Skip to main content
eLife logoLink to eLife
. 2020 Feb 27;9:e50325. doi: 10.7554/eLife.50325

Dullard-mediated Smad1/5/8 inhibition controls mouse cardiac neural crest cells condensation and outflow tract septation

Jean-François Darrigrand 1, Mariana Valente 2, Glenda Comai 3, Pauline Martinez 1, Maxime Petit 4, Ryuichi Nishinakamura 5, Daniel S Osorio 6, Gilles Renault 7, Carmen Marchiol 7, Vanessa Ribes 8,✉, Bruno Cadot 1,✉
Editors: Richard P Harvey9, Marianne E Bronner10
PMCID: PMC7069721  PMID: 32105214

Abstract

The establishment of separated pulmonary and systemic circulation in vertebrates, via cardiac outflow tract (OFT) septation, is a sensitive developmental process accounting for 10% of all congenital anomalies. Neural Crest Cells (NCC) colonising the heart condensate along the primitive endocardial tube and force its scission into two tubes. Here, we show that NCC aggregation progressively decreases along the OFT distal-proximal axis following a BMP signalling gradient. Dullard, a nuclear phosphatase, tunes the BMP gradient amplitude and prevents NCC premature condensation. Dullard maintains transcriptional programs providing NCC with mesenchymal traits. It attenuates the expression of the aggregation factor Sema3c and conversely promotes that of the epithelial-mesenchymal transition driver Twist1. Altogether, Dullard-mediated fine-tuning of BMP signalling ensures the timed and progressive zipper-like closure of the OFT by the NCC and prevents the formation of a heart carrying the congenital abnormalities defining the tetralogy of Fallot.

Research organism: Mouse

Introduction

The heart outflow tract (OFT) is an embryonic structure which ensures the connection between the muscular heart chambers and the embryonic vascular network. Initially, forming a solitary tube called truncus arteriosus, it gets progressively remodelled into two tubes which give rise to the aortic (Ao) and pulmonary (Pa) arteries (Brickner et al., 2000; Figure 1A). This remodelling stands as one of the most sensitive processes during heart morphogenesis. As such, faulty septation of the OFT represents 30% of all congenital heart diseases, with poor clinical prognosis due to improper mixing of oxygenated and deoxygenated blood. This thus calls for a better understanding of the cellular and molecular cues by which the OFT gets septated during development.

Figure 1. Dullard acts as a Smad1/5/8 activity inhibitor in cardiac NCC.

(A) Ai. Schematic representation of the migration routes the cardiac NCC (green) have taken to reach the heart region (red) in a E10.5 mouse embryo. Aii. Schematics of the embryonic heart at E11.5 showing the distal-proximal axis of the OFT. Aiii. Schematic representation of transverse sections through the OFT showing discrete stages of NCC condensation and endocardium septation along the OFT distal-proximal axis. (B) Pecam and GFP immunolabelling and DAPI staining on transverse sections throughout the medial OFT of E11.5 Wnt1Cre or Pax3Cre; Dullardflox/+; Rosa26mTmG embryos. (C) Normalized expression levels of Dullard assayed by q-RT-PCR on single cells isolated after immuno-marking endothelial CD31+ cells from E11.5 Wnt1Cre; Dullardflox/+ and Wnt1Cre; Dullardflox/flox; Rosa26mTmG hearts (dots: value for a single cell; boxplot: mean ± s.e.m.). The primers used to amplify Dullard specifically binds to exons 2 and 3, which are excised by the Cre recombinase. (D) Dullard mRNA distribution detected using RNAscope probes, in transverse sections of E11.5 control and mutant OFTs, assessed by RNAscope. Dullard mRNA levels were significantly reduced in mutant cardiac cushions compared to controls; however, mRNA signals were still detected given the binding of Z pair probes to non-recombined exons 5 to 8 and UTR region. (E) Ei. Schematics of E11.5 heart showing the position of the transverse sections used to quantify the levels of the phosphorylated forms of Smad1/5/8 in iii. Eii. Immunolabelling for P-Smad1/5/8 and GFP, and DAPI staining on transverse sections across the OFT at three distinct distal-proximal levels in E11.5 embryos with the indicated genotype. Eiii. Quantification of P-Smad1/5/8 levels in cardiac NCC along the OFT distal-proximal axis of E11.5 embryos with the indicated genotype (dots: values obtained on a given section; n > 4 embryos per genotype recovered from at least three liters; the black line is the linear regression, the coloured areas delineate the 95% confidence intervals, ***: p-value<0001 for a two-way Anova statistical test). (F) Msx2 and Id2 mRNA distribution detected using RNAscope probes (grey) and immunostaining of GFP (green) in transverse sections of E11.5 control and mutant OFTs (n = 2 embryos). On all A-F panels: green dotted lines delineate the area colonised by cardiac NCC. Ao: aortic artery, Pa: pulmonary artery.

Figure 1.

Figure 1—figure supplement 1. Dullard phosphatase is a negative regulator of BMP signalling in several mammalian cells.

Figure 1—figure supplement 1.

(A) Ai. Western blot detecting the phosphorylated forms of Smad1/5/8, GFP or Gapdh in C2C12 muscle cells with or without BMP2 treatment for 1 hr. These cells were non-transfected (ct) or transfected with either a GFP expressing plasmid (GFP), a GFP tagged version of the wild-type Dullard (Dull) or of Dullard carrying D67E mutation in its phosphatase domain (Dull D67E). Dullard inhibits BMP2-mediated phosphorylation of Smad1/5/8; this inhibition is dependent on the functionality of its phosphatase domain. Aii. Immunofluorescence for P-Smad1/5/8 and GFP and DAPI staining in C2C12 transfected with GFP or GFP-Dullard and exposed for 1 hr to BMP2 showing that only cells transfected with Dullard do not show nuclear phosphorylated Smad1/5/8. Aiii. Quantification of the number of P-Smad1/5/8 positive C2C12 cells exposed to BMP2 for 1 hr and transfected with GFP (ct), Dullard or Dullard carrying the D67E mutation (n = 3 independent experiments; Student t-test **: p-value<0.01.; N.S.: non-significant). (B) Bi. Immunolabelling for P-Smad1/5/8 and GFP and DAPI staining on transverse sections across the OFT at three distinct distal-proximal levels in E11.5 of control Pax3Cre; Dullardflox/+; Rosa26mTmG and mutant Pax3Cre; Dullardflox/flox; Rosa26mTmG hearts. Pale green dotted lines delineate the area colonized by cardiac NCC. Bii. Quantification of P-Smad1/5/8 levels in cardiac NCC along the distal-proximal axis of the OFT of E11.5 embryos with the indicated genotype (dots: values obtained on a given section; n > 4 embryos per genotype recovered from at least three liters; the black line is the linear regression, the coloured areas delineate the 95% confidence intervals, ***: p-value<0001 for a two-way Anova statistical test). Ao: aortic artery, Pa: pulmonary artery. (C) Normalized expression levels of Id1, Msx1 and Msx2 assayed by q-RT-PCR on single GFP+ cardiac NCC isolated from E11.5 Wnt1Cre; Dullardflox/+ and Wnt1Cre; Dullardflox/flox; Rosa26mTmG hearts (boxplot: mean ± s.e.m.). (D) Immunolabelling of P-Smads1/5/8 and Sema3c transcripts detected by ISH on transverse sections of E11.5 control and Dullard mutant at brachial levels. i’’ to i’’’ and ii’’ to ii’’’ are blown up on muscle masses (mm). (E) Immunolabelling for the phosphorylated form of Smad2 and GFP and DAPI staining on transverse sections across the OFT at medial levels in E11.5 of control Pax3Cre; Dullardflox/+; Rosa26mTmG and mutant Pax3Cre; Dullardflox/flox; Rosa26mTmG hearts. Pale green dotted lines delineate the area colonised by cardiac NCC. P-Smad2 levels are similar in control and dullard mutant cardiac NCC. Ao: aortic artery, Pa: pulmonary artery.

Morphogenesis of the OFT is orchestrated in time and space by cross-interaction between several cell types including the myocardial progenitors of the second heart field (SHF), the endocardial cells (EC) delineating the OFT lumen, and the cardiac neural crest cells (cardiac NCC) (Kelly, 2012; Keyte and Hutson, 2012; Figure 1A). Various genetic manipulations or ablation models have highlighted the predominant role of cardiac NCC in initiating and controlling OFT septation (Bockman et al., 1987; Phillips et al., 2013). Originally, cardiac NCC delaminate from the dorsal neural tube and migrate through the pharyngeal mesoderm to reach the developing OFT (Figure 1A). There, they invade the two cardiac cushions, condense toward the endocardium and trigger its rupture, thereby inducing cardiac cushions fusion and creating the two great arteries (Plein et al., 2015; Waldo et al., 1998). The rupture of the endocardium is first detected in the regions of the OFT which are the most distal from the heart chambers. In mouse embryos this rupture initiates around 11.5 days of embryonic development (E11.5; Figure 1A) and then expands progressively to more proximal levels. In parallel to these morphogenetic events, NCC differentiate into the vascular smooth muscles of the aortic arch (Keyte and Hutson, 2012) and also contribute to the arterial valves (Odelin et al., 2018).

Intense investigations to identify the molecular cues controlling the stereotyped behaviour and differentiation of cardiac NCC in the OFT have established the importance of the Bone Morphogenic Proteins (BMP), secreted by the outlying myocardium cells from E8.75 onwards (Danesh et al., 2009; Jiao et al., 2003; Liu et al., 2004; McCulley et al., 2008). Indeed, ablation of the BMP receptor Bmpr1a, ablation of the key downstream transcriptional effector Smad4, or forced expression of the BMP signalling antagonist Smad7 within the NCC lineage all lead to the formation of hypoplastic cushions, a shorter and non-septated OFT, thus phenocopying cardiac NCC ablation experiments (Jia et al., 2007; Stottmann et al., 2004; Tang et al., 2010). Knock-out of the ligand BMP4 from the myocardium similarly prevents OFT septation (Liu et al., 2004). However, little is known about the cardiac NCC behaviour and molecular cascades triggered by BMP signalling and responsible for the cardiac NCC mediated OFT septation.

To gain insights into these molecular cascades, we decided to dissect the role of Dullard (Ctdnep1), a perinuclear phosphatase that functions as a negative intracellular BMP inhibitor, during OFT morphogenesis (Sakaguchi et al., 2013; Urrutia et al., 2016; Sardi et al., 2019). In the canonical BMP signalling cascade, binding of BMP ligands to their transmembrane receptors leads to the phosphorylation of the transcription factors Smad1/5/8 which translocate to the nucleus and modify the transcriptional landscape of targeted cells (Bruce and Sapkota, 2012). Dullard stands out as one of the few cytoplasmic modulators of this phosphorylation step, which also includes PP1A, PP2B, the inhibitory Smads 6 and 7 and the Ubiquitin degradation pathway (Bruce and Sapkota, 2012). The Dullard protein is evolutionary conserved from yeast to mammals and expressed in many embryonic tissues, including the developing neural tube and neural crest cells (Sakaguchi et al., 2013; Satow et al., 2006; Tanaka et al., 2013; Urrutia et al., 2016; Figure 1D). Several pieces of evidence from Drosophila, xenopus, and mouse embryos indicate that this enzyme dampens Smad1/5/8 phosphorylation levels upon BMP stimulation (Sakaguchi et al., 2013; Satow et al., 2006; Urrutia et al., 2016). However, this activity is likely to be tissue specific, as depleting Dullard in gastrulating mouse embryos or later in the limb bud mesenchyme did not impair BMP signalling, while its depletion in the mouse embryonic kidney led to an elevated BMP response (Sakaguchi et al., 2013; Tanaka et al., 2013; Hayata et al., 2015). Regardless of the effect on BMP signalling, Dullard appears as a key regulator of various morphogenetic events regulating the elaboration of embryonic tissues. Early in development, it is required for the expansion of extraembryonic tissues, and later on, it prevents cell death by apoptosis in kidney nephrons or favours the ossification of limb bones (Sakaguchi et al., 2013; Tanaka et al., 2013; Hayata et al., 2015).

We showed here that deletion of Dullard in the cardiac NCC increases Smad1/5/8 activity, leading to premature and asymmetric septation of the OFT and pulmonary artery closure. BMP overactivation in the cardiac NCC occurs concurrently with the downregulation of mesenchymal markers (Snai2, Twist1, Rac1, Mmp14 and Cdh2) and upregulation of Sema3c, which is associated with premature cardiac NCC condensation to the endocardium. Our data converge to a model whereby graded BMP activity, Sema3c expression and cardiac NCC condensation along the OFT axis set the tempo of OFT septation from its distal to its proximal regions. Hence, our findings reveal that fine tuning of BMP signalling levels in cardiac NCC orchestrates OFT septation in time and space.

Results

Dullard deletion triggers hyperactivation of BMP intracellular signalling in cardiac NCC

In order to ablate Dullard in cardiac NCC, we crossed mice carrying floxed alleles of Dullard with mice expressing the Cre recombinase from the Pax3 locus or thanks to Wnt1 enhancer (Danielian et al., 1998; Engleka et al., 2005; Sakaguchi et al., 2013). Cell lineage tracing was achieved by using a ubiquitous double-fluorescent Cre reporter allele, Rosa26mTmG, in which Cre-mediated recombination labels the cells with membrane-targeted GFP (Muzumdar et al., 2007). The pattern of cell recombination in the cardiac cushions of E11.5 control embryos carrying either Cre driver matched with the pattern of colonising cardiac NCC described by previous lineage analyses (Figure 1B; Brown et al., 2001; Jiang et al., 2000). RT-qPCR on single cells isolated by Fluorescence-activated cell sorting (FACS) from dissected OFT and RNAscope in situ hybridization on histological sections were used to monitor Dullard expression and validate its deletion on GFP+ cells upon Cre recombination of Dullard flox alleles (Figure 1C,D). At E11.5, Dullard was ubiquitously expressed in all OFT layers of control embryos. In recombined Wnt1Cre; Dullardflox/flox; Rosa26mTmG embryos, the cardiac NCC displayed a strong reduction in Dullard levels compared to control littermates, while the surrounding tissues remained Dullard positive. Strikingly, in these mutants, the NCC formed a unique mass at the distal part of the OFT, while two distinct NCC cushions were present in the control embryos (Figure 1D), indicating that Dullard regulates the spatial organization of NCC in the OFT (see below).

We next assessed the relationship between Dullard and the activity of the intracellular effectors of BMP signalling, that is the Smad1/5/8 transcription factors, in mammalian cells. As previously shown (Satow et al., 2006), Dullard overexpression in the myogenic cell line C2C12 strongly decreased the levels of phosphorylated Smad1/5/8 induced by BMP2 treatment (Figure 1—figure supplement 1A). In addition, by generating a version of Dullard carrying a phosphatase dead domain, we showed that the role of Dullard as negative modulator of BMP signaling relied on its phosphatase activity (Figure 1—figure supplement 1A). Accordingly, Dullard deletion in cardiac NCC was sufficient to double the levels of P-Smad1/5/8 within the NCC whatever their position along the distal-proximal OFT axis of E11.5 hearts (Figure 1E, Figure 1—figure supplement 1B). To confirm this result, we also looked at the distribution and/or the levels of expression of several well-established BMP signalling pathway downstream targets, namely Id1, Id2, Msx1 and Msx2 (Figure 1F, Figure 1—figure supplement 1C; Miyazono et al., 2005). Quantitative RT-qPCR on isolated E11.5 NCC showed that the levels of Id1 transcripts were significantly elevated by Dullard loss and that Msx1 and Msx2 expression range was shifted towards higher values in mutants compared to control embryos (Figure 1—figure supplement 1C). In agreement, the amount of Msx2 transcripts detected by in situ hybridisation within the NCC in the vicinity of the aorta was greater in mutants compared to control embryos, so was that of Id2 transcripts present throughout all cardiac NCC (Figure 1F). This further indicates that in the cardiac NCC lineage, Dullard acts as a BMP intracellular signalling inhibitor. It is worth mentioning that Dullard was also required to dampen the levels of activated Smad1/5/8 in other cell types, including myogenic cells (Figure 1—figure supplement 1D). Furthermore, while Dullard has also been shown to decrease the levels of phosphorylation of Smads acting downstream of the TGF𝞫 in bone precursors (Hayata et al., 2015), the modulation of Dullard activity did not alter the phosphorylation state of one of these Smads, namely Smad2, in cardiac NCC (Figure 1—figure supplement 1E).

Remarkably, in both control and mutant contexts, P-Smad1/5/8 levels were more elevated distally than proximally (Figure 1Eiii, Figure 1—figure supplement 1Bii), indicating that BMP signalling elicits a graded response in cardiac NCC, which declines as they colonise more proximal OFT areas. Altogether, our results show that Dullard is required in cardiac NCC to dampen the magnitude of the BMP signalling gradient along the proximo-distal axis of the OFT, but is not required for its establishment, which is still observed in mutant embryos.

Dullard deletion in cardiac NCC leads to the emergence of heart abnormalities present in Fallot’s tetralogy

Given that cardiac NCC control OFT septation (Bockman et al., 1987; Phillips et al., 2013; Plein et al., 2015), we next sought to examine the morphology of the OFT in control and Dullard mutants. No gross morphological defects were detected in E10.5 Dullard mutant OFTs (Figure 2—figure supplement 1A). Notably, the endocardium morphology, the thickness and position of the myocardium, the NCC distribution along the outflow tract, were comparable in control and mutant embryos (Figure 2—figure supplement 1A). Strikingly, 24 hr later, severe and penetrant morphological OFT defects were observed in Dullard mutant embryos (Figure 2A,B, Figure 2—figure supplement 1B). To characterize these defects, we first analyzed E11.5–12 hearts labelled for the arterial marker Pecam using 3D lightsheet and confocal microscopy (Figure 2A,B, Figure 2—figure supplement 1B, Videos 1 and 2). At distal levels, the OFT of control embryos displayed symmetrical septation with two great arteries of similar size (Figure 2Ai,Bi, Figure 2—figure supplement 1Bi - Video 1). In contrast, Pax3Cre or Wnt1Cre; Dullardflox/flox embryos exhibited an asymmetric breakdown of the endocardium on the pulmonary side with obstruction of the pulmonary artery (Pa) (Figure 2Aii,Biv, Figure 2—figure supplement 1Biv - Video 2). At more medial levels in control embryos, the pulmonary pole of the endocardium was still connected to its aortic pole (Figure 2Bii, Figure 2—figure supplement 1Bii). This pole was also attached to the presumptive pulmonary valve intercalated-cushion (PV-IC), a cell cluster recognisable by faint levels of endothelial markers such as Pecam (Mifflin et al., 2018). Conversely, the aortic and pulmonary poles of the endocardium were prematurely septated and the NCC cushions were fused in the medial portion of the mutant OFT (Figure 2Bv, Figure 1—figure supplement 1Bv). Similarly to the observations made at distal levels, pulmonary endocardium cells were aggregated together failing to delineate a lumen. Furthermore, NCC often intervened between the residual pulmonary endocardium cells and the presumptive pulmonary valve intercalated-cushion (PV-IC) (Figure 2Bv). At proximal regions, the shape of the OFT endocardium and the surrounding NCC cushions were similar in both mutant and control embryos (Figure 2A,Biii,vi, Figure 2—figure supplement 1Biii,vi). We also checked for the state of the peripheral sheet of myocardium composing E11.5 control and Dullard mutant OFTs by immunolabelling the myosin heavy chain or the transcription factor Islet1/2 (Isl1/2) (Figure 2—figure supplement 1C,D). No significant differences could be detected between the control and mutant OFTs.

Figure 2. Dullard deletion in cardiac NCC causes asymmetric and premature OFT septation similar to Fallot’s tetralogy.

(A) Three-dimensional rendering of the Pecam+ endocardium of E12 Pax3Cre; Dullardflox/+ and Pax3Cre; Dullardflox/flox embryos after 3Disco clearing and lightsheet acquisition (n = 3 per genotype). The fine oblique white line marks the Pa width. The OFT levels along its distal-proximal axis analyzed in B are also indicated. (B) Immunolabelling for Pecam (red), GFP (green) and DAPI (blue) on transverse sections along the distal-proximal axis of the OFT in E11.5 embryos with the indicated genotypes (n > 10 embryos collected from more than three liters). Brackets in i and iv highlight the symmetric and asymmetric Ao and Pa poles in control and mutant embryos, respectively. Arrowheads in ii and v point at the unruptured and ruptured endocardium in control and mutant embryos, respectively. (C) Percentage of living Dullard mutant embryos before E12.5 and after E12.5, carrying the indicated Cre driver. (D) Immunolabelling for Pecam, GFP and DAPI staining on sections through the hearts of E14.5 (i,ii,v,vi) and E18.5 (iii,iv) embryos with the indicated genotypes (n = 2 embryos per genotype). Arrowheads in ii and arrow in iv point at a septation defect, the star in vi indicates the lack of Pa. (E) Whole dissected E18.5 hearts coming from embryos with the indicated genotype (n = 2 per genotype). (F) Two cycles of blood flow measured at the level of the abdominal artery of E11.75 control embryos and indication of the parameters analysed. VTI: velocity time integral. Parameters (i-iii) of the blood flow velocity measured in the abdominal artery of E11.75 control (turquoise dots) and Wnt1Cre; Dullardflox/flox embryos (purple squares)(dots and squares: mean of two to five measures obtained on a single embryo, bars: mean ± s.e.m; differences evaluated using a Mann-Whitney test: N.S. non-significant, *: p<0.05, **: p<0.01, ***: p<0.001). i. peak systolic velocity, ii. end-diastolic velocity, iii. mean of three velocity time integrals (n = 10 mutants and n = 32 controls). Ao: aortic artery, Pa: pulmonary artery, PV IC: pulmonary valve intercalated-cushion.

Figure 2.

Figure 2—figure supplement 1. Morphological defects in Dullard mutants become striking from E11.5 onwards.

Figure 2—figure supplement 1.

(A) MF20 (myosin heavy chain) and GFP immunostaining and DAPI staining on transverse sections (i,iii) and coronal sections (ii,iv) in E10.5 embryos with the indicated genotype. (B) Immunolabelling for Pecam (red) and GFP (green) and DAPI (blue) staining on transverse sections along the distal-proximal axis of the OFT in E11.5 embryos with the indicated genotypes (n > 10 embryos collected from more than three liters). (C) Immunolabelling of MF20, Isl1/2, Pecam and GFP, as well as DAPI staining, on transverse sections of E11.5 hearts of embryos with the indicated genotypes. Ao: Aorta; Pa: pulmonary artery; ba: branchial arch; myoc: myocardium; Lv: left ventricle; Rv: right ventricle.

Video 1. Three-dimensional rendering of cardiac NCC (green) over Pecam (white) after BABB clearing and Lightsheet acquisition of Pax3Cre; Dullardflox/+; Rosa26mTmG and Pax3Cre; Dullardflox/flox; Rosa26mTmG E12 embryos.

Download video file (1.9MB, mp4)

No defect in the OFT colonisation of mutant cardiac NCC is observed.

Video 2. Three-dimensional rendering of cardiac NCC (green) over Pecam (white) after BABB clearing and Lightsheet acquisition of Pax3Cre; Dullardflox/+; Rosa26mTmG and Pax3Cre; Dullardflox/flox; Rosa26mTmG E12 embryos.

Download video file (1.3MB, mp4)

No defect in the OFT colonisation of mutant cardiac NCC is observed.

In order to evaluate the physiological impact of these OFT defects on cardiac function, we first attempted to harvest older embryos to conduct a histological characterisation of their hearts. The premature death of Pax3Cre or Wnt1Cre; Dullardflox/flox embryos after E12.5 complicated this task (Figure 2C). Nevertheless, in the handful of Dullard mutant embryos collected alive at E14.5 or E18.5, we consistently observed hearts with an interventricular septum (compare Figure 2Dii,iv with 2Di,iii), a hypertrophy of their right ventricle compared to their left one (compare Figure 2Div with 2Diii), a wide aorta connected to both ventricles (Figure 2Dvi, E) and pulmonary stenosis (compare Figure 2Dvi with 2Dv, asterisk in E). These are the four major heart morphological traits defining the tetralogy of Fallot (TOF)’s condition (Neeb et al., 2013). Second, we imaged the blood flow passing through the abdominal artery of E11.75 Wnt1Cre; Dullardflox/flox and Wnt1Cre; Dullardflox/+ embryos using doppler ultrasound (Figure 2F; see Material and methods section; Nomura-Kitabayashi et al., 2009). Several hemodynamic parameters were affected in Dullard mutants compared to controls. Notably, the systolic velocity peaked at a lower level in mutants compared to controls, suggesting a compromised blood ejection from the heart (Figure 2Fi). Conversely, the heart relaxation phase was less affected as no differences in the diastolic velocity were detected (Figure 2Fii). Overall, the blood flow was weaker in the mutants than in controls, as indicated by a decrease in the mean of the velocity time integral (VTI) (Figure 2Fiii).

Dullard prevents the premature condensation of cardiac NCC

We next wanted to further investigate the cellular mechanisms by which Dullard in NCC ensures OFT septation and started evaluating the migrative, proliferation and death status of cardiac NCC (Figure 3A, Figure 3—figure supplement 1, Videos 1–4). Whole mount immunostaining and 3D-reconstructions revealed that GFP+ cardiac NCC reached similar OFT levels in E11.5 control and Dullard mutants, showing that Dullard is not required for NCC colonisation of the OFT (Figure 3A, Videos 1–4). Similarly, quantification of cell proliferation and apoptosis on tissue sections, using antibodies raised against the phosphorylated form of histone H3 and the cleaved version of Caspase three respectively, indicated that Dullard does not control the proliferation nor the survival of cardiac NCC (Figure 3—figure supplement 1Ai-iv). In agreement with these observations, the total number of GFP+ cells colonising the OFT in mutant embryos was not significantly different from that found in controls (Figure 3—figure supplement 1Av, vi).

Figure 3. Dullard does not affect NCC migration, but prevents NCC premature condensation.

(A) Three-dimensional rendering of cardiac NCC (green) over Pecam (white) after BABB clearing and confocal acquisition (Wnt1cre samples) or 3disco clearing and lightsheet microscopy (Pax3cre samples) of whole E11.5 hearts isolated from embryos with the indicated genotype (n = 2 per genotype). (B) Coloured coded orientation of the major axis of NCC cells relative to Ao-Pa axis colour-coded as indicated in the section shown in Figure 2Bi–vi. (C) DAPI staining on transverse sections through the medial part of the OFT of E11.5 embryos with the indicated genotype. Magnified regions on the right are indicated by white rectangles in NCC cushions. The entire OFT is circled with a while line. The endocardium is delineated in red, the condensed and round NCC in green, the loose and elongated NCC in yellow. (D) Minimum distances between NCCs (Di) and distances between NCCs and the endocardium (Dii) quantified along the distal-proximal axis of the OFT in E11.5 embryos with the indicated genotypes (n = 3 embryos from distinct liters were analyzed for each genotype and OFT level, bars: mean ±s.d.; ***: p-value<0.0001 for Student statistical t-test). Ao: Aorta; Pa: pulmonary artery; Lv: left ventricle; PV-IC: Pulmonary valve intercalated-cushion; Rv: right ventricle.

Figure 3.

Figure 3—figure supplement 1. Morphogenetic defects in Dullard NCC mutants.

Figure 3—figure supplement 1.

(A) Quantification of the total number of activated caspase 3+ apoptotic NCC (i,ii), PH3+ mitotic cardiac NCC (iii,iv) and GFP+ cardiac NCC (v,vi) per OFT section at the indicated distal-proximal OFT axis levels (dots: value per section; bars: mean ±s.d.; n.s.: non-significant differences evaluated using a Mann-Whitney test). (B) Orientation of the major axis of NCC cells relative to Ao-Pa axis colour coded as indicated in the section shown in Figure supplement 2B. (C) Quantification of the OFT surface area measured at distinct distal-proximal axis levels in control and Dullard mutants at E11.5 (dots: values obtained on a given section; n > 4 embryos per genotype recovered from at least three liters; the black line is the linear regression, the coloured areas delineate the 95% confidence intervals, ***: p-value<0001 for a two way-Anova statistical test).

Video 3. Three-dimensional rendering of cardiac NCC (green isosurface) over Pecam (red isosurface) and Dapi (white) of Wnt1Cre; Dullardflox/+; Rosa26mTmG and Wnt1Cre; Dullardflox/flox; Rosa26mTmG E11.5 embryos.

Download video file (3.9MB, mp4)

No defect in the OFT colonisation of mutant cardiac NCC is observed, and reduction of the pulmonary artery is visible in the mutant.

Video 4. Three-dimensional rendering of cardiac NCC (green isosurface) over Pecam (red isosurface) and Dapi (white) of Wnt1Cre; Dullardflox/+; Rosa26mTmG and Wnt1Cre; Dullardflox/flox; Rosa26mTmG E11.5 embryos.

Download video file (3.2MB, mp4)

No defect in the OFT colonisation of mutant cardiac NCC is observed, and reduction of the pulmonary artery is visible in the mutant.

Finally, we wondered whether the morphogenetic defects of the mutant OFT could stem from differences in cell-cell arrangements, looking at the position and orientation of NCC and endocardial cell nuclei (Figure 3B–D, Figure 3—figure supplement 1B–C). The orientation of the cardiac NCC nuclei relative to the endocardium appeared spatially regulated along the proximal-distal axis of the OFT, in both mutant and control hearts (Figure 3B,C, Figure 3—figure supplement 1B). In controls, NCC perpendicular to the endocardium could be found at distal levels, while at proximal levels no orientation preference could be assigned (blue dashes in Figure 3B, Figure 3—figure supplement 1B). Strikingly, in Wnt1Cre; Dullardflox/flox OFTs the perpendicular orientation was more widely observed at medial levels than in control OFT (blue dashes in Figure 3B, Figure 3—figure supplement 1B). Moreover, quantification of the shortest distance between adjacent cardiac NCC nuclei indicated that in E11.5 control hearts NCC condensation was also variable along the distal-proximal axis of the OFT (Figure 3C,Di). Cells were closer to each other at distal levels than in proximal regions. This progression of NCC condensation along the OFT axis was impaired in Dullard mutants, whereby mutant NCC prematurely condensed within the medial region of the OFT (Figure 3C,Di). Finally, the position of NCC to the endocardium was variable along the OFT axis of control embryos with NCC being closer to this epithelium at distal levels than at proximal levels (Figure 3C,Dii). In the mutants, NCC were in a closer vicinity of the endocardium than control cells, so that in medial levels they displayed traits of cells normally found at distal levels in control hearts (Figure 3C,Dii). In agreement with these data, the OFT area was reduced in mutants and remained more constant along the distal to proximal axis (Figure 3—figure supplement 1C).

Taken together Figures 2 and 3 data demonstrate that Dullard stands as a key modulator of NCC behaviour dynamics in the heart and hence of OFT septation. It precipitates NCC condensation, and thereby leads to the premature breakage of the endocardium and obstruction of the pulmonary artery. This weakens the embryonic hemodynamics and compromises the living of Dullard mutant embryos (see discussion). Our data also brings further support to the idea that morphogenetic defects in the NCC-derived cushions stand as one possible cause of Fallot's tetralogy (Neeb et al., 2013).

Dullard deletion in NCC mainly affects the transcriptional state of NCC

To decipher the molecular basis of the defective OFT remodeling observed in mutants, we micro-dissected Wnt1Cre; Rosa26mTmG E11.5 control and Dullard mutant heart OFTs and sorted the cardiac NCC (GFP+) and endocardial cells (CD31+; RFP+) from the other OFT cell-types (CD31-; RFP+) (Figure 4A). We then performed single-cell RT-qPCR for 44 genes implicated in epithelial-mesenchymal transition (EMT), migration and/or specification of the different OFT progenitor subtypes (Supplementary file 1), and their expression levels were normalised to GAPDH and ActB (Figure 4B).

Figure 4. Single-cell transcriptional analyses of all OFT cells at E11.5.

Figure 4.

(A) Experimental steps performed to profile gene expression in OFT single-cells sorted from five Wnt1Cre; Dullardflox/+; Rosa26mTmG and five Wnt1Cre; Dullardflox/flox; Rosa26mTmG E11.5 embryos. At least 70 cells were isolated per gate and genotype (GFP+, CD31+, RFP+). (B) Graph showing the distribution of all cells analysed (dots) as a function of normalised expression values of the house keeping genes Actb and Gapdh and a linear regression (red line). (C) t-SNE plot showing the distribution of 44-genes-based transcriptomes of 433 OFT cells expressing the indicated markers isolated from both Wnt1Cre; Dullard+/flox; Rosa26mTmG and Wnt1Cre; Dullardflox/flox; Rosa26mTmG E11.5 embryos. (D) Unsupervised clustering heatmap of the 433 OFT isolated cells from Wnt1Cre; Dullard+/flox; Rosa26mTmG and Wnt1Cre; Dullardflox/flox; Rosa26mTmG based on the gene expression level of the 44 genes included in the panel (Supplementary file 1). Six different groups of cells can be discriminated, among which the endocardial (Group 1) cells expressing high levels of Flt1, Kdr, Nfatc1 and Tek, and the epicardial (Group 5) cells expressing high levels of Wt1, Tcf21..

T-statistic Stochastic Neighbour Embedding (t-SNE) was first used to plot the distances existing between the 44 gene-based-transcriptomes of individual cells (Figure 4C). It revealed that the 44 chosen genes were sufficient to segregate the three isolated cell subtypes, GFP+ NCC, the RFP+;CD31+endocardial cells and the other RFP+;CD31- OFT cells, validating our approach. Unsupervised hierarchical clustering analysis of all cells refined this segregation and identified six distinct groups of OFT cells (Figure 4D). Importantly, some of these groups contained both control and Dullard mutant cells (Groups 1, 3, 5) meaning that their 44 gene-based-transcriptome was not drastically dependent on Dullard. Instead, the three other groups were enriched for cells with a given genotype (Groups 2, 4, 6), hence harboured a Dullard dependent transcriptional state. Importantly, most GFP+ NCC were contained in the Groups 2, 4, 6, while the other groups were enriched for other cell types. For instance, the RFP+;CD31+ (Flt1+;Kdr+;Nfatc+;Tek+) endocardial cells and the RFP+;CD31- (Tcf21+;Wt1+) epicardial cells defined the Groups 1 and 5, respectively. Group 3 contained Isl1+ and Six2+ cells coming from GFP+ (NCC) and RFP+;CD31- (including myocardial) lineages. Overall, it suggests that Dullard deletion in NCC mainly alters the transcriptional states cell-autonomously and modulates to a much lesser extent the surrounding cell types present in the developing E11.5 heart.

Transcriptomic heterogeneity in non NCC-derived populations upon Dullard deficiency

We next focused on the transcriptomic variations operating in the distinct OFT specific cell populations, starting with the RFP+;CD31+endocardial cells and RFP+;CD31- OFT cells (Figure 5Ai–ii’, Figure 5—figure supplement 1). Hierarchical clustering and two-dimensional visualisation of cells on diffusion maps indicated that in both cell types, some transcriptomic heterogeneity was found and distinct subpopulations could be isolated (Figure 5Ai–ii’, Figure 5—figure supplement 1A). All 5 RFP+;CD31- subpopulations identified contained both control and mutant cells (Figure 5Ai,i’), sustaining the idea that Dullard loss in cardiac NCC does not impair the differentiation of the SHF-derived myocardium and smooth muscle, nor the differentiation of the epicardium (see also Figure 2—figure supplement 1C). Similarly, the vast majority of RFP+;CD31+ cells (four out of six subpopulations (sub-pops 2 to 5)) presented both mutant and control cells (Figure 5Aii,ii’, Figure 5—figure supplement 1A). The transcriptomic heterogeneity between these RFP+;CD31+ subpopulations was mild and these cells were all Kdr+, Foxc1+, Nfatchigh, Flt1+, Nrp1+, Plxnd1 High, as expected for the endocardium (blue rectangles in Figure 5—figure supplement 1A). However, the subpopulation 1 of RFP+;CD31+ cells was enriched in control cells while the subpopulation six in mutant cells (Figure 5Aii,ii’). From the genes that drive the segregation of these CD31+ subpopulations (Figure 5—figure supplement 1B), very few of them were specifically induced or repressed in the subpopulation six or the subpopulation one compared to the others subpopulation (Figure 5—figure supplement 1C). Out of them stood Twist1 and Sox9, which were enriched in the subpopulation 1. Accordingly, while few Twist1+ cells could be immunolabelled within the endocardium of control embryos, these were almost undetectable in mutant embryos (Figure 6A). Twist1 being one of the epithelial-mesenchymal transition (EMT) drivers, it suggests that endocardial EMT is affected by the absence of Dullard in the NCC (see discussion).

Figure 5. Impact of Dullard deletion in NCC on the transcriptomic variations within the distinct cellular subtypes of E11.5 hearts.

(A) Projected position of 44 genes-based transcriptomes assessed in mutant and control CD31+; RFP+ and CD31-; RFP+ OFT cells on diffusion maps made using the first two Diffusion Component 1 (DC1) and 2 (DC2) (Figure 5—figure supplement 1B). Sub-populations defined with hierarchical clustering are presented in i and ii, while the genotype of cells is illustrated in i’ and ii’. (B, C) Projected position of 44 genes-based transcriptomes assessed in mutant and control cardiac GFP+ NCC on diffusion maps made using the first two Diffusion Component 1 (DC1) and 2 (DC2) (see Figure 5—figure supplement 2B). The five subpopulations defined in Figure 3A are highlighted. (D) Percentage of cardiac NCC in each subpopulation. (E) Heatmaps showing the levels of expression of selected genes in all GFP+ NCC in the five subpopulations identified using unsupervised hierarchical clustering (Figure 5—figure supplement 2A) coming from control (blue) or mutant (orange) E11.5 embryos. (F) Boxplot representation of the expression levels of genes differentially expressed between the five NCC subpopulations (Sub-Pop 1: 44 cells, Sub-Pop 2: 29 cells, Sub-Pop3: 20 cells, Sub-Pop 4: 34 cells, Sub-Pop 5: 24 cells) (mean ±s.d.).

Figure 5.

Figure 5—figure supplement 1. Transcriptional profiling of CD31+; RFP+ OFT cells.

Figure 5—figure supplement 1.

(A) Unsupervised clustering heatmap of 139 CD31+; RFP+ endocardium cells isolated from Wnt1Cre; Dullard+/flox; Rosa26mTmG and Wnt1Cre; Dullardflox/flox; Rosa26mTmG based on the gene expression level of the 44 genes included in the panel (Supplementary file 1). Six different subpopulations can be identified, two of which (Sub-Pop 1 and 6) are enriched for either mutant (Sub-Pop 6) or control cells (Sub-Pop 1). (B) Genetic composition of the diffusion components (DC) 1 and 2 for CD31+; RFP+ endocardium cells on which are based the diffusion maps presented in Figure 5A. (C) Boxplot representation of the expression levels of genes highlighted in DC1 and 2 shown in B in the 6 subpopulations of CD31+; RFP+ endocardium cells defined in A (mean ±s.d.).
Figure 5—figure supplement 2. Single-cell transcriptional profiling of GFP+ NCC at E11.5.

Figure 5—figure supplement 2.

(A) Unsupervised clustering heatmap of 151 GFP+ NCC isolated from Wnt1Cre; Dullard+/flox; Rosa26mTmG and Wnt1Cre; Dullardflox/flox; Rosa26mTmG based on the gene expression level of the 44 genes included in the panel (Supplementary file 1). Five different subpopulations can be identified, two of which (Sub-Pop 1 and 2) are not Dullard dependent, while the three others (Sub-Pop3 to 5) are enriched for either mutant (Sub-Pop 4,5) or control cells (Sub-Pop 3). Stars indicate genes involved in the mesenchymal state. The circles marks instead the genes associated with an epithelial fate. The arrows points at genes encoding for smooth muscle specific genes marking the subpopulation 3. Crescents point to typical cardiac genes, whereas squares point to genes involved in valve formation. (B) Genetic composition of the diffusion components (DC) 1 and 2, on which are based the diffusion maps presented in Figure 5B and C. (C) Boxplot representation of the expression levels of genes highlighted in DC1 and 2 in B and not presented in Figure 5F, in the GFP+ NCC cells from both genotypes (mean ±s.d.).

Figure 6. Dullard prevents NCC from acquiring epithelial-like traits and prolongs the expression of mesenchymal drivers.

(E) Twist1 immunolabelling and RFP signal (red; grey), Snai2 mRNA distribution assessed by RNAscope (red; grey), GFP (green) immunolabelling and DAPI staining on transverse sections through the medial OFT of E11.5 Wnt1Cre; Dullardflox/+; Rosa26mTmG and Wnt1Cre; Dullardflox/flox; Rosa26mTmG embryos. The red lines mark the endocardium, green arrowheads point at NCC, while the white ones indicate the endocardium. The white lines delineate the cardiac NCC cushions. RFP and GFP mark cell membrane whereas Twist1 is cytoplasmic or nuclear. (B) Sema3c expression assessed by ISH on transverse sections from distal to medial OFT levels of E11.5 Wnt1Cre; Dullardflox/+ and Wnt1Cre; Dullardflox/flox embryos. The endocardium is delineated with a red line, the cardiac NCC areas with a green line and the myocardium with grey lines. (C) Normalized expression levels of Sema3c assayed by q-RT-PCR on single cells isolated after immuno-marking endothelial CD31+ cells from E11.5 Wnt1Cre; Dullardflox/+ and Wnt1Cre; Dullardflox/flox; Rosa26mTmG hearts (dots: value for a single cell; boxplot: mean ± s.e.m.). (D) Model for the molecular and cellular cues controlling OFT septation. Upper panel: Morphogenesis of the single truncus arteriosus at E10.5 into fully formed great arteries at E14.0. Middle panel: Shape of P-Smad1/5/8 and Sema3c gradients along the OFT distal-proximal axis in a control situation. NCC in the cardiac cushions condense toward the endocardium between the aorta and the pulmonary trunk. Lower panel: Premature condensation of NCC at the pulmonary trunk in absence of Dullard in NCC, is associated with increased levels of Sema3c and BMP signalling.

Figure 6.

Figure 6—figure supplement 1. Dullard loss in cardiac NCC alters the expression of Sema3c specifically in NCC.

Figure 6—figure supplement 1.

(A) Sema3c expression assessed by ISH on transverse sections from distal to medial OFT levels of E11.5 Pax3Cre; Dullardflox/+ and Pax3Cre; Dullardflox/flox embryos. The endocardium is delineated with a red line, the cardiac NCC areas with a green line and the myocardium with grey lines. (B) Sema3c mRNA distribution assessed by RNAscope, GFP immunolabelling and DAPI staining in transverse sections of E11.5 control Wnt1Cre; Dullardflox/+and mutant Wnt1Cre; Dullardflox/flox OFTs at distal levels.

Dullard controls the mesenchymal transcriptional state of cardiac NCC

Given the key defects observed in NCC condensation in Dullard mutants, we then focused on the gene expression signature of GFP+ NCC. With similar approaches as above we could identify five GFP+ NCC subpopulations based on their gene expression signature (Sub Pops 1 to 5) (Figure 5B, Figure 5—figure supplement 2A), each of them containing an unbalanced ratio of mutant versus control cells (Figure 5C,D), suggesting that Dullard influences the fate of all NCC subtypes. The NCC subpopulation 1 was characterised by the expression of Nfatc1, Tcf21, Postn (Periostin) (Figure 5—figure supplement 2A–C), which are all expressed in the heart valves (Acharya et al., 2011; Norris et al., 2008; Wu et al., 2011), a heart structure that is also colonised by NCC (Odelin et al., 2018). The slight enrichment for control cells in this subpopulation raised the possibility that Dullard is required to favour the contribution of NCC to this structure (Figure 5C). The second subpopulation was defined by the predominant expression of cardiac progenitor markers Tbx1, Six2, Gja1, Isl1, and contained both control and mutant cardiac NCC (Figure 5—figure supplement 2A–C), indicating that Dullard is not required for the entry of NCC into the smooth muscle lineage (Zhou et al., 2017). This is in agreement with the distribution of Isl1 we observed in control and mutant embryos (Figure 2—figure supplement 1C). Conversely, the emergence of the subpopulation 3 was strictly dependent on Dullard, as this subpopulation barely contained mutant cells (Figure 5C,D, Figure 5—figure supplement 2A). Subpopulation 3 corresponded to NCC further differentiated toward the smooth lineage as defined by expression of Myh11 and Acta2 (Huang et al., 2008; Figure 5D,E). The subpopulations 4 and 5 were enriched for mutant cardiac NCC (Figure 5C–E, Figure 5—figure supplement 2A). The transcriptomic state of the cells in these two subpopulations diverged from that of the subpopulation 3 cells (Figure 5C,E,D). This divergence was greater for the subpopulation 5 than for the Ssubpopulation 4. Yet, the position of cells within the diffusion maps suggests a close relationship between these two subsets of cells which might represent two states of the differentiation path of Dullard deleted cardiac NCC (Figure 5C).

Strikingly, genes that were differentially expressed between subpopulation 3 and the subpopulation 4/5 encode for known regulators of cell adhesion and epithelial-mesenchymal transition. On the one hand, the levels of mesenchymal markers (Snai2, Twist1, Cdh2, Mmp14, Rac1) in both subpopulations 4 and 5 were lower than in the subpopulation 3. In control embryos, NCC expressing these markers were found near the endocardium, as demonstrated by an ISH for Snai2 or immunolabelling for Twist1 (Figure 6A). In mutants, these pro-epithelial-mesenchymal transition factors were barely detected in NCC. These data are in agreement with the NCC over-condensation phenotype observed in Dullard mutants nearby the endocardium. On the other hand, cells in subpopulations 4 and 5 displayed higher levels of the epithelial markers Cdh5 and of Sema3c compared to subpopulation 3 cells. In situ hybridization of Sema3c further confirmed these results with cellular resolution (Figure 6B, Figure 6—figure supplement 1A,B), showing that at distal OFT levels, Sema3C was expressed in a scattered fashion in NCC in cushions of control embryos, while it was found in almost all NCC in mutants. Importantly, we observed a graded decrease of Sema3c expression along the OFT axis in both control and mutant embryos. This was reminiscent of the BMP response and condensation gradients described previously (Figures 1E and 3D) and in agreement with the established role of Sema3c in the regulation of cohesive/metastatic balance in several cancers (Tamagnone, 2012).

Altogether, our results show that Dullard prevents the establishment of an epithelial-like state and promotes the expression of pro-mesenchymal genes in NCC. In addition, it may also impair the epithelial mesenchymal transition of the endothelial cells (see discussion).

Discussion

Our analysis of the functions of the Dullard phosphatase in cardiac NCC brings us to propose a model whereby a BMP-dependent gradient of cardiac NCC condensation would set the timing of cardiac cushions fusion and thereby the septation of the OFT into the aorta and pulmonary artery. In addition, the analogy between the phenotype of Dullard mutant mice and patients suffering from Fallot’s tetralogy condition calls for a discussion on the cellular and molecular aetiology of this complex congenital heart disease.

First, we showed that a gradient of BMP activation exists in the cardiac NCC along the OFT axis and matches with a gradient of NCC condensation. The magnitude of this BMP gradient is under the control of the phosphatase Dullard. Yet, the establishment of this gradient is dependent on other mechanisms, as the gradient is still observed in absence of Dullard in the cardiac NCC. The establishment of this gradient is unlikely to result from a corresponding gradient of ligand that would diffuse from a localized distal source, as described in other contexts (Bier and De Robertis, 2015). In fact, BMP4 is homogeneously expressed in the myocardium throughout the entire length of the OFT and not solely at the distal level (Jia et al., 2007; Jiao et al., 2003; Jones et al., 1991; Zhang et al., 2010). Rather, intracellular signalling inhibitors could allow a temporal adaptation of cardiac NCC to BMP signals along with their migration towards proximal levels of the OFT. Prominent expression of Smad6, a BMP negative feedback effector, and of the diffusible inhibitor Noggin, are indeed observed in the OFT from E10.5 throughout the great arteries formation and thus represent promising candidates (Choi et al., 2007; Galvin et al., 2000).

Secondly, several lines of evidence support the idea that the elevation of BMP signalling in Dullard mutants underpins the premature condensation of cardiac NCC and the strong pulmonary artery atrophy. While in other biological systems, Dullard loss has been associated with decreased Wnt-𝞫-Catenin signalling (Tanaka et al., 2013) or enhanced TGF𝞫-Smads2/3 signalling (Hayata et al., 2015), these signalling pathways are probably not affected upon Dullard deletion in the cardiac NCC. On the one hand, we showed that the phosphorylation state of Smad2 in Dullard mutant and control cardiac NCC was comparable (Figure 1—figure supplement 1E). On the other hand, loss of Wnt signalling in cardiac NCC leads to persistent truncus arteriosus, which is associated with reduced NCC-mediated cushion fusion (Brade et al., 2006). Furthermore, gain- and loss-of-function experiments argue that BMP levels stand as a sufficient parameter to tune the degree of condensation of cardiac NCC towards the endocardium. Lowering BMP levels was shown to prevent fusion of the cardiac cushions and leads to persistent truncus arteriosus (Jia et al., 2007; Stottmann et al., 2004). Instead, we showed that increasing downstream BMP signalling due to Dullard loss triggers premature cardiac NCC condensation to the endocardium and accentuated OFT septation (Figure 2). This phenotype is reminiscent of the misplaced septation and narrowing of one of the OFT tubes observed in mouse mutants for the BMP and TGF𝞫 signalling antagonist Smad6 (Galvin et al., 2000). As such, the BMP signalling gradient can be seen as a means that allow septation of the OFT to proceed in a zipper-like fashion. This is further supported by the fact that altering the ability of cardiac NCC to contract, migrate and adhere, hence to condense, prevents the correct formation and positioning of the aorticopulmonary septum (Luo et al., 2006; Phillips et al., 2013; Plein et al., 2015).

Thirdly, we have uncovered part of the cellular and molecular mechanism by which Dullard controls cardiac NCC behaviour. Dullard deletion triggers a downregulation of mesenchymal markers reminiscent of a cardiac NCC transition towards epithelial-like states, with a loss of migratory freedom and increased cohesiveness between cells (Kim et al., 2017). Furthermore, out of the transcriptional changes induced by the loss of Dullard, several lines of evidence support the idea that the up-regulation of Sema3c is likely to play a predominant role in the increased condensation of the cardiac NCC. In fact, the expression of Sema3c in the cardiac NCC is required for their convergence to the endocardium and was also shown to promote the aggregation of cardiac NCC in primary cultures as well as in cancer cells in vivo (Delloye-Bourgeois et al., 2017; Feiner et al., 2001; Kodo et al., 2017; Plein et al., 2015; Toyofuku et al., 2008). In addition, the Sema3C-Nrp1 signalling has been proposed as a triggering signal for the EMT of the endocardium which accompanies its rupture (Plein et al., 2015). Intriguingly, our data show that the elevation of Sema3c in Dullard mutants is associated with variations in the expression of EMT factors in the endocardium (Figure 5—figure supplement 1), that would indicate that either the endocardium EMT is inhibited or has taken place prematurely. Testing the first possibility would require a fine quantification over time of rare EMT figures within the endocardium of control and Dullard mutants at several developmental stages. Yet, in the light of the premature septation of the endocardium we observed in Dullard mutants, we favour the second possibility. The elevation of Sema3c in Dullard mutants raises also the question about the nature of the regulatory relationship existing between BMP signalling and Sema3c expression. Embryos from the Pax3Cre driver line harbour myogenic recombined cells which, as the cardiac NCC, show a striking increase in phosphorylation of Smad1/5/8 and Sema3c expression when Dullard is deleted (Figure 1—figure supplement 1E). This suggests that the regulatory influence of BMP signaling on Sema3c expression is not restricted to the context of cardiac NCC but also to other cell types. However, it remains unclear if Smads act directly on Sema3c expression or indirectly via an intermediate transcription factor. In fact, Gata6, a member of the zinc finger family of transcription factors, has been described as an activator of Sema3c expression in the cardiac NCC (Kodo et al., 2017; Lepore et al., 2006). Yet, we did not observe any significant difference of Gata6 expression in Dullard deleted cardiac NCC (data not shown).

Finally, our data indicates that mice in which Dullard is deleted in the NCC harbours the traits of patients affected by Fallot’s tetralogy condition, and thus represents one of the rare animal models for this pathology (Neeb et al., 2013). Interestingly, while the few well-characterized genetic causal factors identified in humans (such as Jag1, Nkx2.5, Tbx5) and the analysis of few mouse mutants would primarily incriminate defects at the level of the SHF, our data suggest that this sheet of cells is unaffected in Dullard mutants (Neeb et al., 2013; Morgenthau and Frishman, 2018). Instead, our data provide further evidence for the NCC as one of the OFT cell lineages whose development defects can lead to the formation of hearts with an aorta overriding the interventricular septum (High et al., 2007). Further explorations would be required to assess whether the malformations led by defects in the NCC or the SHF are comparable and whether, in both cases, the molecular and cellular defects lead to more pressure on the endocardium and forces its rupture.

Materials and methods

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional information
Strain, strain background (Mus musculus) C57BL/6JRj Janvier Labs
Genetic reagent (Mus musculus) Wnt1Cre PMID: 9843687 MGI:2386570 Dr A Pierani (Imagine Institute)
Genetic reagent (Mus musculus) Pax3Cre PMID: 15882581 MGI: 3573783 Dr F Relaix (Créteil University)
Genetic reagent (Mus musculus) Rosa26mTmG PMID: 17868096 MGI: 3716464 Dr F Relaix (Créteil University)
Genetic reagent (Mus musculus) DullardFlox PMID: 23360989 other Dr R Nishinakamura (Kumamoto University)
Antibody Anti-GFP (Chicken) Aves Labs GFP-1020
RRID:AB_10000240
IF(1:500)
Antibody anti-PECAM (Rat monoclonal) Santa-Cruz Biotechnology Sc-18916
RRID:AB_627028
IF(1:200)
Antibody Anti-phosphoSmad1/5/8 (Rabbit monoclonal) Cell Signalling Technology 13820S
RRID:AB_2493181
IF (1:500)
Antibody Anti-Myosin Heavy Chain (mouse monoclonal) DSHB MF20
RRID:AB_2147781
IF (1:300)
Antibody Anti-phospho-histone H3 (rabbit polyclonal) Cell Signalling Technology 9701
RRID:AB_331535
IF (1:500)
Antibody Anti-cleaved Caspase 3 (Rabbit monoclonal) Cell Signalling Technology 9664
RRID:AB_2070042
IF (1:500)
Antibody Anti-Isl1 (Rabbit polyclonal) Abcam Ab20670
RRID:AB_881306
IF (1:500)
Antibody AF 488 donkey IgG anti-chicken IGG (H+L) Interchim 703-545-155
RRID:AB_2340375
IF (1:500)
Antibody Alexa Fluor 555 Goat Anti-Rabbit IgG (H+L), highly cross-adsorbed Life Technologies A-21429
RRID:AB_2535850
IF (1:500)
Antibody AF 647 Donkey IgG Anti Rabbit IGG (H+L) Interchim 711-605-152
RRID:AB_2492288
IF (1:500)
Antibody Alexa Fluor 647 Goat Anti-Rat IgG (H+L) Life Technologies A21247
RRID:AB_141778
IF (1:500)
Antibody Alexa Fluor 647 Goat Anti-Mouse IgG (H+L) Antibody, highly cross-adsorbed Life Technologies A-21236
RRID:AB_2535805
IF (1:500)
Antibody Alexa Fluor 488 Goat Anti-Mouse IgG (H+L) Antibody, highly cross-adsorbed Life Technologies A-11029
RRID:AB_2534088
IF (1:500)
Antibody Alexa Fluor 488 Goat Anti-Rabbit IgG (H+L) Antibody Life Technologies A-11008
RRID:AB_143165
IF (1:500)
Antibody Anti-Phospho Smad 2/3 (Rabbit monoclonal) Ozyme 8828 s
RRID:AB_2631089
IF (1:200)
Sequence-based reagent Sema3C PMID: 16397144 other RNA probe from Dr S Zaffran (Aix Marseille University)
Sequence-based reagent Dullard Advanced Cell Diagnostics #456911 RNA probe
Sequence-based reagent Sema3C Advanced Cell Diagnostics #441441 RNA probe
Sequence-based reagent Twist1 Advanced Cell Diagnostics #414701 RNA probe
Sequence-based reagent Snai2 Advanced Cell Diagnostics #451191 RNA probe
Sequence-based reagent Msx2 Advanced Cell Diagnostics #421851 RNA probe
Sequence-based reagent Id2 Advanced Cell Diagnostics #445871 RNA probe
Antibody Anti-Ter119 Pe-Cy7 (Mouse monoclonal) Sony 1181110 Facs (1:300)
Antibody Anti-CD45 APC-Cy7 (Mouse monoclonal) BD Pharmingen 557659
RRID:AB_396774
Facs (1:300)
Antibody Anti-CD31 APC (Mouse monoclonal) BD Pharmingen Clone MEC 13.3 Catalog No. 561814
RRID:AB_10893351
Facs (1:300)
Commercial assay or kit 7AAD PE-Cy7 BD Pharmingen 559925 Facs (1:800)
Commercial assay, kit CellsDirect One-Step qRTPCR Kit Invitrogen 11753100
Commercial assay, kit 48.48 Sample/Loading Kit— 10 IFCs Fluidigm Corporation BMK-M10- 48.48
Cell Line (Mus musculus) C2C12 ATCC, PMID: 28966089 CRL-1772, RRID:CVCL_0188
Peptide, recombinant protein Human BMP-2 Thermo Fisher Scientific #PHC7145 50 ng/ml
Software, algorithm R, pHeatmap (v1.0.10) R foundation R package (v3.2.2), RRID:SCR_016418
Software, algorithm R, phenograph (v0.99.1) R foundation R package (v3.2.2), RRID:SCR_016919
Software, algorithm R, ggplot2 (v3.1.0) R foundation R package (v3.2.2), RRID:SCR_014601
Software, algorithm R, Destiny (v2.6.1) R foundation R package (v3.6) https://github.com/theislab/destiny
Recombinant DNA reagent pEGFP-Dullard (plasmid) This paper GFP-Dullard expression plasmid
Recombinant DNA reagent pEGFP-Dullard D67E (plasmid) This paper GFP-Dullard D67E expression plasmid
Recombinant DNA reagent pEGFP-N1 Clontech 6085–1
Commercial assay or kit Gateway LR Clonase ThermoFisher 11791100
Commercial assay or kit Taq Polymerase, Superscript III Thermofisher 11732020
Sequence-based reagent Dull_FL_C1_FW This paper PCR primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGATGCGGACGCAGTGT
Sequence-based reagent Dull_FL_C1_Rev This paper PCR primers GGGGACCACTTTGTACAAGAAAGTGGGTCTCACCAGAGCCTATGTTGGTG
Sequence-based reagent Dull_D67E_FW This paper PCR primers GATCCTGGTGCTGGAACTGGACGAAACCCTG
Sequence-based reagent Dull_D67E_Rev This paper PCR primers CAGGGTTTCGTCCAGTTCCAGCACCAGGATC

Animals

All animal experiments were approved by the Animal Ethics Committee of Sorbonne University. We used the mouse strains described in the following papers and MGI IDs: Dullardflox/flox (Sakaguchi et al., 2013; in these mice exons 2 to 4 are floxed), Pax3Cre (Engleka et al., 2005, MGI: 3573783), Wnt1Cre (Danielian et al., 1998, MGI:2386570), Rosa26mTmG (Muzumdar et al., 2007, MGI: 3716464), and C57BL/6JRj (Janvier Labs).

Immunohistochemistry and imaging

Mouse embryos were collected at E11.5 and dissected in cold PBS, incubated 5 min in 200 mM KCl to stop heart beating and fixed for 2–3 hr in 4% PFA (Electron Microscopy Science, #15710S) at 4°C.

For immunostaining on cryosections, embryos were cryoprotected in 20% sucrose overnight at 4°C, embedded in OCT, and cryosectioned at 12 µm thickness. Sections were permeabilized 10 min in PBS/0.5% Triton, incubated for 1 hr in blocking buffer (5% goat serum in PBS) and overnight in primary antibody solution (in 1% BSA in PBS). After thorough washing in PBS, they were incubated 1 hr in secondary antibody solution (in 1% BSA in PBS), washed in PBS and mounted in Fluoromount-G (Clinisciences, 0100–01). Immunostainings were acquired using a Nikon Ti2 microscope, driven by Metamorph (Molecular Devices), equipped with a motorized stage and a Yokogawa CSU-W1 spinning disk head coupled with a Prime 95 sCMOS camera (Photometrics), then assembled and analyzed on Fiji (Schindelin et al., 2012).

For wholemount staining, we followed the 3Disco protocol (Belle et al., 2017) to immunostain, clear and image with a lightsheet ultramicroscope (LaVision BioTec). Alternatively, micro-dissected hearts immunostained as described in Belle et al. (2017), were clarified with BABB and imaged using a LSM700 confocal microscope (Carl Zeiss) (Gopalakrishnan et al., 2015). 3D renderings were generated using the Imaris software.

The primary antibodies used were raised against: GFP (chicken, Aves Labs, GFP-1020, 1/500), Pecam (rat monoclonal, Santa-Cruz Biotechnology, sc-18916, 1/200), Phospho-Smad1/5/8 (rabbit monoclonal, Cell Signalling Technology, 13820S, 1/500), myosin heavy chain, MyHC (mouse monoclonal, DSHB, MF20, 1/300), Phospho-Histone H3 (rabbit, Cell Signalling Technology, 9701, 1/500), Cleaved Caspase-3 (rabbit monoclonal, Cell Signalling Technology, Asp175, 1/500), Isl-1 (Abcam, ab20670), Phospho-Smad2,3 (rabbit, Ozyme, 8828 s, 1:200). Secondary antibodies were bought from Life technologies or Interchim and were Donkey or Goat Igg coupled to Alexa fluorophores.

In situ hybridisation

The Sema3c probe was provided by the lab of S. Zaffran (Bajolle et al., 2006). In situ hybridization on cryosections were processed following the protocol described in Chotteau-Lelièvre et al. (2006).Fluorescent in situ hybridization probes for Dullard (#456911), Sema3c (#441441), Twist1 (#414701), Snai2 (#451191), Msx2 (#421851) and Id2 (#445871) were obtained from Advanced Cell Diagnostics, Inc In situ hybridization was performed using the RNAscope V2-fluorescent kit according to the manufacturer's instructions. For sample pre-treatments: H2O2 treatment was performed during 10 min at RT, retrieval 2 min at 98°C and slides were digested with Protease Plus reagent for 15 min at 40°C. After the probe detection steps immunostaining was performed as described above with fluorescent secondary antibodies. Sections were imaged using a 40x objective on a LSM700 microscope (Zeiss) or Nikon Ti2 microscope.

Image analyses, quantification, statistical analysis

Mean levels of P-Smad1/5/8 in the cardiac NCC were quantified using Image J thanks to a mask established on the GFP channel. Distances between cardiac NCC and between cardiac NCC and the endocardium, as well as the angle of the major axis of NCC to an axis linking the Ao and Pa poles of the endocardium were measured using Metamorph (Molecular Devices) and a home-made algorithm on Excel. Statistical analysis was performed with the Student’s t-test or Mann-Whitney test depending on normality. The analysis was performed using Prism Software (GraphPad). Statistical significance is represented as follows: ***p<0.001. All results are shown as mean ± standard deviation.

Plasmids

Dullard was directly cloned from an NIH 3T3 mRNA library using the SuperScript III One‐Step RT‐PCR System (Life Technologies) using primers Dull_FL_C1_FW 5 ´‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGATGCGGACGCAGTGT‐3’ and Dull_FL_C1_Rev 5 ´‐GGGGACCACTTTGTACAAGAAAGTGGGTCTCACCAGAGCCTATGTTGGTG‐3’ for N‐terminal tag destination vectors (pDONR221). For phosphatase‐null point mutant Dullard D67E, site‐directed mutagenesis was performed by PCR amplification of pDONR 221 Dullard full‐length vector using primers Dull_D67E_FW 5 ´‐GATCCTGGTGCTGGAACTGGACGAAACCCTG‐3’ and Dull_D67E_Rev 5 ´‐CAGGGTTTCGTCCAGTTCCAGCACCAGGATC‐3’ followed by DpnI endonuclease mediated digestion of the parent (methylated) DNA chain. After sequence confirmation, entry vectors were recombined with pEGFP GW C1 for N‐terminal (Life Technologies) GFP‐tag fusion proteins using the Gateway system (Thermofisher).

Cell culture and transfection

C2C12 cells were cultivated at 37°C/5% CO2, in growth medium (DMEM, 4.5 g/L, D-glucose, 4 mM L-glutamine, 1 mM sodium pyruvate, 10% fetal calf serum). Plasmid transfection was performed using Lipofectamine 2000 (Life Technologies). 24 hr after transfection, BMP2 recombinant human protein (Thermo Fisher Scientific, #PHC7145) was applied for 1 hr on cells. Cells were fixed with 4% PFA and immunostained with the phospho-Smad1/5/8 antibody. Alternatively, cells were washed in PBS, collected with PBS 1% SDS and passed through Qiashredder columns (Qiagen) to disrupt nucleic acids. Proteins extracts were then processed for western blotting using pre-cast gels (Life Technologies) and transferred on nitrocellulose by semi-dry transfer (Bio-Rad). C2C12 (ATCC CRL-1772) is a murine myogenic cell line. Its myogenic profile is regularly checked by placing them in low serum to trigger the formation of myotubes through cell-cell fusion. Their mycoplasma contamination status resulted negative.

Tissue dissociation and FACS sorting

Mouse embryos were collected at E11.5 and placed in HBSS/1% FBS (HBSS +/+, Invitrogen) during genotyping. OFT were micro-dissected and dissociated by 15 min incubation in collagenase (0.1 mg/ml in HBSS, C2139 Sigma) and thorough pipetting. HBSS (10% FBS) was added to the cells medium to stop the enzymatic reaction. OFT cell suspensions were centrifuged and resuspended in HBSS (1% FBS) before immunostaining. The panel of conjugated antibodies used for FACS included Ter119 Pe-Cy7 (Erythroid Cells, anti-mouse, Sony, Catalog No. 1181110, 1/300), CD45 APC-Cy7 (Rat anti-mouse, BD Pharmingen, Catalog No. 557659, 1/300), CD31 APC (Rat anti-mouse, BD Pharmingen, Clone MEC 13.3 Catalog No. 561814, 1/300) diluted in HBSS (1% FBS). Cells were centrifuged and resuspended in the antibody solution for a 25 min incubation period (4°C, dark), washed three times, filtered (Fisher cell strainer, 70 μm mesh) and 7AAD PE-Cy7 (1/800) was added in the cells suspension to exclude dead cells. Cells were sorted in a BD FACSAria III into 96-well plates loaded with RT-STA reaction mix (CellsDirect One-Step qRTPCR Kit, Invitrogen) and 0.2x specific TaqMan Assay mix (see Supplementary file 1 for assays list).

Single-cell gene expression

We proceeded as described in Valente et al. (2019). Cells were sorted in RT-STA reaction mix from the CellsDirect One-Step qRT-PCR Kit (Life Technologies), reverse transcribed and specific target pre-amplified (20 cycles), according to the manufacturer’s procedures. Pre-amplified samples were diluted 5x with low EDTA TE buffer prior to qPCR analysis using 48.48 Dynamic Array IFCs and the BioMark TM HD System (Fluidigm). The same TaqMan gene expression assays (20x, Life Technologies) were individually diluted 1:1 with 2x assay loading reagent (Fluidigm). Pre-amplified samples were combined with TaqMan Universal Master Mix (Life Technologies) and 20x GE sample loading reagent (Fluidigm). Loading of the 48.48 Dynamic Array TM IFCs and qPCR cycling conditions followed the Fluidigm procedure for TaqMan gene expression assays.

Bioinformatic analysis

The analytic framework used followed the one described in Perchet et al. (2018); Valente et al. (2019). It included notably a normalization of all the cycle threshold (Ct) values extracted from the Biomark chips using the mean value of Actb and Gapdh housekeeping genes (Figure 4B). For visualisation of the single-cell multiplex qPCR, done on 44 genes, we generated a heatmap using the pHeatmap (v1.0.10) R package (v3.2.2). For unsupervised clustering, we used PhenoGraph that takes as input a matrix of N single-cell measurements and partitions them into subpopulations by clustering a graph that represents their phenotypic similarity. PhenoGraph builds this graph in two steps. Firstly, it finds the k nearest neighbors for each cell (using Euclidean distance), resulting in N sets of k-neighborhoods. Secondly, it operates on these sets to build a weighted graph such that the weight between nodes scales with the number of neighbors they share. The Louvain community detection method is then used to find a partition of the graph that maximizes modularity. Given a dataset of N d-dimensional vectors, M distinct classes, and a vector providing the class labels for the first L samples, the PhenoGraph classifier assigns labels to the remaining N_L unlabeled vectors. Firstly, a graph is constructed as described above. The classification problem then corresponds to the probability that a random walk originating at unlabeled node x will first reach a labeled node from each of the M classes. This defines an M-dimensional probability distribution for each node x that records its affinity for each class. PhenoGraph is implemented as Rphenograph (v0.99.1) R package (v3.2.3).

We used boxplot for gene expressions of clusters obtained with PhenoGraph algorithm, from package ggplot2 (v3.1.0) R package (v3.2.2). For visualisation and pathway analyses (tree), Destiny (v2.6.1) on R package (v3.6) generates the diffusion maps. Destiny calculates cell-to-cell transition probabilities based on a Gaussian kernel with a width σ to create a sparse transition probability matrix M. For σ, Destiny employs an estimation heuristic to derive this parameter. Destiny allows for the visualization of hundreds of thousands of cells by only using distances to the k nearest neighbors of each cell for the estimation of M. An eigen decomposition is performed on M after density normalisation, considering only transition probabilities between different cells. The resulting data-structure contains the eigenvectors with decreasing eigenvalues as numbered diffusion components (DC), the input parameters and a reference to the data. These DC are pseudotimes identifying differentiation dynamics from our sc-qPCR data.

Impact of gene expressions creating the different dimensions is represented as horizontal box plots, showing cells up- or down-regulating indicated genes in the plot.

Ultrasound imaging

Pregnant mice were anaesthetised (3% isoflurane in air and maintained at 1.5%), installed on a heating pad and monitored for respiration frequency, ECG and temperature (Vevo Imaging Station, Visualsonics). Pregnant mice were intraperitoneally injected with Metacam (1mg/kg body weight; Boehringer Ingelheim). A laparotomy was then performed and the uterine horns were gently exteriorized to allow direct visualisation of embryos using a high-resolution ultrasound imaging scanner (VEVO2100, Visualsonics) equipped with a 60 MHz probe (MS-700). To ensure contact between the ultrasound probe and the embryos, a warm sterile gel (Aquasonic) was used. Long axis view of the heart was performed on each embryo to measure left and right ventricle dimensions. PW Doppler measurements were achieved positioning the caliper on the descending abdominal aorta with embryo in sagittal view. From Abdominal Aorta the following measurements were performed: Abdominal Aorta Peak Systolic Velocity (AA PSV, mm/s), End Diastolic Velocity (AA EDV, mm/s), Velocity Time Integral of mean velocities (AA VTI, ms). From these measurements, the following parameters were calculated: Mean Velocity (AA VTI Mean Vel), Abdominal Aorta Pulsatility Index (AA PI), Abdominal Aorta Resistive Index (AA RI).

Acknowledgements

We thank the Cadot, Bitoun and Ribes Laboratories for discussions, Sigolène Meilhac for her help on understanding heart development concepts, Edgar Gomes laboratories, Isabelle Le Roux and Pascale Gilardi-Hebenstreit for useful comments, Stéphane Zaffran for the Sema3c ISH probe and Morgane Belle for Lightsheet microscopy. The Pax3Cre and Rosa26mTmG transgenic lines were kindly provided by F Relaix, and the Wnt1Cre line by A Pierani. This work was supported by Agence Nationale pour la Recherche (ANR-14-CE09-0006-04) to BC; Association Institut de Myologie to BC. VR is an INSERM researcher, and work in her lab is supported by CNRS/INSERM ATIP-AVENIR program, as well as by a Ligue Nationale Contre le Cancer grant (PREAC2016.LCC). MV has a postdoctoral fellowship from the Laboratoire d'Excellence Revive (Investissement d'Avenir; ANR-10-LABX-73). In vivo imaging was performed at the Life Imaging Facility of Paris Descartes University (Plateforme Imageries du Vivant – PIV) and is supported by France Life Imaging (grant ANR-11-INBS-0006).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Vanessa Ribes, Email: vanessa.ribes@ijm.fr.

Bruno Cadot, Email: cadotbruno@gmail.com.

Richard P Harvey, Victor Chang Cardiac Research Institute, Australia.

Marianne E Bronner, California Institute of Technology, United States.

Funding Information

This paper was supported by the following grants:

  • Agence Nationale de la Recherche ANR-14-CE09-0006-04 to Bruno Cadot.

  • Ligue Contre le Cancer PREAC2016.LCC to Vanessa Ribes.

  • Agence Nationale de la Recherche ANR-10-LABX-73 to Mariana Valente.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology.

Data curation, Investigation, Visualization, Methodology.

Data curation, Formal analysis, Validation, Investigation, Visualization.

Investigation.

Formal analysis, Validation, Investigation.

Resources.

Resources.

Investigation.

Investigation.

Conceptualization, Data curation, Supervision, Validation, Investigation, Visualization, Methodology, Project administration.

Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Project administration.

Ethics

Animal experimentation: All animal experiments (APAFIS#4163-2016042809186990) were approved by the Animal Ethics Committee of Sorbonne University (Permit Number: A751320).

Additional files

Supplementary file 1. List of TaqMan gene expression assays (20x, Life Technologies) used for single-cell qPCRs experiments.
elife-50325-supp1.xlsx (12KB, xlsx)
Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

  1. Acharya A, Baek ST, Banfi S, Eskiocak B, Tallquist MD. Efficient inducible Cre-mediated recombination in Tcf21 cell lineages in the heart and kidney. Genesis. 2011;49:870–877. doi: 10.1002/dvg.20750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bajolle F, Zaffran S, Kelly RG, Hadchouel J, Bonnet D, Brown NA, Buckingham ME. Rotation of the myocardial wall of the outflow tract is implicated in the normal positioning of the great arteries. Circulation Research. 2006;98:421–428. doi: 10.1161/01.RES.0000202800.85341.6e. [DOI] [PubMed] [Google Scholar]
  3. Belle M, Godefroy D, Couly G, Malone SA, Collier F, Giacobini P, Chédotal A. Tridimensional visualization and analysis of early human development. Cell. 2017;169:161–173. doi: 10.1016/j.cell.2017.03.008. [DOI] [PubMed] [Google Scholar]
  4. Bier E, De Robertis EM. EMBRYO DEVELOPMENT. BMP gradients: a paradigm for morphogen-mediated developmental patterning. Science. 2015;348:aaa5838. doi: 10.1126/science.aaa5838. [DOI] [PubMed] [Google Scholar]
  5. Bockman DE, Redmond ME, Waldo K, Davis H, Kirby ML. Effect of neural crest ablation on development of the heart and arch arteries in the chick. American Journal of Anatomy. 1987;180:332–341. doi: 10.1002/aja.1001800403. [DOI] [PubMed] [Google Scholar]
  6. Brade T, Männer J, Kühl M. The role of wnt signalling in cardiac development and tissue remodelling in the mature heart. Cardiovascular Research. 2006;72:198–209. doi: 10.1016/j.cardiores.2006.06.025. [DOI] [PubMed] [Google Scholar]
  7. Brickner ME, Hillis LD, Lange RA. Congenital heart disease in adults. New England Journal of Medicine. 2000;342:256–263. doi: 10.1056/NEJM200001273420407. [DOI] [PubMed] [Google Scholar]
  8. Brown CB, Feiner L, Lu MM, Li J, Ma X, Webber AL, Jia L, Raper JA, Epstein JA. PlexinA2 and semaphorin signaling during cardiac neural crest development. Development. 2001;128:3071–3080. doi: 10.1242/dev.128.16.3071. [DOI] [PubMed] [Google Scholar]
  9. Bruce DL, Sapkota GP. Phosphatases in SMAD regulation. FEBS Letters. 2012;586:1897–1905. doi: 10.1016/j.febslet.2012.02.001. [DOI] [PubMed] [Google Scholar]
  10. Choi M, Stottmann RW, Yang YP, Meyers EN, Klingensmith J. The bone morphogenetic protein antagonist noggin regulates mammalian cardiac morphogenesis. Circulation Research. 2007;100:220–228. doi: 10.1161/01.RES.0000257780.60484.6a. [DOI] [PubMed] [Google Scholar]
  11. Chotteau-Lelièvre A, Dollé P, Gofflot F. Expression analysis of murine genes using in situ hybridization with radioactive and nonradioactively labeled RNA probes. Methods Mol Biol. . 2006;326:61–87. doi: 10.1385/1-59745-007-3:61. [DOI] [PubMed] [Google Scholar]
  12. Danesh SM, Villasenor A, Chong D, Soukup C, Cleaver O. BMP and BMP receptor expression during murine organogenesis. Gene Expression Patterns. 2009;9:255–265. doi: 10.1016/j.gep.2009.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP. Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of cre recombinase. Current Biology. 1998;8:1323–1326. doi: 10.1016/S0960-9822(07)00562-3. [DOI] [PubMed] [Google Scholar]
  14. Delloye-Bourgeois C, Bertin L, Thoinet K, Jarrosson L, Kindbeiter K, Buffet T, Tauszig-Delamasure S, Bozon M, Marabelle A, Combaret V, Bergeron C, Derrington E, Castellani V. Microenvironment-Driven shift of cohesion/Detachment balance within tumors induces a switch toward metastasis in neuroblastoma. Cancer Cell. 2017;32:427–443. doi: 10.1016/j.ccell.2017.09.006. [DOI] [PubMed] [Google Scholar]
  15. Engleka KA, Gitler AD, Zhang M, Zhou DD, High FA, Epstein JA. Insertion of cre into the Pax3 locus creates a new allele of splotch and identifies unexpected Pax3 derivatives. Developmental Biology. 2005;280:396–406. doi: 10.1016/j.ydbio.2005.02.002. [DOI] [PubMed] [Google Scholar]
  16. Feiner L, Webber AL, Brown CB, Lu MM, Jia L, Feinstein P, Mombaerts P, Epstein JA, Raper JA. Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development. 2001;128:3061–3070. doi: 10.1242/dev.128.16.3061. [DOI] [PubMed] [Google Scholar]
  17. Galvin KM, Donovan MJ, Lynch CA, Meyer RI, Paul RJ, Lorenz JN, Fairchild-Huntress V, Dixon KL, Dunmore JH, Gimbrone MA, Falb D, Huszar D. A role for Smad6 in development and homeostasis of the cardiovascular system. Nature Genetics. 2000;24:171–174. doi: 10.1038/72835. [DOI] [PubMed] [Google Scholar]
  18. Gopalakrishnan S, Comai G, Sambasivan R, Francou A, Kelly RG, Tajbakhsh S. A cranial mesoderm origin for esophagus striated muscles. Developmental Cell. 2015;34:694–704. doi: 10.1016/j.devcel.2015.07.003. [DOI] [PubMed] [Google Scholar]
  19. Hayata T, Ezura Y, Yoichi E, Asashima M, Nishinakamura R, Noda M. Dullard/Ctdnep1 regulates endochondral ossification via suppression of TGF-β signaling. Journal of Bone and Mineral Research. 2015;30:318–329. doi: 10.1002/jbmr.2343. [DOI] [PubMed] [Google Scholar]
  20. High FA, Zhang M, Proweller A, Tu L, Parmacek MS, Pear WS, Epstein JA. An essential role for notch in neural crest during cardiovascular development and smooth muscle differentiation. Journal of Clinical Investigation. 2007;117:353–363. doi: 10.1172/JCI30070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Huang J, Cheng L, Li J, Chen M, Zhou D, Lu MM, Proweller A, Epstein JA, Parmacek MS. Myocardin regulates expression of contractile genes in smooth muscle cells and is required for closure of the ductus arteriosus in mice. Journal of Clinical Investigation. 2008;118:515–525. doi: 10.1172/JCI33304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jia Q, McDill BW, Li SZ, Deng C, Chang CP, Chen F. Smad signaling in the neural crest regulates cardiac outflow tract remodeling through cell autonomous and non-cell autonomous effects. Developmental Biology. 2007;311:172–184. doi: 10.1016/j.ydbio.2007.08.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian cardiac neural crest. Development. 2000;127:1607–1616. doi: 10.1242/dev.127.8.1607. [DOI] [PubMed] [Google Scholar]
  24. Jiao K, Kulessa H, Tompkins K, Zhou Y, Batts L, Baldwin HS, Hogan BL. An essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes & Development. 2003;17:2362–2367. doi: 10.1101/gad.1124803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jones CM, Lyons KM, Hogan BL. Involvement of bone morphogenetic Protein-4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in the mouse. Development. 1991;111:531–542. doi: 10.1242/dev.111.2.531. [DOI] [PubMed] [Google Scholar]
  26. Kelly RG. The second heart field. Current Topics in Developmental Biology. 2012;100:33–65. doi: 10.1016/B978-0-12-387786-4.00002-6. [DOI] [PubMed] [Google Scholar]
  27. Keyte A, Hutson MR. The neural crest in cardiac congenital anomalies. Differentiation. 2012;84:25–40. doi: 10.1016/j.diff.2012.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim HY, Jackson TR, Davidson LA. On the role of mechanics in driving mesenchymal-to-epithelial transitions. Seminars in Cell & Developmental Biology. 2017;67:113–122. doi: 10.1016/j.semcdb.2016.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kodo K, Shibata S, Miyagawa-Tomita S, Ong SG, Takahashi H, Kume T, Okano H, Matsuoka R, Yamagishi H. Regulation of Sema3c and the interaction between cardiac neural crest and second heart field during outflow tract development. Scientific Reports. 2017;7:6771. doi: 10.1038/s41598-017-06964-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lepore JJ, Mericko PA, Cheng L, Lu MM, Morrisey EE, Parmacek MS. GATA-6 regulates semaphorin 3C and is required in cardiac neural crest for cardiovascular morphogenesis. Journal of Clinical Investigation. 2006;116:929–939. doi: 10.1172/JCI27363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Liu W, Selever J, Wang D, Lu MF, Moses KA, Schwartz RJ, Martin JF. Bmp4 signaling is required for outflow-tract septation and branchial-arch artery remodeling. PNAS. 2004;101:4489–4494. doi: 10.1073/pnas.0308466101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Luo Y, High FA, Epstein JA, Radice GL. N-cadherin is required for neural crest remodeling of the cardiac outflow tract. Developmental Biology. 2006;299:517–528. doi: 10.1016/j.ydbio.2006.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. McCulley DJ, Kang JO, Martin JF, Black BL. BMP4 is required in the anterior heart field and its derivatives for endocardial cushion remodeling, outflow tract septation, and semilunar valve development. Developmental Dynamics. 2008;237:3200–3209. doi: 10.1002/dvdy.21743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mifflin JJ, Dupuis LE, Alcala NE, Russell LG, Kern CB. Intercalated cushion cells within the cardiac outflow tract are derived from the myocardial troponin T type 2 (Tnnt2) Cre lineage. Developmental Dynamics. 2018;247:1005–1017. doi: 10.1002/dvdy.24641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Miyazono K, Maeda S, Imamura T. BMP receptor signaling: transcriptional targets, regulation of signals, and signaling cross-talk. Cytokine & Growth Factor Reviews. 2005;16:251–263. doi: 10.1016/j.cytogfr.2005.01.009. [DOI] [PubMed] [Google Scholar]
  36. Morgenthau A, Frishman WH. Genetic origins of tetralogy of fallot. Cardiology in Review. 2018;26:86–92. doi: 10.1097/CRD.0000000000000170. [DOI] [PubMed] [Google Scholar]
  37. Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L. A global double-fluorescent cre reporter mouse. Genesis. 2007;45:593–605. doi: 10.1002/dvg.20335. [DOI] [PubMed] [Google Scholar]
  38. Neeb Z, Lajiness JD, Bolanis E, Conway SJ. Cardiac outflow tract anomalies. Wiley Interdisciplinary Reviews: Developmental Biology. 2013;2:499–530. doi: 10.1002/wdev.98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Nomura-Kitabayashi A, Phoon CK, Kishigami S, Rosenthal J, Yamauchi Y, Abe K, Yamamura K, Samtani R, Lo CW, Mishina Y. Outflow tract cushions perform a critical valve-like function in the early embryonic heart requiring BMPRIA-mediated signaling in cardiac neural crest. American Journal of Physiology-Heart and Circulatory Physiology. 2009;297:H1617–H1628. doi: 10.1152/ajpheart.00304.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Norris RA, Moreno-Rodriguez RA, Sugi Y, Hoffman S, Amos J, Hart MM, Potts JD, Goodwin RL, Markwald RR. Periostin regulates atrioventricular valve maturation. Developmental Biology. 2008;316:200–213. doi: 10.1016/j.ydbio.2008.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Odelin G, Faure E, Coulpier F, Di Bonito M, Bajolle F, Studer M, Avierinos J-F, Charnay P, Topilko P, Zaffran S. Krox20 defines a subpopulation of cardiac neural crest cells contributing to arterial valves and bicuspid aortic valve. Development. 2018;145:dev151944. doi: 10.1242/dev.151944. [DOI] [PubMed] [Google Scholar]
  42. Perchet T, Petit M, Banchi EG, Meunier S, Cumano A, Golub R. The notch signaling pathway is balancing type 1 innate lymphoid cell immune functions. Frontiers in Immunology. 2018;9:1252. doi: 10.3389/fimmu.2018.01252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Phillips HM, Mahendran P, Singh E, Anderson RH, Chaudhry B, Henderson DJ. Neural crest cells are required for correct positioning of the developing outflow cushions and pattern the arterial valve leaflets. Cardiovascular Research. 2013;99:452–460. doi: 10.1093/cvr/cvt132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Plein A, Fantin A, Ruhrberg C. Current Topics in Developmental Biology. Trainor PA: Academic Press; 2015. Chapter Six - Neural Crest Cells in CardiovascularDevelopment; pp. 183–200. [DOI] [PubMed] [Google Scholar]
  45. Sakaguchi M, Sharmin S, Taguchi A, Ohmori T, Fujimura S, Abe T, Kiyonari H, Komatsu Y, Mishina Y, Asashima M, Araki E, Nishinakamura R. The phosphatase dullard negatively regulates BMP signalling and is essential for nephron maintenance after birth. Nature Communications. 2013;4:1398. doi: 10.1038/ncomms2408. [DOI] [PubMed] [Google Scholar]
  46. Sardi J, Bener MB, Simao T, Descoteaux AE, Slepchenko BM, Inaba M. Mad dephosphorylation at the nuclear envelope is essential for asymmetric stem cell division. bioRxiv. 2019 doi: 10.1101/798116. [DOI] [PMC free article] [PubMed]
  47. Satow R, Kurisaki A, Chan TC, Hamazaki TS, Asashima M. Dullard promotes degradation and dephosphorylation of BMP receptors and is required for neural induction. Developmental Cell. 2006;11:763–774. doi: 10.1016/j.devcel.2006.10.001. [DOI] [PubMed] [Google Scholar]
  48. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nature Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Stottmann RW, Choi M, Mishina Y, Meyers EN, Klingensmith J. BMP receptor IA is required in mammalian neural crest cells for development of the cardiac outflow tract and ventricular myocardium. Development. 2004;131:2205–2218. doi: 10.1242/dev.01086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tamagnone L. Emerging role of semaphorins as major regulatory signals and potential therapeutic targets in cancer. Cancer Cell. 2012;22:145–152. doi: 10.1016/j.ccr.2012.06.031. [DOI] [PubMed] [Google Scholar]
  51. Tanaka SS, Nakane A, Yamaguchi YL, Terabayashi T, Abe T, Nakao K, Asashima M, Steiner KA, Tam PP, Nishinakamura R. Dullard/Ctdnep1 modulates WNT signalling activity for the formation of primordial germ cells in the mouse embryo. PLOS ONE. 2013;8:e57428. doi: 10.1371/journal.pone.0057428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Tang S, Snider P, Firulli AB, Conway SJ. Trigenic neural crest-restricted Smad7 over-expression results in congenital craniofacial and cardiovascular defects. Developmental Biology. 2010;344:233–247. doi: 10.1016/j.ydbio.2010.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Toyofuku T, Yoshida J, Sugimoto T, Yamamoto M, Makino N, Takamatsu H, Takegahara N, Suto F, Hori M, Fujisawa H, Kumanogoh A, Kikutani H. Repulsive and attractive semaphorins cooperate to direct the navigation of cardiac neural crest cells. Developmental Biology. 2008;321:251–262. doi: 10.1016/j.ydbio.2008.06.028. [DOI] [PubMed] [Google Scholar]
  54. Urrutia H, Aleman A, Eivers E. Drosophila dullard functions as a mad phosphatase to terminate BMP signaling. Scientific Reports. 2016;6:32269. doi: 10.1038/srep32269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Valente M, Resende TP, Nascimento DS, Burlen-Defranoux O, Soares-da-Silva F, Dupont B, Cumano A, Pinto-do-Ó P. Mouse HSA+ immature cardiomyocytes persist in the adult heart and expand after ischemic injury. PLOS Biology. 2019;17:e3000335. doi: 10.1371/journal.pbio.3000335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Waldo K, Miyagawa-Tomita S, Kumiski D, Kirby ML. Cardiac neural crest cells provide new insight into septation of the cardiac outflow tract: aortic sac to ventricular septal closure. Developmental Biology. 1998;196:129–144. doi: 10.1006/dbio.1998.8860. [DOI] [PubMed] [Google Scholar]
  57. Wu X, Northcott PA, Croul S, Taylor MD. Mouse models of medulloblastoma. Chinese Journal of Cancer. 2011;30:442–449. doi: 10.5732/cjc.011.10040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhang J, Chang JY, Huang Y, Lin X, Luo Y, Schwartz RJ, Martin JF, Wang F. The FGF-BMP signaling axis regulates outflow tract valve primordium formation by promoting cushion neural crest cell differentiation. Circulation Research. 2010;107:1209–1219. doi: 10.1161/CIRCRESAHA.110.225318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhou Z, Wang J, Guo C, Chang W, Zhuang J, Zhu P, Li X. Temporally distinct Six2-Positive second heart field progenitors regulate mammalian heart development and disease. Cell Reports. 2017;18:1019–1032. doi: 10.1016/j.celrep.2017.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Richard P Harvey1

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This paper, now much improved after key revisions, provides a compelling picture of the role of the phosphatase Dullard, a BMP signaling inhibitor, in patterning of the cardiac outflow tract, and specifically the contribution from cardiac neural crest cells. BMP signaling is established in a distal-high gradient along the outflow tract, and it is the magnitude of the gradient, not the gradient itself, that is moderated by Dullard. In the absence of Dullard, there is premature condensation of the cardiac neural crest in the outflow tract and breakdown of the endocardium, forcing a premature scission of the outflow into its two major arterial trunks, and in addition the pulmonary artery becomes constricted. The phenotype in rare surviving Dullard mutants closely resembles the tetralogy of Fallot, suggesting relevance to understanding of this severe congenital heart disease. The reviewers appreciated the clever use of single cell transcriptomics, which has helped to show which outflow cell types are affected and suggest the spatial elements of this dysfunction. The outflow tract is an important structure in heart development and evolution, and its complex makeup presents certain vulnerabilities during fetal life. This is an excellent study on how Dullard constrains BMP signaling to allow the correct extent and timing of tissue patterning in the outflow tract.

Decision letter after peer review:

Thank you for sending your article entitled "Transcriptional control of cardiac neural crest cells condensation and OFT septation by the Smad1,5,8 inhibitor Dullard" for peer review at eLife. Your article is being evaluated by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation is being overseen by Marianne Bronner as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

The paper by Darrigrand et al. describes an analysis of mice mutant for the phosphatase gene Dullard in cardiac neural crest using both Wnt1 and Pax3-driven (non-inducible) Cre drivers. The authors study morphology and gene/protein expression on sections with quantifications and study a 44-gene single cell transcriptome with clustering of cell types/states to explore changes in mutant populations. The authors describe a distal-proximal gradient of pSmad1/5/8 staining across the OFT and reduction in the level of staining but not the gradient, in Dullard conditional mutants. The most obvious morphological phenotype is a premature "rupture" of the endocardium and fusion of the endocardial cushions at distal and medical locations, in the absence of changes in NCC numbers or overall pattern or distribution. Morphological parameters of this phenotype, including cell proximity and orientation are described. Clustering analysis defines a number of GFP+ population states in wild type and mutant OFT, with skewing towards either wild type or mutant genotypes within predominantly two of these. Subsequent analysis identified up-regulation of SemaC3 in NCCs as a possible driver of the premature rupture phenotype. The analysis of OFT defect has significant relevance to congenital defects of the OFT and great vessels, which are common. The work is interesting and relevant to understanding of heart development and disease, and the quantitative and single cell approaches are a strength. However, the reviewers have identified a number of important issues that need to be addressed before this work is ready for publication, as well as many other points for clarification. Major issues concern 1) the lack of detail on the temporal development and symmetry/asymmetry of NCC deployment into the OFT and how the phenotype evolves morphologically and in the context of related events such as EndMT; 2) the specificity of the phenotype with respect to BMP signaling; and 3) the possible role of Sema3C and other differentially-expressed genes in the development of the phenotype.

Essential revisions:

1) While Dullard is an established negative regulator of BMP/Smad1,5,8 activity, it is also a negative regulator of Tgfβ Smad2,3 phosphorylation and stability (Hayata et al., 2015). The current paper addresses the gradient in BMP/Smad1,5,8 activity in the OFT and establishes correlations with altered BMP activity and morphology but ignores the possibility that Tgfβ signalling or indeed other signaling pathways that may utilise this phosphatase may be involved. Experiments that address this: e.g. rescue of the phenotype with genetic or pharmacological dampening of BMP signalling will significantly strengthen the paper.

2) The model relies on gradients of BMP signalling activity across the OFT (high distal; low proximal). Figure 1E and Supplmentary Figure 1B show significant differences between control and Dullard mutants but not with respect to the proximal distal axis. Thus, this gradient cannot be claimed unless further work allows statistical significance to be established. Stats are also not shown for the distal-proximal change in OFT area in Supplementary Figure 2D.

3) Figure 2A left panels shows Wnt1Cre reporter expression in Pecam1+ OFT endothelial cells. How does this affect the results of the study, particularly the single cell gene expression analysis e.g. EMT markers? Does Sema3c expression in the OFT wall change in conditional mutant embryos? It appears to be reduced in the Pax3Cre conditional Dullard mutant (Figure 6—figure supplement 1). The authors show that Dullard, like Sema3c, is also expressed in OFT myocardium. Can the authors add any conditional data addressing Dullard function in the OFT wall?

4) Subsection “Dullard is a key modulator of cardiac NCC mediated OFT septation” and Figure 2A. The authors claim that the distal and medial rupture of the OFT endocardium and imposition of condensed NCCs in Dullard mutants is somehow asymmetric, restricting the pulmonary artery lumen. The description is vague, and the claim is not convincing as in the controls also the Pa is considerably smaller than the aorta. The relevance of the comments about the PV-IC are not clear in this light and may not be justified expect that morphogenesis in mutants is abnormal. Overall, the study lacks a detailed temporal description of the development of NSC deployment and of the phenotype. Not having data at earlier stages of development (e.g. E9.5 and E10.5) leaves us guessing whether the observed phenotype (morphological, cellular, transcriptional) is the consequence of earlier problems during the ontogeny of NCCs. Not having later, fetal stages (e.g. E18.5) leaves us wondering what the morphogenetic consequences of dullard deletion are on the developed heart. For example, it would be important to establish whether the mutation leads to specific heart defects seen in congenital heart disease patients. The authors should provide information on the intercalated cushions. Do they form normally? Also, are there different behaviors in neural crest derived cells between the two main OFT cushions (this seems to be the case in the mutant cushions in Figure 2Avi'). Can the authors further investigate this with analysis of additional markers of OFT development such as Pitx2? The authors should discuss whether enriched Sema3c in the subpulmonary but not subaortic wall could be involved in asymmetric septation on upregulation of Sema3c in crest subsequent to Dullard loss. Finally, the significance of this asymmetric defect for congenital heart defects such as pulmonary trunk atresia and tetralogy of Fallot should be discussed.

5) Subsection “Dullard is a key modulator of cardiac NCC mediated OFT septation”. The mutant NCC more convincingly condenses prematurely in the medical region of the OFT. How does this relate to the model?

6) The OFT contains the junction between SHF-derived myocardium and NCC-derived smooth muscle cells. This point is ignored in this study and may have significance. It is noteworthy the Sema3c is expressed mostly in the presumed myocardium shown in medial and proximal sections (Figure 3F; Figure 6—figure supplement 1A) compared to distal sections (perhaps containing more NCC-derived SMCs). The authors mention other (myogenic) aspects of the Pax3 conditional mutant phenotype – it seems relevant to expand on this as Sema3c appears also be upregulated. Do changes in Sema3C lead to defects in cell behavior?

7) Subsection “Dullard cell-autonomously controls cardiac NCC mesenchymal transcriptional state”. It can be presumed that Dullard works cell-autonomously, although the last sentence suggests that this was confirmed by the transcriptome data. How?

8) The attempts at spatial reconstruction of cell populations based on transcriptome data is admirable, although the story around Sema3c is simplistic and incomplete. Sema3c is regarded as a guidance See for example Kodo et al., 2017, and Plein et al., JCI 2015 for descriptions of interactions between NCC and SHF cells, and NCC and OFT endothelial cells, respectively. The role of EndMT and how it is affected in mutants is not addressed in this paper. The endothelial-proximal expression of Twist and Snail may relate to EndMT not condensation of NCC. The paper would be strengthened if this general aspect could be strengthened.

9) The single cell RT-PCR analysis is an informative approach that gives clear molecular insights into both the heterogeneity of OFT cell types and Dullard function. However, the analysis could be more complete. In particular the authors should provide more information on the different subpopulations of cells they define, including details of cell numbers for each subgroup. Group 3 appears to contain both RFP and GFP positive cells and expresses many genes expressed in mesodermal cardiac progenitor cells. This should be resolved further: is the grouping meaningful if it contains both GFP and RFP+ cells? Also, is Tbx1, for example, expressed in cardiac neural crest cells? Can the authors show this by immunofluorescence or other means? What fraction of all cardiac neural crest cells are positive for these mesodermal progenitor genes? When the authors refer to the muscle lineage in paragraph three of subsection “Dullard cell-autonomously controls cardiac NCC mesenchymal transcriptional state” presumably they mean smooth muscle, this should be specified.

10) Can the authors use their single cell data to identify any presumably indirect changes in endocardial gene expression that may mediate the endocardial rupture/fusion defect? Are the changes in Cdh5 expression in the crest lineage?

11) The authors should discuss whether the ingression of crest cells into the OFT may itself play a role in generating the BMP signaling gradient.

eLife. 2020 Feb 27;9:e50325. doi: 10.7554/eLife.50325.sa2

Author response


We thank the reviewers for their thoughtful and constructive comments. We have divided our response into three sections, the points highlighted by the reviewers and the editorial board. The answers to the specific points have been incorporated in these three points. We provide several new supplementary figures and the text has been modified accordingly.

A) Response to the general comments:

Point 1. The lack of detail on the temporal development and symmetry/asymmetry of NCC deployment into the OFT and how the phenotype evolves morphologically and in the context of related events such as EndMT.

Point 1.1 A phenotypic characterization of Dullard mutant hearts anchored in a larger developmental window.

We now provide substantial phenotypic analysis of Dullard mutants throughout a larger time window than presented in the previous version of the manuscript, which bring insights into the role and time of action of the phosphatase during heart morphogenesis (Figure 2C-F—figure supplement 2).

First, labelling the cardiac NCC, the myocardium and/or the endocardium of E10.5 embryos indicates that the morphology of the OFT is not impacted at this stage by the loss of Dullard in the NCC compartment (Figure 2—figure supplement 1A). Hence, the premature NCC condensation in Dullard mutant OFT is likely established after E10.5.

Second, we now show that Dullard deletion using either the Wnt1cre or the Pax3credrastically compromises the survival of embryos after E12.5 onwards (Figure 2C). Histological characterization of the rare embryos that can survive up to E14.5 or E18.5 revealed that their heart exhibits i) an opened interventricular septum, ii) a hypertrophy of the right ventricle, iii) an aorta overriding the two ventricles and finally a pulmonary stenosis (Figure 2D, E). Hence, as proposed by one of the reviewers, the phenotype of the heart developed in the presence of cardiac NCC missing Dullard is highly reminiscent to the heart of patients affected by the most cyanotic congenital heart disease, named tetralogy of Fallot (TOF) (Neeb et al., 2013). We now discuss how our work brings insight into the etiology of this condition, which is still poorly understood (cf. Snider and Conway, 2011).

Finally, we imaged the blood flow within the abdominal artery of E11.75 control and Dullard mutant embryos using doppler ultrasound (Figure 2F) (Nomura-Kitabayashi et al., 2009). It indicates that the flow is generally weaker in Dullard mutants compared to controls, as indicated by a lower systolic velocity peak in mutants than control. Hence the OFT defects triggered by the loss of the phosphatase in the NCC worsen the blood circulation of embryos and could in turn impair the survival rate of embryos.

Point 1.2 A better characterization of the effect of Dullard loss on the OFT cell types communicating with the NCC (experimental procedures detailed here will also address the questions raised in point 3).

We provide in our revised manuscript a better description of the differentiation and morphogenesis of the non-NCC derived OFT tissues. Overall these analyses sustain the idea that the NCC derived cardiac cushion is the tissue mostly affected by the loss of Dullard. No identity defect in the specification of the myocardium was found. Similarly, we had barely found any changes in the endocardium of Dullard mutants compared to controls. To illustrate this, we have:

– Performed bioinformatics analyses of our 44 gene base-transcriptomes centred on the RFP+;CD31+ endocardial cells and to the RFP+;CD31- OFT cells following the pipeline used to describe GFP+ NCC transcriptomes (Figure 5A, Figure 5—figure supplement 1). As established for the GFP+ NCC, the endocardium cells and the RFP+;CD31- OFT cells display transcriptomic variations and can be segregated into distinct populations (Figure 5Ai, ii). However, in contrast to the NCC cells, most of these populations all contain both control and mutant cells, with the exception of two populations of endocardial cells (Figure 5Ai’, ii’). The RFP+;CD31+ pop 1 is enriched for cells coming from control embryos, while the RFP+;CD31+ pop 6 contains more mutant cells than control cells. Again, in contrast to NCC case, very few of the genes that drive the segregation of the CD31+ cells into 6 populations display clear variations in the pop 6 or the pop 1 compared to the other pops (Figure 5—figure supplement 1B, C). Twist1 stands as one of the pop1 signature genes and appears downregulated in the absence of Dullard. Accordingly, immune detection of this transcription factor revealed few positive Twist1+ endocardial cells in E11.5 control embryos, which were barely detectable I n mutant endocardium (Figure 6B).

– Brought further evidence that the Wnt1Creand Pax3Cre drivers activity are not detectable in the endocardium to the reviewers. The yellow staining detected on the sections stained for GFP and PECAM correspond to overlapping membranes at sites of cell-cell interaction captured with a large pinhole confocal acquisition. FACS plots further showed a clear segregation between the GFP+ and the CD31+ cells (Author response image 1). Finally, within the NCC transcriptomes, we did not detect a cohort of genes which define endocardial cells (e.g. Figure 5—figure supplement 2). We have not included the data of the Author response images in the current version of the manuscript, as many papers have already extensively described the activity of these Cre drivers in the developing heart (Brown et al., 2001; Jiang et al., 2000).

Author response image 1. FACS plot showing that CD31+ cells are segregating from GFP+ NCC cells and the gating (coloured squares) used to collect cells for the q-RT-PCR screening.

Author response image 1.

– Performed several immunostaining or ISH for key markers of the myocardium, showing in agreement with transcriptomic data that the differentiation tissue and its pattern along thee bis not majorly affected by Dullard loss. Isl1 or myosin heavy chain (MF20) in E11.5 control and Dullard hearts displayed similar profile and expression levels in control and Dullard mutant embryos (Figure 2—figure supplement 1). Similarly, Tbx1 and Pitx2 expression patterns at the base of the pulmonary trunk and its expression level were comparable in control and mutant embryos (Author response image 2). Finally, more data on Sema3c mRNA distribution in Dullard mutants also indicate that Sema3c expression in the myocardial cuff is not altered by Dullard’s deletion in the NCC (Figure 1—figure supplement 1D).

Author response image 2. RNAscope for Tbx1 and Pitx2 showing there are no differences between Control and mutants PFT for their expression levels.

Author response image 2.

N.B. We have tested several antibodies against the Cdh5, none of those were efficient enough to mark whether the elevated Cdh5 mRNA levels in Dullard mutant could also be detected at the protein level.

Point 2. The specificity of the phenotype with respect to BMP signalling.

We now provide further support for the lack of Dullard leading to an elevation of BMP signalling.

– A new statistical test (two way-Anova) indicate that the variations in PSmads levels both between control and mutant cells at a given proximo-distal axis level and between the distal and proximal regions of the OFT in a given genetic background are significant (significance for the differences between Wnt1cre,DullardFlox/Flox and Wnt1cre;DullardFlox/+; p-value<0.002).

– Our single cells transcriptomic analysis reveals that out of the genes differentially expressed between control and Dullard mutant cardiac NCC stand well known pan BMP signalling direct target genes, namely Id1, Id2, Msx1 and Msx2 (Figure 1F). Accordingly, Id2 and Msx2 detected using RNAscope probes exhibit elevated levels in the mutant NCC compared to control NCC or to adjacent positive tissues (Figure 1F). Hence, not only the phosphorylation of Smad1/5/8 is increased by the loss of Dullard, but their transcriptional activity is likely to be upregulated as well.

– We provide also data showing that the loss of Dullard using the Pax3cre driver not only lead to elevation of BMP signalling in cardiac NCC, but also in other lineages marked by this Cre driver and exposed to BMP ligands in their environment (Figure supplement 1D and data not shown). It includes for instance several muscle masses in the trunk and limb bud regions, as well as the dorsal neural tube. Furthermore, the muscle masses of Dullard mutants also display elevated levels of Sema3c (Figure 1—figure supplement 1D). These results further support the idea that Dullard stands as a pan and generic inhibitor of BMP signalling in several embryonic tissues.

Furthermore, we have attempted to rescue Dullard mutants by performing intraperitoneal injections to pregnant females with the Alk2 and Alk3 BMP receptors inhibitor LDN193189 at two different doses (Author response image 3). Unfortunately, we haven’t been able to downregulate the levels of PSmads neither in controls nor in Dullard mutants, and Dullard mutants treated with LDN still displayed OFT septation defect. This could stem from the instability in the LDN, issues from its absorption and diffusion within the mother and embryonic tissues.

Author response image 3. LDN effect on Dullard mutants.

Author response image 3.

(A) Analysis of phosho-Smad intensity at different levels of the OFT at E11.5 after 48h exposure to LDN. (B) Transversal sections of the distal OFT stained for PECAM and GFP after 48h treatment with LDN or vehicle of mutant E11.5 embryos.

We have also checked the state of TGFβ signalling in Dullard mutants, as this pathway has been shown to be increased upon deletion of the phosphatase in the limb bud mesenchyme (Hayata et al., 2015). Immunostaining for the phosphorylated form of one of the downstream effectors of this signalling pathway (Smad2) indicates that the levels of activation of this TF is not impaired in absence of Dullard (Figure 1—figure supplement 1E). Hence, in NCC Dullard does not appear to be required for dampening TGFβ signalling levels.

Finally, we have clarified in the Discussion our statement on whether the ingression of NCC may contribute to the generation of a BMP signalling gradient. From our data, it is clear that Dullard is not implicated in the establishment of the gradient of BMP signalling, but in the regulation of its amplitude. We have proposed that this is regulated by other negative regulators of the pathway and could be linked to temporal dynamics in this signalling pathway. Over time the signal decreases, hence cells which have been submitted earlier to BMP and which have ingressed further display lower levels of signalling than cells which have been in the presence of BMP ligands for a shorter period of time (Bier and Robertis, 2015).

Point 3. The possible role of Sema3C and other differentially expressed genes in the development of the phenotype.

As proposed by one of the reviewers, we have taken the opportunity to further develop our discussion in the revised version of the paper on how the differentially expressed genes may contribute to the establishment of the Dullard mutant phenotype. Notably, we believe that the elevation of Sema3c expression is central to the establishment of the OFT defects in Dullard mutants. Based on a handful of papers that have demonstrated in different cell lines Sema3c requirement for cohesion between cells, we propose that the elevated levels could promote the early compaction of the NCC in Dullard mutants.

References:

Bier E and Robertis EMD (2015) BMP gradients: A paradigm for morphogen-mediated developmental patterning. Science 348: aaa5838

Brown CB, Feiner L, Lu MM, Li J, Ma X, Webber AL, Jia L, Raper JA and Epstein JA (2001) PlexinA2 and semaphoring signaling during cardiac neural crest development. Dev. Camb. Engl. 128: 3071–3080

Hayata T, Yoichi, Ezura, Asashima M, Nishinakamura R and Noda M (2015) Dullard/Ctdnep1 Regulates Endochondral Ossification via Suppression of TGF-β Signaling. J. Bone Miner. Res. 30: 318–329

Jiang X, Rowitch DH, Soriano P, McMahon AP and Sucov HM (2000) Fate of the mammalian cardiac neural crest. Development 127: 1607–1616

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Supplementary file 1. List of TaqMan gene expression assays (20x, Life Technologies) used for single-cell qPCRs experiments.
    elife-50325-supp1.xlsx (12KB, xlsx)
    Transparent reporting form

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES