey SR (2012) Fluorescence imaging of cellular metabolites with RNA. Science 335(6073):1194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pereira P, Pedro AQ, Tomas J, Maia CJ, Queiroz JA, Figueiras A, Sousa F (2016a) Advances in time course extracellular production of human pre-miR-29b from Rhodovulum sulfidophilum. Appl Microbiol Biotechnol 100(8):3723–3734 [DOI] [PubMed] [Google Scholar]
  33. Pereira PA, Tomas JF, Queiroz JA, Figueiras AR, Sousa F (2016b) Recombinant pre-miR-29b for Alzheimer’s disease therapeutics. Sci Rep 6:19946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pereira P, Pedro AQ, Queiroz JA, Figueiras AR, Sousa F (2017) New insights for therapeutic recombinant human miRNAs heterologous production: Rhodovolum sulfidophilum vs Escherichia coli. Bioengineered 8(5):670–677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pitulle C, Hedenstierna KO, Fox GE (1995) A novel approach for monitoring genetically engineered microorganisms by using artificial, stable RNAs. Appl Environ Microbiol 61(10):3661–3666 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ponchon L, Dardel F (2007) Recombinant RNA technology: the tRNA scaffold. Nat Methods 4(7):571–576 [DOI] [PubMed] [Google Scholar]
  37. Ponchon L, Beauvais G, Nonin-Lecomte S, Dardel F (2009) A generic protocol for the expression and purification of recombinant RNA in Escherichia coli using a tRNA scaffold. Nat Protoc 4(6):947–959 [DOI] [PubMed] [Google Scholar]
  38. Ranaei-Siadat E, Merigoux C, Seijo B, Ponchon L, Saliou JM, Bernauer J, Sanglier-Cianferani S, Dardel F, Vachette P, Nonin-Lecomte S (2014) In vivo tmRNA protection by SmpB and pre-ribosome binding conformation in solution. RNA 20(10):1607–1620 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rosano GL, Ceccarelli EA (2014) Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol 5:172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schindler D, Dai J, Cai Y (2018) Synthetic genomics: a new venture to dissect genome fundamentals and engineer new functions. Curr Opin Chem Biol 46:56–62 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sun F, Fu H, Liu Q, Tie Y, Zhu J, Xing R, Sun Z, Zheng X (2008) Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett 582(10):1564–1568 [DOI] [PubMed] [Google Scholar]
  42. Tu MJ,Ho PY, Zhang QY, Jian C, Qiu JX,Kim EJ, Bold RJ, Gonzalez FJ, Bi H, Yu AM (2019) Bioengineered miRNA-1291 prodrug therapy in pancreatic cancer cells and patient-derived xenograft mouse models. Cancer Lett 442:82–90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wang WP, Ho PY, Chen QX, Addepalli B, Limbach PA, Li MM, Wu WJ, Jilek JL, Qiu JX, Zhang HJ, Li T,Wun T,White RD, Lam KS, Yu AM (2015) Bioengineering novel chimeric microRNA-34a for prodrug cancer therapy: high-yield expression and purification, and structural and functional characterization. J Pharmacol Exp Ther 354(2):131–141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yamadori T, Ishii Y, Homma S, Morishima Y, Kurishima K, Itoh K, Yamamoto M, Minami Y, Noguchi M, Hizawa N (2012) Molecular mechanisms for the regulation of Nrf2-mediated cell proliferation in non-small-cell lung cancers. Oncogene 31(45):4768–4777 [DOI] [PubMed] [Google Scholar]
  45. Yu AM, Jian C, Yu AH, Tu MJ (2019) RNA therapy: are we using the right molecules? Pharmacol Ther 196:91–104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang X, Potty AS, Jackson GW, Stepanov V, Tang A, Liu Y, Kourentzi K, Strych U, Fox GE, Willson RC (2009) Engineered 5S ribosomal RNAs displaying aptamers recognizing vascular endothelial growth factor and malachite green. J Mol Recognit 22(2):154–161 [DOI] [PubMed] [Google Scholar]
  47. Zhang K, Lu X, Li Y, Jiang X, Liu L, Wang H (2019) New technologies provide moremetabolic engineering strategies for bioethanol production in Zymomonas mobilis. Appl Microbiol Biotechnol 103(5):2087–2099 [DOI] [PubMed] [Google Scholar]
  48. Zhao Y, Tu MJ, Wang WP, Qiu JX, Yu AX, Yu AM (2016) Genetically engineered pre-microRNA-34a prodrug suppresses orthotopic osteosarcoma xenograft tumor growth via the induction of apoptosis and cell cycle arrest. Sci Rep 6:26611. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES