Skip to main content
eLife logoLink to eLife
. 2020 Mar 4;9:e50434. doi: 10.7554/eLife.50434

ARL13B regulates Sonic hedgehog signaling from outside primary cilia

Eduardo D Gigante 1,2, Megan R Taylor 3, Anna A Ivanova 4, Richard A Kahn 4, Tamara Caspary 2,✉
Editors: Jeremy F Reiter5, Anna Akhmanova6
PMCID: PMC7075693  PMID: 32129762

Abstract

ARL13B is a regulatory GTPase highly enriched in cilia. Complete loss of Arl13b disrupts cilia architecture, protein trafficking and Sonic hedgehog signaling. To determine whether ARL13B is required within cilia, we knocked in a cilia-excluded variant of ARL13B (V358A) and showed it retains all known biochemical function. We found that ARL13BV358A protein was expressed but could not be detected in cilia, even when retrograde ciliary transport was blocked. We showed Arl13bV358A/V358A mice are viable and fertile with normal Shh signal transduction. However, in contrast to wild type cilia, Arl13bV358A/V358A cells displayed short cilia and lacked ciliary ARL3 and INPP5E. These data indicate that ARL13B’s role within cilia can be uncoupled from its function outside of cilia. Furthermore, these data imply that the cilia defects upon complete absence of ARL13B do not underlie the alterations in Shh transduction, which is unexpected given the requirement of cilia for Shh transduction.

Research organism: Mouse

Introduction

The Hedgehog (Hh) signaling pathway is essential for embryogenesis in a wide variety of organisms. Initially discovered in Drosophila where there is a single Hh ligand, the core components of the Hh pathway are conserved in vertebrates (Nüsslein-Volhard and Wieschaus, 1980). These include the vertebrate Hh receptor Patched1 (Ptch1), the obligate transducer of the pathway Smoothened (Smo), as well as the Gli transcription factors (Ci in Drosophila) that act as both activators (GliA) and repressors (GliR) to control target gene transcription (Briscoe and Thérond, 2013). There are three Hh ligands in vertebrates, Sonic (Shh), Indian (Ihh) and Desert (Dhh), that regulate a multitude of developmental processes including formation of the limbs and digits, the bones of the skull and face, and the patterning of the neural tube (Placzek and Briscoe, 2018). Diminished Hh signaling during embryogenesis results in birth defects whereas increased Hh signaling leads to tumors, highlighting the importance of the pathway and its regulation (Raleigh and Reiter, 2019).

Given the deep homology between invertebrate and vertebrate Hh signaling, the discovery that primary cilia are required for vertebrate, but not invertebrate, Hh signaling was unexpected (Huangfu et al., 2003; Huangfu and Anderson, 2006). Vertebrate Hh components dynamically traffic within primary cilia in response to Hh ligand (Corbit et al., 2005; Haycraft et al., 2005; Rohatgi et al., 2007). In the absence of ligand, Ptch1 is enriched on the ciliary membrane and Smo is barely detectable (Corbit et al., 2005; Rohatgi et al., 2007). Furthermore, full length Gli proteins traffic to the ciliary tip and back to the cytoplasm before being cleaved to their repressor form, which actively shuts down Hh target gene transcription in the nucleus (Kim et al., 2009; Liu et al., 2005; Wen et al., 2010; Humke et al., 2010). In contrast, upon ligand stimulation (Shh, Ihh or Dhh), the Ptch1 receptor binds the ligand and shuttles out of cilia (Rohatgi et al., 2007). Subsequently, Smo is enriched in the cilium and is subsequently activated (Kong et al., 2019; Corbit et al., 2005). Activated Smo promotes the processing of full-length Gli transcription factors into GliA, which turns on target genes (Aza-Blanc et al., 2000; Ruiz i Altaba, 1998). Ablation of cilia results in an absence of GliA and GliR production, rendering the pathway inert and leading to an absence of transcriptional response (Huangfu and Anderson, 2005). The dynamic ciliary movement of Shh components appears to be critical to pathway function, as alterations to cilia disrupt pathway output (Caspary et al., 2007; Huangfu and Anderson, 2006; Liem et al., 2012; Liem et al., 2009; Goetz et al., 2009; Murdoch and Copp, 2010; Tuz et al., 2014; Cortellino et al., 2009; Houde et al., 2006; Liu et al., 2005; Tran et al., 2008; Taylor et al., 2015).

Given that the fundamental logic of the pathway is conserved from flies through vertebrates, and that flies transduce Hh signals without relying on primary cilia, both evolutionary and mechanistic questions are raised as to how vertebrate cells co-opted the primary cilium for Hh signal transduction. One distinction lies in the fact that vertebrates use Hh signaling over a longer distance than flies, leading to the proposal that the primary cilium is a critical part of a mechanism underlying long range signaling (Bangs et al., 2015). For example, in neural patterning Shh is initially expressed in the notochord and is secreted to specify fates more than 20 cells away (Chiang et al., 1996; Briscoe et al., 2001; Roelink et al., 1994). At the evolutionary level, comparisons among organisms with cilia and or Hh have provided some clues. The round worm C. elegans have cilia yet do not possess Hh signaling as they don’t have most of the genes encoding the core components of Hh signal transduction (The C. elegans Sequencing Consortium, 1998; Roy, 2012). Curiously, a few components of Hh signaling such as fused and costal2 are in the C. elegans genome where they are functionally important for ciliogenesis (Ingham et al., 2011). Additionally, C. elegans retained a Ptch1 homolog important for development and pattern formation, but no Hh or Smo (Zugasti et al., 2005; Kuwabara et al., 2000). In contrast, planaria flatworms possess both cilia and Hh signaling but the cilia are not required to transduce Hh signaling (Rink et al., 2009). The first known evolutionary link between cilia and Hh is in sea urchins which transduce Hh signal in developing muscle tissue via motile cilia (Warner et al., 2014; Sigg et al., 2017). Subsequently, in vertebrates Hh signaling requires primary cilia. These data suggest that the mechanistic link of cilia and Hh is limited to deuterostomes and raises the question of whether the relationship of Hh and primary cilia originated near the last common ancestor of vertebrates, the urochordates.

ARL13B is a member of the ARF family of regulatory GTPases and is highly enriched on the ciliary membrane (Caspary et al., 2007). In mice, a null mutation of Arl13b leads to short cilia and to alterations in Shh signal transduction (Caspary et al., 2007; Larkins et al., 2011). ARL13 is ancient, predicted to be present in the last common eukaryotic ancestor. ARL13 appears to have been lost during evolution in organisms that lack cilia and duplicated to ARL13A and ARL13B in the urochordates, thus ARL13B is proposed to hold important clues in deciphering the links between primary cilia and vertebrate Hh signaling (Schlacht et al., 2013; Li et al., 2004; Kahn et al., 2008; East et al., 2012; Logsdon, 2004).

ARF regulatory GTPases, like ARL13B, are best known to play roles in membrane trafficking (D'Souza-Schorey and Chavrier, 2006). As is true for a large number of regulatory GTPases, ARL13B is functionally diverse (Sztul et al., 2019). It regulates endocytic traffic (Barral et al., 2012), as well as the phospholipid composition of the ciliary membrane through recruitment of the lipid phosphatase INPP5E to the ciliary membrane (Humbert et al., 2012). ARL13B also has a conserved role as a guanine nucleotide exchange factor (GEF) for ARL3, another ciliary ARF-like (ARL) protein (Gotthardt et al., 2015; Zhang et al., 2016; Hanke-Gogokhia et al., 2016; Ivanova et al., 2017). ARL13B regulates intraflagellar transport (IFT), the process that builds and maintains cilia (Cevik et al., 2010; Li et al., 2010; Nozaki et al., 2017). It is known to interact with several proteins associated with cilia, including the exocyst, tubulin and UNC119 (Seixas et al., 2016; Zhang et al., 2016; Larkins et al., 2011; Revenkova et al., 2018). Critical to this work, loss of ARL13B disrupts Shh signal transduction in at least two distinct ways: Smo enrichment in cilia occurs even in the absence of ligand and Gli activator production is diminished, although Gli repressor is made normally (Caspary et al., 2007; Larkins et al., 2011).

Due to the high enrichment of ARL13B on the ciliary membrane, ARL13B is assumed to function in its diverse roles from within the cilium. However, ARL13B is present in early endosomes and circular dorsal ruffles on the cell surface (Barral et al., 2012; Casalou et al., 2014). We previously showed that a V358A variant of ARL13B does not localize to cilia as it disrupts a known VxPx cilia localization sequence (Higginbotham et al., 2012; Mariani et al., 2016). Exogenous overexpression of a ARL13BV358A construct in Arl13b null cells does not rescue ARL13B-dependent phenotypes such as cilia length as well as interneuron migration and connectivity, consistent with ciliary ARL13B mediating these processes (Higginbotham et al., 2012; Mariani et al., 2016). In contrast, we found that overexpressed ARL13BV358A does rescue the Shh-dependent ciliary enrichment of Smo in mouse embryonic fibroblasts, arguing that ARL13B may function outside the cilium to regulate Smo traffic (Mariani et al., 2016). Together, these results raise the question of where ARL13B functions.

To define where ARL13B functions in relation to cilia, we wanted an in vivo model so generated mice carrying the ARL13BV358A point mutation using CRISPR/Cas9. Here we demonstrate that ARL13BV358A protein was undetectable in Arl13bV358A/V358A cilia in both neural tube and mouse embryonic fibroblast cilia, even after blocking retrograde ciliary traffic. We report that Arl13bV358A/V358A mice were viable, fertile, and transduced Shh signal normally. We found ARL3 and INPP5E did not localize to the short cilia present in/on Arl13bV358A/V358A cells. These data indicate that ARL13B’s roles within and outside cilia can be uncoupled; ARL13B’s role in regulating cilia length is from within cilia, whereas its control of Shh signaling appears to be from outside the cilium. Thus, these data imply that the cilia defects seen in the complete absence of ARL13B do not underlie the alterations in Shh transduction, which is unexpected given the requirement of cilia for Shh signal transduction.

Results

ARL13BV358A displays normal GEF activity

We previously showed that mouse ARL13BV358A protein retained normal intrinsic and GAP-stimulated GTP hydrolysis activities by analyzing GST-ARL13BV358A purified from human embryonic kidney (HEK) cells (Mariani et al., 2016). In order to test ARL13BV358A GEF activity for ARL3, we used the same GST-ARL13BV358A protein preparation and measured the rates of spontaneous or GEF-stimulated GDP dissociation from ARL3 in the presence and absence of ARL13B or ARL13BV358A. ARL3 spontaneously releases pre-bound GDP quite slowly under the conditions in the assay, though release is linear with time, and by extrapolation requires just under 30 minutes for 50% of pre-bound [3H]GDP to dissociate (Figure 1). In marked contrast, addition of ARL13B under the same conditions caused the release of 50% of the GDP within ~10 seconds and close to 100% in one minute. We detected no differences between the wild type and mutant ARL13BV358A proteins in this assay, consistent with this point mutation having no effect on ARL13B GEF function (Figure 1). This result is consistent with GEF activity being conserved within the protein’s GTPase domain while the V358A mutation is located in the C-terminal domain (Gotthardt et al., 2015). These data indicate that ARL13BV358A retains all known ARL13B biochemical activities, suggesting that the V358A mutation only disrupts ARL13B localization.

Figure 1. ARL3 GEF activity is retained in the ARL13BV358A mutant.

Figure 1.

Time course of the release of pre-bound [3H]GDP from purified, recombinant ARL3 in the absence (ARL3) or presence of mouse wild type ARL13B or ARL13BV358A (mARL13B) are shown. See Methods for details. Error bars ± standard deviation.

CRISPR engineered Arl13bV358A/V358A mice express cilia-excluded ARL13B protein

To determine the consequences of ARL13BV358A expression in vivo, we used CRISPR/Cas9 editing to change residue 358 from valine to alanine (Figure 2A). We performed sequencing of the region that flanked exon 8, using primers outside the region of the donor oligonucleotide. We confirmed the heterozygous T to C base pair change for a valine to alanine change at residue 358 (Figure 2B). We backcrossed heterozygous F1 progeny to FVB/NJ for three generations before analysis to minimize any off target confounds (see details in Methods).

Figure 2. Generation of the Arl13bV358A/V358A mouse.

(A) Schematic of Arl13b gene and donor oligo (orange bar) at exon 8 used to generate the V358A causing point mutation. Arrows indicate primers used for allele validation. (B) Arl13b DNA and relevant amino acid sequence with the RVEP sequence in the orange box and the T-to-C mutation highlighted in pink. (C) Confocal images of cilia marker IFT88 (green) and ARL13B (magenta; NeuroMab) staining in neural tube of E10.5 somite-matched embryos. ARL13B-positive cilia are visible in Arl13b+/+ and Arl13bV358A/+, but not in Arl1bV358A/V358A embryos. (See Figure 2—figure supplement 1 for images of neural tube cilia under saturating conditions.) At least 5 embryos per genotype across five litters were examined. Scale bars are 50 μm. (D) ARL13B western blot of E10.5 whole embryo lysates, wild type (+/+), Arl13bV358A/+ (A/+) and Arl13bV358A/V358A (A/A) and (E) quantification presented as average intensity normalized to total protein ± standard deviation. Representative blot of whole embryo lysates (n = 3 embryos per genotype with technical duplicate of each). *p<0.05, one-way ANOVA and Tukey’s multiple comparison.

Figure 2—source data 1. ARL13B western blot quantification.

Figure 2.

Figure 2—figure supplement 1. Overexposure of Arl13bV358A/V358A cilia in E10.5 neural tube reveals no clear ARL13BV358A presence in cilia.

Figure 2—figure supplement 1.

Overexposure of cilia in E10.5 Arl13b+/+, Arl13bV358A/V358A, and Arl13bhnn/hnn embryonic neural tube, stained for IFT88 and ARL13B (NeuroMab). The ARL13B channel was overexposed for four seconds instead of one second.
Figure 2—figure supplement 2. Overexposure of Arl13bV358A/V358A cilia in MEFs reveals no clear ARL13BV358A presence in cilia.

Figure 2—figure supplement 2.

(A) We identified acetylated α-tubulin positive cilia and used the marker to outline the area of the cilium. We quantified ARL13B immunofluorescence detected by Caspary lab polyclonal anti-ARL13B antibody (Caspary et al., 2007) and used the same trace to measure background levels in a different area of the cell body. (B) Arl13bV358A/V358A (A/A) and Arl13bhnn/hnn (hnn) MEFs treated with control or ciliobrevin-D 0.5% FBS Media. Samples were overexposed five times longer than normal, saturating the detector in the ARL13B channel. We measured no difference in ciliary ARL13B immunofluorescence between control and ciliobrevin-D treated Arl13bV358A/V358A and Arl13bhnn/hnn MEFs. Data presented as violin plots and analyzed by one-way ANOVA. Respective number of cilia listed below each plot. Cilia that had ARL13B immunofluorescent readings above background (*) are shown in panel D. (C) Representative images of over exposed Arl13bV358A/V358A and Arl13bhnn/hnn MEFs in control and ciliobrevin-D treatment conditions. (D) Representative images of cilia with ARL13B levels above background, marked by * in panel B.

To determine whether ARL13BV358A was detectable in neural tube cilia, we performed immunofluorescence using antibodies directed against ARL13B and the cilia marker IFT88. At embryonic day (E)10.5, we saw IFT88 staining, indicating the presence of cilia. In neural tube cilia of Arl13b+/+ and Arl13bV358A/+ embryos, we observed equivalent ARL13B staining but could not see ARL13B signal in neural tube cilia of Arl13bV358A/V358A embryos (Figure 2C). We exposed the images longer, to saturation, and while we observed low-level staining throughout the cell, we saw no ciliary ARL13B indicating the ARL13BV358A protein is undetectable in cilia in vivo (Figure 2—figure supplement 1).

One possible explanation for the absence of ciliary ARL13B in the Arl13bV358A/V358A embryos is that the ARL13BV358A protein is not expressed or is unstable. To determine whether ARL13B protein expression was affected by the V358A mutation, we performed western blots on E10.5 whole embryo lysates (Figure 2D). We found a ~ 7% (±20%) reduction of ARL13B levels in Arl13bV358A/+ embryos and a ~ 37% (±6%) decrease of ARL13B levels in Arl13bV358A/V358A embryos, compared to WT (Figure 2E). This decrease may reflect a change in ARL13BV358A stability compared to ciliary ARL13B or could signify ARL13BV358A protein having a distinct half-life when localizing to different cellular compartments. Regardless, these data indicate that ARL13BV358A is expressed in Arl13bV358A/V358A embryos.

ARL13BV358A protein is undetectable in cilia in mouse embryonic fibroblasts

To more closely investigate whether any ARL13BV358A protein could localize to cilia, we generated immortalized mouse embryonic fibroblasts (MEFs). We performed double labeling to first identify cilia using acetylated α-tubulin or IFT88 antibodies and subsequently determined whether ARL13B is present in cilia. We used five distinct antibodies against ARL13B: four antibodies against amino acids 208–427 of the mouse ARL13B protein (one mouse monoclonal (NeuroMab), three rabbit polyclonal antibodies Caspary et al., 2007), as well as one antibody against the full-length human ARL13B protein (rabbit polyclonal (Protein Tech)). By eye, we observed strong ciliary staining of ARL13B with each of the antibodies in Arl13b+/+ and Arl13bV358A/+ cells, but we were unable to identify any evidence of ARL13B staining above background within cilia in Arl13bV358A/V358A cells with any of these five antibodies (Figure 3A). Taken together, these data support our conclusion that ARL13BV358A is not detectable in cilia using the currently available, validated ARL13B antibodies. While we observed no evidence of detectable ciliary ARL13B in Arl13bV358A/V358A MEFs, it is possible that a small amount of ARL13BV358A is constantly trafficking in and out of cilia, at steady-state levels that remain below the limits of detection. To begin to address this possibility, we blocked retrograde ciliary transport, reasoning that any ARL13B undergoing trafficking in and out of cilia would accumulate. We treated cells with ciliobrevin-D, which blocks the retrograde motor protein dynein (Firestone et al., 2012). As a positive control, we examined IFT88 and Gli3, a ciliary protein and a Hh component, respectively; both are known to accumulate at ciliary tips upon blocking of retrograde transport. We found IFT88 and Gli3 enrichment at ciliary tips in Arl13b+/+, Arl13bV358A/+ and Arl13bV358A/V358A cells upon ciliobrevin-D treatment relative to the respective DMSO-treated controls with no difference in IFT88 or Gli3 staining among the three genotypes (Figure 3B and C). To determine whether ARL13B accumulated in cilia of ciliobrevin-D-treated MEFs, we examined cells co-stained for acetylated α-tubulin and ARL13B. In Arl13b+/+ and Arl13bV358A/+ cells, we saw that about 90% of acetylated α-tubulin-positive cilia also stained for ARL13B in DMSO-treated control or ciliobrevin-D treated MEFs (Figure 3D and E). In Arl13bV358A/V358A MEFs, we saw no ciliary ARL13B staining in DMSO-treated control or ciliobrevin-D-treated cells using two antibodies against distinct epitopes (Figure 3D and E). Thus, even when retrograde traffic out of cilia is disrupted, we were unable to detect ARL13B protein in cilia in Arl13bV358A/V358A MEFs.

Figure 3. ARL13BV358A is undetectable in cilia and cannot be enriched by inhibition of retrograde transport.

(A) Antibodies against ciliary markers acetylated α-tubulin or IFT88 (magenta) and ARL13B (cyan) in Arl13bV358A/V358A MEFs. Representative images show staining for five indicated ARL13B antibodies: (PT) polyclonal rabbit antibody against full-length human ARL13B from ProteinTech, (503, 504, 505) polyclonal rabbit sera from three distinct rabbits raised against C-terminus of mouse ARL13B (amino acids 208–427) (Caspary et al., 2007), and (NM) monoclonal mouse antibody against C terminus of mouse ARL13B from NeuroMab. Arl13b+/+ and Arl13bV358A/+ show ciliary ARL13B staining. Table lists ARL13B-positive cilia and the total number of cilia identified by acetylated α-tubulin or IFT88 antibody in parentheses. Cilia appear shorter in Arl13bV358A/V358A cells (see Figure 6). (B) IFT88 and (C) Gli3 (green) is enriched in the tips of cilia in Arl13b+/+ (+/+), Arl13bV358A/+ (A/+) and Arl13bV358A/V358A (A/A) cells following ciliobrevin-D treatment. Violin plots depict relative fluorescence of IFT88 and Gli3 at cilia tip to cell body with number of cilia measured (n) listed beneath each plot. (D and E) Table lists ARL13B (cyan) positive cilia (rabbit anti-ARL13B; ProteinTech or mouse anti-ARL13B; NeuroMab) and the total number of cilia (acetylated α-tubulin: magenta) examined in control (DMSO) and ciliobrevin-D treated (30 μM CB) cell lines. Representative images show staining for cilia and ARL13B. Staining of IFT88 and Gli3 analyzed by two-way ANOVA and Sidak’s multiple comparisons. (***p<0.001, ****p<0.0001).

Figure 3—source data 1. Analysis of ARL13B in MEFs.

Figure 3.

Figure 3—figure supplement 1. Endogenous ARL13B is undetectable in the cell body of cilia mutant Ift172wim/wim cells.

Figure 3—figure supplement 1.

Immunofluorescent detection of ARL13B (cyan; NeuroMab) and cilia marker acetylated α-tubulin (magenta) in wildtype, Arl13bhnn/hnn, Ift172wim/wim, and Ift172wim/wim Arl13bhnn/hnn cell lines. (A) In wildtype cells, ARL13B is detectable in the cilium under non-saturating conditions, these parameters are kept constant across all samples. (B) In Ift172wim/wim non-ciliated cells, ARL13B protein is confined to the cell body, but is nearly undetectable by standard immunofluorescence. (C–D) In Arl13bhnn/hnn and Ift172wim/wim Arl13bhnn/hnn cells, null for Arl13b, any signal is due primary antibody background. At an exposure rate 4x above normal the ARL13B signal saturates the detector in wildtype cells. In Ift172wim/wim cells, overexposure reveals no ARL13B positive stain that is above the background detected in Arl13bhnn/hnn and Ift172wim/wim Arl13bhnn/hnn cells. Images taken at 40x. Scale bar is 5 μm. Experiments repeated in duplicate and examined 4–6 fields of view per condition.

We re-examined these data and repeated our analyses using over-exposed images. After defining the region of interest using the acetylated α-tubulin staining, we subsequently overexposed the ARL13B channel five-fold relative to the images in Figure 3 and acquired measurements at the cilium and the cell body (Figure 2—figure supplement 2). As a control, we used Arl13bhnn/hnn MEFs, which are devoid of any ARL13B, and obtained a ratio of 1.0, with or without ciliobrevin-D treatment. We found the same ratio when we analyzed Arl13bV358A/V358A MEFs consistent with ARL13B being absent from the cilia. We observed a few instances of ARL13B appearing to co-localize with acetylated α-tubulin, but these were rare (<5%, 2/49) and occurred in both Arl13bV358A/V358A and Arl13bhnn/hnn (null) cells indicating this is the background staining of the primary antibody. We extended our analysis of overexposed images in Arl13bV358A/V358A and Arl13bhnn/hnn neural tube sections four-fold relative to the images in Figure 2; we identified no overlap of overexposed ARL13B with cilia marker IFT88 (Figure 2—figure supplement 1). While it is formally possible that an extremely small amount of ARL13BV358A remains in cilia, we are not able to find evidence of it; thus, we designate ARL13BV358A protein as cilia-excluded ARL13B.

We did not observe any obvious cellular ARL13B signal in the cells expressing cilia-excluded ARL13B so we investigated whether we could detect cellular ARL13B in cells lacking cilia, Ift172wim/wim MEFs. As controls we used wildtype, Arl13bhnn/hnn (lacking ARL13B), and Ift172wim/wim Arl13bhnn/hnn (lacking ARL13B and cilia) MEFs. We only detected ARL13B staining in Ift172wim/wim cells upon overexposure and found it was modestly detectable above the background level we observed in Arl13bhnn/hnn or Ift172wim/wim Arl13bhnn/hnn cells (Figure 3—figure supplement 1). Thus, cellular ARL13B is expressed at an extremely low level.

Arl13bV358A/V358A mice are viable and fertile

In order to determine the phenotypic consequence of the Arl13bV358A allele, we intercrossed Arl13bV358A/+ mice. We observed progeny in Mendelian proportions with an average of 7.3 pups per litter, consistent with the reported FVB/NJ litter size of 7–9 (Murray et al., 2010; Table 1). To test whether homozygous mice breed normally, we crossed Arl13bV358A/V358A males to heterozygous or homozygous females. We found the Arl13bV358A allele segregated in Mendelian proportions and the litter sizes were normal indicating that Arl13bV358A does not impact viability, fertility or fecundity.

Table 1. Genotype of mice born to heterozygous and/or homozygous carrier parents.

Data analyzed by chi-squared test.

MICE Sex wildtype V358A/+ V358A/V358A
Het × Het
Avg. Litter
7.3
M (46.5%) 3 11 6
χ2 = 0.60
F (53.5%) 6 8 9
% of Total 20.9 44.2 34.9
Het × Hom
Avg. Litter
7.5
M (60%) - 10 11
χ2 = 0.69
F (40%) - 6 8
% of Total - 45.7 54.3
Hom × Hom
Avg. Litter
9.5
M (47.4%) - - 9
F (52.6%) - - 10

ARL13BV358A permits normal embryonic development and Shh signaling

Loss of Arl13b leads to morphologically abnormal embryos, lethality and neural patterning defects (Caspary et al., 2007). As ARL13BV358A overcame the embryonic lethality, we examined overall embryo morphology at E9.5, E10.5 and E12.5. We found the overall morphology of Arl13bV358A/V358A embryos resembled those of Arl13b+/+ and Arl13bV358A/+ embryos indicating that ARL13BV358A did not lead to gross morphological defects. (Figure 4A–I).

Figure 4. ARL13BV358A mediates normal Shh signaling and neural tube patterning.

Figure 4.

(A–I) Whole embryo and neural tube sections of somite-matched littermates at E9.5, E10.5, and E12.5 stained with indicated markers of cell fate. Whole embryo scale bars: 2 mm. (A’-I’ and A’-F’) Shh-dependent neural tube patterning at three separate time points. Cell fate markers are listed above each image. All neural tube scale bars are 50 μm. Neural tube patterning was examined in five embryos for each embryonic stage. E, embryonic day.

At E9.5, Shh is normally expressed in the notochord as well as the floor plate of the ventral neural tube. Moving dorsally, the adjacent domains express Nkx2.2 and subsequently Olig2. In the Arl13bhnn/hnn (null) neural tube, the Shh-positive columnar cells of the floor plate are absent resulting in both ventral and dorsal expansion of intermediate Shh-dependent cell fates such as Olig2 (Caspary et al., 2007). To determine whether ARL13BV358A disrupts Shh signaling, we examined neural tube patterning in Arl13b+/+, Arl13bV358A/+, and Arl13bV358A/V358A embryos at E9.5, E10.5, and E12.5. At E9.5 we observed no differences in Shh, Nkx2.2 or Olig2 among Arl13b+/+, Arl13bV358A/+, and Arl13bV358A/V358A embryos (Figure 4A–C). Cell fates in the neural tube are specified by both the concentration and duration of Shh signaling so we examined neural patterning at subsequent stages (Dessaud et al., 2007). By E10.5, some Olig2 precursors have differentiated to HB9+ motor neurons and all Shh-responsive cells express Nkx6.1. We found that Olig2, HB9 and Nkx6.1 positive cells are normally distributed in all 3 genotypes at E10.5 and E12.5 (Figure 4D–I). These data indicate that ARL13BV358A mediates normal Shh signaling.

ARL13B regulates ciliary enrichment of Shh components from outside cilia

In Arl13bhnn/hnn cells, Smo is enriched in cilia in a Shh-independent manner, which may be due to defective trafficking of Smo, as many ARL family members regulate protein trafficking (Lim et al., 2011; Larkins et al., 2011). To assess Smo enrichment in Arl13bV358A/V358A embryos, we stained for the cilia marker acetylated α-tubulin and Smo in E10.5 embryos. Smo appeared enriched normally in ventral floor plate cilia and the dorsal boundary of Smo ciliary enrichment in ventral neural progenitors was identical in Arl13b+/+, Arl13bV358A/+, and Arl13bV358A/V358A samples indicating ARL13BV358A mediates normal ciliary Smo enrichment (Figure 5A).

Figure 5. ARL13BV358A mediates normal ciliary enrichment of Shh components, but not ARL3 or INPP5E.

Figure 5.

(A) Smo (green) enrichment in ventral neural tube cilia (acetylated α-tubulin: magenta) is normal in E10.5 embryos. Images are confocal projections. Scale bar is 25 μm. (B-H, Top) Quantification of average fluorescence intensity in the tip of the cilium (Gli2, Gli3, and Sufu) or the entire cilium (Ptch1, Smo, ARL3, and INPP5E) relative to background level. Violin plots depict relative fluorescent intensity per cilium with number of cilia examined below each plot. (B-H, Bottom) Representative images for each condition and cell type with the cilia marker acetylated α-tubulin (magenta) and indicated protein (green). Arl13b+/+ (+/+), Arl13bV358A/+ (A/+), Arl13bV358A/V358A (A/A) and Arl13bhnn/hnn (hnn). Data analyzed by one-way ANOVA and Tukey’s multiple comparisons, except Smo data analyzed by two-way ANOVA and 16 comparisons, corrected p<0.003 deemed significant. (**p<0.01, ***p<0.001, ****p<0.0001).

Figure 5—source data 1. Immunofluorescence of cilia proteins.

To examine Smo traffic in response to Shh stimulation, we treated MEFs with 0.5% FBS or Shh-conditioned media for 24 hours and stained for Smo. As expected in control Arl13bhnn/hnn cells, we saw ciliary Smo in unstimulated MEFs which increased upon stimulation with Shh-conditioned media (Larkins et al., 2011; Figure 5B). In Arl13b+/+, Arl13bV358A/+, and Arl13bV358A/V358A MEF cilia, we saw ciliary enrichment of Smo upon Shh stimulation over their respective unstimulated controls (Figure 5B, left). We found no difference in Smo enrichment among these cell lines (Figure 5B, right). Thus, despite ARL13B being critical for Shh-dependent Smo ciliary enrichment, ARL13BV358A regulates Smo localization normally, arguing this function of ARL13B can occur when the protein is not in cilia.

In addition to aberrations in Smo trafficking, loss of Arl13b leads to changes in the cilia localization of other Shh components in MEFs (Larkins et al., 2011). To determine whether these components are disrupted by ARL13BV358A, we examined Gli2, Gli3, Sufu and Ptch1 in MEFs. We observed no differences in distribution of Gli2 or Ptch1 among any of the examined genotypes (Figure 5C,F). In contrast, as we previously reported, we observed more Gli3 at the ciliary tip of Arl13bhnn/hnn cells and increased Sufu in Arl13bhnn/hnn cilia compared to wild type controls (Larkins et al., 2011; Figure 5D,E). Thus, Shh components are normally localized in Arl13bV358A/V358A MEFs consistent with the normal Shh signal transduction observed in Arl13bV358A/V358A embryos (Figure 4).

ARL13B regulates ciliary enrichment of ARL3 and INPP5E from within cilia

We next examined the role of ARL13BV358A in the localization of other ciliary proteins. ARL13B is the GEF for ARL3, and we showed that ARL13BV358A GEF activity for ARL3 is retained (Figure 1). ARL13B is also essential for cilia localization of INPP5E, as the proteins are in a common complex (Humbert et al., 2012). To determine whether the ciliary localization of either ARL3 or INPP5E was affected by ARL13BV358A, we performed immunofluorescence on MEFs. Ciliary ARL3 staining appeared the same in Arl13b+/+ and Arl13bV358A/+ MEFs, however ARL3 was not detectable in Arl13bV358A/V358A or Arl13bhnn/hnn cilia (Figure 5G). INPP5E was normally detectable in Arl13b+/+ and Arl13bV358A/+ MEF cilia, but not in Arl13bV358A/V358A and Arl13bhnn/hnn MEF cilia (Figure 5H). These results indicate that ARL13B is required in cilia for the proper localization of ARL3 and INPP5E to the cilium.

Ciliary ARL13B is required for normal cell ciliation and ciliary length

Loss of Arl13b leads to defects in the percentage of ciliated MEFs and in cilia length (Caspary et al., 2007; Larkins et al., 2011). To test whether ARL13BV358A impacted cell ciliation, we examined immortalized MEFs and counted the number of ciliated cells 24 hours after induction of ciliation by growth in low serum (0.5% FBS). We found 73% (±11%) of Arl13b+/+ and 75%, (±9.1%) of Arl13bV358A/+ MEFs are ciliated, consistent with published results. In contrast, we found 45% (±8.7%) of Arl13bV358A/V358A cells and 53% (±6.4%) of Arl13bhnn/hnn cells had cilia (Figure 6A). Thus, Arl13bV358A/V358A cells exhibit a similar deficit in percentage of ciliated MEFs as complete loss of ARL13B function.

Figure 6. ARL13BV358A results in decreased ciliation rates and short cilia.

Figure 6.

(A) Quantification of ciliation rates in all cell types; Arl13b+/+ (+/+), Arl13bV358A/+ (A/+), Arl13bV358A/V358A (A/A) and Arl13bhnn/hnn (hnn). Fewer Arl13bV358A/V358A and Arl13bhnn/hnn MEFs form cilia compared to Arl13b+/+ or Arl13bV358A/+ cells. (B) Quantification of axoneme length as labeled by acetylated α-tubulin (magenta) in indicated MEFs. Data are presented as mean (μm)± standard deviation with the number of cilia measured per genotype depicted at the base of each bar. Data analyzed by one-way ANOVA and Tukey’s multiple comparisons. (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

Figure 6—source data 1. Analysis of ciliated MEFs.

Arl13bhnn/hnn cilia are about half as long as wild type in both embryos and MEFs (Caspary et al., 2007; Larkins et al., 2011). To determine whether cilia length was affected by ARL13BV358A, we stained MEFs with acetylated α−tubulin and measured the length of the axoneme. We found the average cilia length in Arl13b+/+ and Arl13bV358A/+ MEFs was similar, 2.7 ± 0.8 μm and 2.6 ± 0.9 μm, respectively. However, we found Arl13bV358A/V358A MEF cilia were shorter, 1.9 ± 0.7 μm, similar to Arl13bhnn/hnn MEF cilia which were 2.15 ± 0.8 μm (Figure 6B). These results indicate that ARL13BV358A phenocopies complete loss of ARL13B for ciliation and cilia length, indicating these ARL13B functions require ARL13B in cilia. Furthermore, these data show that ARL13B function within cilia is distinct from ARL13B function outside of cilia in a subset of activities, and that the cilia defects and Shh defects in the complete absence of ARL13B can be uncoupled.

Discussion

Here we show that ARL13B’s role(s) in cell ciliation and cilia length, along with the ciliary enrichment of a subset of proteins, can be uncoupled from ARL13B’s function in regulating Shh signal transduction (Figure 7). Furthermore, we demonstrate this functional distinction correlates with ARL13B spatial localization to the cilium. By generating a mouse expressing a cilia-excluded variant of ARL13B from the endogenous locus, we showed ARL13BV358A protein is not detectable in cilia of embryonic neural tube or MEFs, even upon retrograde ciliary dynein traffic blockade. Furthermore, we detected 30% less ARL13B protein overall in Arl13bV358A/V358A embryos compared to control embryos. While this reduction is statistically significant, it is unclear whether it is biologically significant given that Arl13bhnn/hnn null mutations are recessive and no Arl13bhnn/+ heterozygous phenotype is reported (Caspary et al., 2007; Larkins et al., 2011).

Figure 7. Model comparing complete loss of ARL13B function to ciliary loss of ARL13B function.

Figure 7.

Wildtype (left), Arl13bhnn/hnn (middle), and Arl13bV358A/V358A (right) cilia represented as two halves. On the left half is the organization of Shh components in the presence of Shh ligand and on the right half is the organization of ARL13B interactors ARL3 and INPP5E. (A) ARL13B associates with the ciliary membrane. In the presence of Shh, Ptch1 is removed from cilia and Smo is visibly enriched in cilia. Smo is activated which promotes the processing of full-length Gli transcription factors into their activator forms (GliA), that are shuttled out of the cilium to promote Shh-dependent gene transcription. In addition, cilia proteins ARL3 and INPP5E are localized to the primary cilium. (B) In Arl13bhnn/hnn cells which are null for ARL13B, cilia are shorter than normal. Ciliary Ptch1 and Smo are visible, although Smo appears punctate instead of diffuse. In addition, loss of ARL13B decreases transcription of Shh-dependent genes due to lowered GliA. Arl13bhnn/hnn cilia also display a failure of INPP5E and ARL3 to localize to the cilium. Because ARL13B is the GEF for ARL3, we speculate in this schematic that ARL3 remains GDP bound in Arl13bhnn/hnn cells. (C) In Arl13bV358A/V358A cells, ARL13BV358A is not detectable in cilia and appears diffuse within the cell body. Arl13bV358A/V358A cilia, like Arl13bhnn/hnn cilia, are shorter than wildtype. We observe normal Shh-dependent ciliary Smo enrichment and normal Shh transcriptional output. However, ARL3 and INPP5E are absent from cilia, indicating that ciliary ARL13B is required for ciliary residence of these proteins.

In contrast to the E13.5 lethality of Arl13bhnn/hnn embryos, we found Arl13bV358A/V358A mice were viable and fertile with correct patterning of the neural tube, indicating normal Shh signal transduction. These results are consistent with our data showing that ARL13BV358A protein retains all known biochemical function including GEF activity (Mariani et al., 2016; Ivanova et al., 2017). However, we observed several Arl13bhnn/hnn phenotypes in Arl13bV358A/V358A cells, including loss of ARL3 and INPP5E ciliary enrichment, along with low percentage of ciliated cells and shorter average cilia length. Taken together, our data show that despite the normal high ciliary enrichment of wild type ARL13B and the requirement of cilia for Shh signaling, cilia-excluded ARL13BV358A is sufficient for Shh signal transduction.

We regard ARL13BV358A as cilia-excluded based on several lines of evidence. We did not detect ciliary ARL13BV358A in vivo or in vitro using any of five validated ARL13B antibodies. These antibodies are against two antigens, the full-length protein or residues 208–427, and were independently generated so are likely to recognize a number of epitopes. Given that four of five antibodies are polyclonal and ARL13BV358A displays normal GTP binding, intrinsic and GAP-stimulated GTP hydrolysis, and ARL3 GEF activity, it is likely that the ARL13BV358A protein retains the wild type structure enabling antibody recognition. Indeed, we observed little or no loss in sensitivity in detecting protein in the immunoblot assays. Furthermore, we could not forcibly enrich ciliary ARL13BV358A through retrograde transport blockade with ciliobrevin-D nor could we detect any ciliary enrichment of ARL13BV358A upon overexposure of the relevant fluorescent channel. Alternative ways of trafficking proteins out of cilia include BBSome-dependent or diffusion-dependent mechanisms raising the possibility that ARL13B is trafficked via dynein-independent mechanisms. The fact that we observed ciliary phenotypes, namely short cilia and abnormal ciliary ARL3 and INPP5E localization in ARL13BV358A expressing cells, argue that ARL13B normally performs these functions from within cilia (Caspary et al., 2007; Larkins et al., 2011; Zhang et al., 2016; Humbert et al., 2012; Nozaki et al., 2017). While we cannot exclude the possibility that sub-detectable levels of ARL13BV358A are present and functional in cilia, we note such a level would need to be sufficient for Shh signaling yet insufficient for ARL3 or INPP5E ciliary localization along with proper regulation of cilia length.

Our data support ARL13B regulating different biological processes from its distinct subcellular localizations consistent with how other GTPases act from multiple sites in cells through different effectors. ARL13BV358A disrupts cilia localization of INPP5E and ARL3, but not Shh components and thus provides a novel tool with which to identify additional ARL13B effectors. Such effectors may also inform us as to what subcellular compartment ARL13B functions from as the cellular ARL13B antibody staining we observe is inconclusive. It is surprising that ARL13BV358A is sufficient to regulate Shh signaling because cilia are required for Shh signal transduction and because ARL13B is highly enriched in cilia (Caspary et al., 2007; Huangfu et al., 2003). These observations suggested that the ciliary defects observed in Arl13bhnn/hnn mutants caused the Shh defects. However, our data indicate that ARL13B regulates cilia length and Shh signaling through distinct localization. Thus, the cilia defects in Arl13bhnn/hnn mutants do not underlie Shh misregulation.

Based on the normal cilia trafficking of Shh components in Arl13bV358A/V358A mutants and the abnormal cilia trafficking of Shh components in the complete absence of ARL13B (Larkins et al., 2011), ARL13B likely regulates Shh signaling from the cell body by controlling Shh component traffic to and/or from the primary cilium. Both Smo and ARL13B traffic is linked to endosomes providing one possible non-ciliary organelle (Barral et al., 2012; Wang et al., 2009; Milenkovic et al., 2009). Arl13bhnn/hnn cells display constitutive Smo ciliary enrichment along with little enrichment of Gli proteins at the ciliary tip (Larkins et al., 2011). Our data do not distinguish between ARL13B playing direct roles in traffic of multiple Shh components or whether the normal Smo ciliary enrichment with ARL13BV358A subsequently causes normal cilia traffic of downstream components. ARL13B regulates a step downstream of activated Smo that controls transcription factor Gli activation, but not repression (Caspary et al., 2007; Bay et al., 2018). We argue from our results that this step is also intact in the presence of ARL13BV358A.

The fact that ARL13BV358A can mediate normal ciliary Smo enrichment is especially interesting given that ARL3 and INPP5E localization to cilia is compromised by this mutation. This suggests that ARL13B controls cilia enrichment via multiple localizations and effectors. This is consistent with our understanding of ARF family members, as they are known to perform multiple tasks from different sites within a cell (Sztul et al., 2019). We speculate that ARL3 residence in cilia may require that ARL3 be in (or at least cycle through) its activated, GTP-bound conformation as ARL13BV358A retains its ARL3 GEF activity, but not its cilia localization. ARL13B is in a common protein complex with INPP5E so absence of ARL13B from cilia may disrupt formation or maintenance of the complex there (Humbert et al., 2012; Nozaki et al., 2017). INPP5E regulates Shh signaling through regulation of the phosphoinositol composition of the ciliary membrane. INPP5E loss results in increased ciliary PIP2 and enrichment of Shh repressors in cilia thus resulting in lowered Shh response (Garcia-Gonzalo et al., 2015; Chávez et al., 2015; Dyson et al., 2017). It is not clear why the absence of ciliary INPP5E in ARL13BV358A cells does not lead to aberrant Shh signal transduction.

In Arl13bhnn/hnn embryos and MEFs, cilia are shorter than normal and have a microtubule defect where the B-tubule of the microtubule outer doublet is open (Caspary et al., 2007; Larkins et al., 2011). Consistent with this, we observed shorter cilia in Arl13bV358A/V358A MEFs. Similarly, we observed a comparable reduction in the percent of cilia in Arl13bhnn/hnn and Arl13bV358A/V358A MEFs compared to wild type MEFs. While loss of ARL13B results in short cilia, increased expression of ARL13B promotes cilia elongation so it is not yet clear what ARL13B’s role is in controlling cilia length (Lu et al., 2015; Hori et al., 2008; Caspary et al., 2007; Larkins et al., 2011). Additionally, it is unclear whether the mechanism from within cilia through which ARL13B controls length or percent of ciliated cells is the same, or distinct from, the mechanism through which ARL13B regulates ARL3 or INPP5E residence in cilia.

Perhaps the most intriguing implication of our data pertains to understanding the evolution of cilia and Hh signaling. ARL13 functions in cilia formation and maintenance in Chlamydomonas and C. elegans, neither of which have Hh signaling, consistent with the ancient role of ARL13 controlling ciliation and cilia length (Cevik et al., 2010; Cevik et al., 2013; Stolc et al., 2005; Miertzschke et al., 2014). Our data support ARL13B retaining ARL13’s ancient role in ciliogenesis. However, our data show that ARL13B does not work from within the cilium to regulate Shh component ciliary traffic or Shh signal transduction. As an ARL protein involved in membrane traffic, we speculate that ARL13B may have linked Shh component trafficking to the primary cilium, albeit from outside the cilium. That the ARL13 duplication could relate to the mechanism linking primary cilia and Hh signaling within the deuterostome lineage is a possibility worth exploring.

Materials and methods

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Gene (M. musculus) Arl13b MGI Cat# 6115585, RRID:MGI:6115585
Genetic reagent (M. musculus) hennin PMID:17488627 MGI Cat# 3580673, RRID:MGI:3580673 Arl13b null allele
Genetic reagent (M. musculus) em1Tc (V358A) This paper MGI:
6256969
New CRISPR Point mutant
Genetic reagent (M. musculus) FBV/NJ Jackson Laboratory Stock #001800
MGI:2163709
Cell lines (M. musculus) Fibroblast (normal, embryonic) This paper Maintained in Caspary lab
Antibody Anti-Shh (Mouse Monoclonal) Developmental Studies Hybridoma Bank DSHB Cat# 5E1, RRID:AB_528466 1:5
Antibody Anti-Nkx2.2 (Mouse Monoclonal) Developmental Studies Hybridoma Bank DSHB Cat# 74.5A5, RRID:AB_531794 1:5
Antibody Anti-Hb9 (Mouse Monoclonal) Developmental Studies Hybridoma Bank DSHB Cat# 81.5C10, RRID:AB_2145209 1:5
Antibody Anti-Nkx6.1 (Mouse Monoclonal) Developmental Studies Hybridoma Bank DSHB Cat# F55A10, RRID:AB_532378 1:50
Antibody Anti-acetylated a-tubulin (Mouse Monoclonal) Millipore Sigma Sigma-Aldrich Cat# T6793, RRID:AB_477585 1:2500
Antibody Anti-Olig2 (Rabbit Polyclonal) Millipore Sigma Millipore Cat# AB9610, RRID:AB_570666 1:300
Antibody Anti-Arl13b (Mouse Monoclonal) NeuroMab UC Davis/NIH NeuroMab Facility Cat# 73–287, RRID:AB_11000053 1:1000
Antibody Anti-Arl13b (Rabbit Polyclonal Protein Tech Proteintech Cat# 17711–1-AP, RRID:AB_2060867 1:1000
Antibody Anti-Arl13b (Rabbit Polyclonal PMID:17488627 503 1:1000
Antibody Anti-Arl13b (Rabbit Polyclonal PMID:17488627 504 1:1000
Antibody Anti-Arl13b (Rabbit Polyclonal PMID:17488627 505 1:1000
Antibody Anti-Smo (Rabbit Polyclonal) K. Anderson 1:1000
Antibody Anti-IFT88 (Rabbit Polyclonal) B. Yoder 1:1000
Antibody Anti-Arl3 (Rabbit Polyclonal) PMID:8034651 1:1000
Antibody Anti-Inpp5e (Rabbit Polyclonal) Protein Tech Proteintech Cat# 17797–1-AP, RRID:AB_2167120 1:150
Antibody Anti-Gli2 (Guinea Pig Polyclonal) J. Eggenschwiler 1:200
Antibody Anti-Gli3 (Goat Polyclonal) R and D R and D Systems Cat# AF3690, RRID:AB_2232499 1:200
Antibody Anti-Ptch1 (Rabbit Polyclonal) R. Rohatgi 1:150
Antibody Anti-Sufu (Goat Polyclonal) Santa Cruz Santa Cruz Biotechnology Cat# sc-10933, RRID:AB_671172 1:100
Antibody Alexa Fluor goat anti-mouse IgG2a 488 ThermoFisher Thermo Fisher Scientific Cat# A-21131, RRID:AB_2535771 1:300
Antibody Alexa Fluor goat anti-mouse IgG1 488 ThermoFisher Thermo Fisher Scientific Cat# A-21121, RRID:AB_2535764 1:300
Antibody Alexa Fluor goat anti-mouse Ig 488 ThermoFisher Molecular Probes Cat# A-11029, RRID:AB_138404 1:300
Antibody Alexa Fluor goat anti-mouse IgG 568 ThermoFisher Thermo Fisher Scientific Cat# A-11031, RRID:AB_144696 1:300
Antibody Alexa Fluor donkey anti-rabbit IgG 488 ThermoFisher Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792 1:300
Antibody Alexa Fluor donkey anti-rabbit IgG 555 ThermoFisher Thermo Fisher Scientific Cat# A-31572, RRID:AB_162543 1:300
Antibody Alexa Fluor goat anti-rabbit IgG 568 ThermoFisher Thermo Fisher Scientific Cat# A-11011, RRID:AB_143157 1:300
Antibody Alexa Fluor goat anti-mouse IgG2b 568 ThermoFisher Thermo Fisher Scientific Cat# A-21147, RRID:AB_2535783 1:300
Antibody Hoechst nuclear stain Millipore Sigma 94403 1:3000
Sequence-based reagent CRISPR gRNA Millpore Sigma, this paper CCAGTCAATACAGACGAGTCTA
Sequence-based reagent CRISPR donor oligo Millpore Sigma, this paper CCTATATTCTTCTAGAAAACAGTAAGAAGAAAACCAAGAAACTACGAATGAAAAGGAGTCATCGGGCAGAACCAGTGAATACAGACGAGTCTACTCCAAAGAGTCCCACGCCTCCCCAAC
Sequence-based reagent F-231-Cac8I This Paper PCR Primer AAGAATGAAAAGGAGTCAGCG
Sequence-based reagent REV-1 This Paper PCR PrimerTGAACCGCTAATGGGAAACT
Peptide, recombinant protein Arl13bWT-GST This Paper Purified from cells
Peptide, recombinant protein Arl13bV358A-GST This Paper Purified from cells
Peptide, recombinant protein Arl3 (human) PMID:11303027 Purified from cells
Peptide, recombinant protein Cas9 Millipore Sigma C120010 50 μg
Peptide, recombinant protein Cac8I New England Biolabs R0579L Restriction enzyme
Chemical compound, drug Ciliobrevin-D Millipore Sigma 250401 30 μM
Chemical compound, drug [3H]GDP PerkinElmer Life Sciences NET966 3000 cpm/pmol
Chemical compound, drug GTPgS35 PerkinElmer Life Sciences NEG030H
Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) ImageJ, RRID:SCR_003070
Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) GraphPad Prism, RRID:SCR_002798 Version 8.0.0

Protein purification and ARL3 GEF assay

Plasmids directing the expression of mouse GST-ARL13B or GST-ARL13BV358A proteins were transiently transfected into HEK cells and the recombinant proteins were later purified by affinity chromatography using glutathione-Sepharose, as described previously (Cavenagh et al., 1994; Ivanova et al., 2017). Human ARL3 (98.4% identical to mouse ARL3) was expressed in BL21 bacteria and purified as previously described (Van Valkenburgh et al., 2001). The ARL3 GEF assay was performed as previously described (Ivanova et al., 2017). Briefly, ARL3 (10 µM) was pre-incubated with [3H]GDP (1 μM; PerkinElmer Life Sciences, specific activity ~3000 cpm/pmol) for 1 hour at 30°C in 25 mM HEPES, pH 7.4, 100 mM NaCl, 10 mM MgCl2. In contrast, pre-loading of ARL13B (10 μM) was achieved by incubation in 100 μM GTPγS for 1 minute at room temperature, due to its much more rapid exchange kinetics. The GEF assay was initiated upon addition of ARL3 (final = 1 µM), ARL13B (final = 0 or 1 μM), 10 μM GTPγS, and 100 μM GDP (to prevent re-binding of any released [3H]GDP), in a final volume of 100 µL. The intrinsic rate of GDP dissociation from ARL3 was determined in parallel as that released in the absence of any added ARL13B. The reactions were stopped at different times (0–15 minutes) by dilution of 10 μL of the reaction mixture into 2 ml of ice-cold buffer (20 mM Tris, pH 7.5, 100 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol). The amount of ARL3-bound [3H]GDP was determined by rapid filtration through BA85 nitrocellulose filters (0.45 μm, 25 mm, Whatman), with 3 × 2 mL washes, and quantified using liquid scintillation counting. Time points are routinely collected in at least duplicate and each experiment reported was repeated at least twice, yielding very similar results. Data were analyzed in GraphPad Prism 7 software.

Mouse allele generation and identification

All mice were cared for in accordance with NIH guidelines and Emory’s Institutional Animal Care and Use Committee (IACUC). Lines used were Arl13bV358A (Arl13bem1Tc) [MGI: 6256969], Arl13bhnn [MGI: 3578151] and FVB/NJ (Jackson Laboratory). To generate the V358A point mutation in the mouse, a CRISPR gRNA (CCAGTCAATACAGACGAGTCTA) targeting exon 8 of the Arl13b locus along with a donor oligo (5’-CCTATATTCTTCTAGAAAACAGTAAGAAGAAAACCAAGAAACTACGAATGAAAAGGAGTCATCGGGCAGAACCAGTGAATACAGACGAGTCTACTCCAAAGAGTCCCACGCCTCCCCAAC-3’; underlined bases are engineered) were designed to generate a T-to-C change creating the V358A point mutation and C-to-G change creating a TspRI restriction site that could be used for genotyping (Millipore Sigma). The gRNA (50 ng/μl), oligo donor (50 ng/μl) and CRISPR protein (100 ng/μL) were injected by the Emory Transgenic and Gene Targeting core into one-cell C57Bl/6J zygotes. Zygotes were cultured to 2 cell before being transferred to pseudopregnant females. Genomic tail DNA from resulting offspring was amplified using PCR primers (5’-GAAGCAGGCATGGTGGTAAT-3’ and 5’-TGAACCGCTAATGGGAAATC-3’) located upstream and downstream of the donor oligo breakpoints. The products were sequenced (5’-GAAGCAGGCATGGTGGTAAT-3’) and 2 animals were identified heterozygous for the desired change and with no additional editing. One line (#173) was bred to FVB/NJ for three generations prior to performing any phenotypic analysis. Males from at least two distinct meiotic recombination opportunities were used in each generation that to minimize potential confounds associated with off-target CRISPR/Cas9 editing.

Genotyping was performed on DNA extracted from ear punch or yolk sac via PCR using the following primers: Fwd: 5’- AAGAATGAAAAGGAGTCAGCG −3’, Rev: 5’- TGAACCGCTAATGGGAAACT −3’; a SNP was engineered in the forward primer that, in combination with the V358A mutation, created a Cac8I restriction site. Thus, the PCR product was digested with Cac8I enzyme, run out on a 4% agarose gel and the relevant bands were detected: undigested wild type (~192 bp) and digested mutant bands (~171 bp).

Phenotypic analysis of embryos

Timed matings of heterozygous intercrosses were performed to generate embryos of the indicated stage, with somite-matched pairs examined at each stage when appropriate. Embryos were dissected in cold phosphate-buffered saline and processed for immunofluorescence staining as previously described (Horner and Caspary, 2011).

Mouse embryonic fibroblasts

Mouse embryonic fibroblasts (MEFs) were isolated and immortalized as previously described Mariani et al. (2016). The identity of all cell lines were confirmed by genotyping PCR and tested mycoplasma negative. MEFs were maintained in DMEM with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37°C in 5% CO2. For experimental use, Arl13b+/+, Arl13bV358A/+, and Arl13bV358A/V358A and Arl13bhnn/hnn MEFs were grown on coverslips at a density of 0.5 × 106 cells/mL and treated for 24 hours with 0.5% FBS Shh conditioned media or 0.5% FBS media to induce ciliogenesis (Larkins et al., 2011).

Antibodies

Primary antibodies used were: mouse anti-Shh (5E1), mouse anti-Nkx2.2 (74.5A5), mouse anti-HB9 (81.5C10), mouse anti-Nkx6.1 (F55A10) (1:5 Developmental Studies Hybridoma Bank); rabbit anti-Olig2 (1:300 Millipore AB9610); mouse anti-acetylated α-tubulin (1:2500 Millipore Sigma; T6793), mouse anti-ARL13B (1:1000 NeuroMab N295B/66), rabbit anti-ARL13B (1:1000, Protein Tech 17711–1-AP); rabbit anti-ARL13B sera from three distinct rabbits (503, 504 and 505) (Caspary Lab Caspary et al., 2007), rabbit anti-Smoothened (1:1000, kindly provided by K. Anderson); rabbit anti-IFT88 (1:1000, kindly provided by B. Yoder); rabbit anti-ARL3 (1:1000, Cavenagh et al., 1994); rabbit anti-INPP5E (1:150, Protein Tech 17797–1-AP); guinea pig anti-Gli2 (1:200, kindly provided by J. Eggenschwiler); rabbit anti-Ptch1 (1:150, kindly provided by R. Rohatgi), goat anti-Sufu (1:100, SC10933, Santa Cruz); goat anti-Gli3 (1:200, R and D AF3690); Alexa Fluor 488 and Alexa Fluor 568 (1:300, ThermoFisher); and Hoechst nuclear stain (1:3000). In all depicted images the red channel is false colored as magenta for the benefit of readers.

Image quantification

Fluorescent intensities were measured in ImageJ software. Cilia were first identified by positive acetylated α-tubulin and an outline was hand drawn around the length of the cilium. The channel was switched to the protein of interest and a measurement of the average fluorescent intensity was acquired. The same outline was then used to acquire a background reading of the cell-body that most closely matched the background at the cilium. In all cases immunofluorescent averages of proteins of interest in cilia were normalized to cell-body intensities (Figure 2—figure supplement 2). For samples with antibodies targeting Gli2, Gli3, and Sufu the ciliary tip was isolated and measured. The cilia tip was identified by weak acetylated α-tubulin staining or the cilium base was identified by the presence of the acetylated α-tubulin positive fibrils in the cell body that cluster at the base of the cilium (Larkins et al., 2011). For samples with antibodies targeting Smo, Ptch1, ARL3, and INPP5E the entire cilium was measured. We plotted the ratio of fluorescence intensity of the protein of interest to the cell body background as violin plots. Within each plot the dashed lines represent the median and interquartile range. The number of cilia examined per genotype and per condition are listed below their respective plot. All data, except for Smo which varied both genotype and treatment, were analyzed by one-way ANOVA. In the event of a significant ANOVA, Tukey’s multiple comparisons were employed to determine significance as all groups were compared. Smo fluorescent intensity data were analyzed by two-way ANOVA. As only specific groups were compared, the significance of those comparisons across and between groups were made using Sidak’s post-hoc to not inflate the significance of those comparisons Data were analyzed in GraphPad Prism 7 software.

In a similar experiment, retrograde IFT was inhibited by the addition of 30 µM ciliobrevin-D (Millipore Sigma; 250401) or 0.1% DMSO control in low-serum media for 60 minutes after ciliation was induced by serum starvation for 24 hours prior with 0.5% FBS media. Cilia were identified by staining with antibodies directed against acetylated α-tubulin, IFT88, and ARL13B. Fluorescent intensities were measured in ImageJ software. Again, cilia were first identified by positive acetylated α-tubulin and an outline was hand drawn. The channel was switched to the protein of interest and a measurement of the average fluorescent intensity was acquired. The same outline was then used to acquire a background reading of the cell-body. To measure IFT88, the cilia tip was identified by weak acetylated α-tubulin staining or the cilium base was identified by the presence of acetylated α-tubulin fibrils in the cell body that cluster at the base of the cilium (Larkins et al., 2011). To make comparisons among cell lines of distinct genotype with and without ciliobrevin-D treatment, data were analyzed by two-way ANOVA. To analyze the specific differences across groups, multiple comparisons were made using Sidak’s post-hoc.

Western blots

Western blotting was performed as previously described Mariani et al. (2016), with antibody against ARL13B (1:1000 Neuromab N295B/66). Lysates were prepared with RIPA buffer and SigmaFast protease inhibitors (Nachtergaele et al., 2013). Values presented as volume intensity measured by chemiluminescence detected on ChemiDoc Touch Imaging System were normalized to total protein as measured on a stain-free gel (Thacker et al., 2016; Rivero-Gutiérrez et al., 2014). Normalized values were analyzed by one-way ANOVA and Tukey’s multiple comparisons. Data were analyzed in GraphPad Prism 7 software.

Acknowledgements

This work was supported by funding from NIH grants R01NS090029 and R35GM122549 to TC and R35GM122568 to RAK. EDG was supported by NIH training grant T32NS096050 and a diversity supplement to R01NS090029. Further support came from the Emory Integrated Mouse Transgenic and Gene Targeting Core, which is subsidized by the Emory University School of Medicine and with support by the Georgia Clinical and Translational Science Alliance of the National Institutes of Health under Award Number UL1TR002378 as well as the Emory University Integrated Cellular Imaging Microscopy Core of the Emory Neuroscience NINDS Core Facilities grant, P30NS055077. We are grateful to Alyssa Long and Sarah Suciu for sequencing potential CRISPR founders, and to members of the Caspary lab for discussion and manuscript comments.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Tamara Caspary, Email: tcaspar@emory.edu.

Jeremy F Reiter, University of California, San Francisco, United States.

Anna Akhmanova, Utrecht University, Netherlands.

Funding Information

This paper was supported by the following grants:

  • National Institute of Neurological Disorders and Stroke R01NS090029 to Tamara Caspary.

  • National Institute of General Medical Sciences R35GM122549 to Tamara Caspary.

  • National Institute of General Medical Sciences R35GM122568 to Richard A Kahn.

  • National Institute of Neurological Disorders and Stroke T32NS096050 to Eduardo D Gigante.

  • National Institute of Neurological Disorders and Stroke F31 NS106755 to Eduardo D Gigante.

Additional information

Competing interests

No competing interests declared.

Author contributions

Formal analysis, Validation, Investigation, Visualization, Methodology.

Formal analysis, Investigation.

Formal analysis, Validation, Investigation, Visualization.

Supervision, Funding acquisition, Visualization, Methodology.

Conceptualization, Supervision, Funding acquisition, Project administration.

Ethics

Animal experimentation: All mice were cared for in accordance with NIH guidelines and Emory's Institutional Animal Care and Use Committee (IACUC) under protocols DAR-2003545-072919N and PROTO201700587.

Additional files

Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

  1. Aza-Blanc P, Lin HY, Ruiz i Altaba A, Kornberg TB. 'Expression of the vertebrate Gli proteins inDrosophilareveals a distribution of activator and repressor activities'. Development. 2000;127:4293–4301. doi: 10.1242/dev.127.19.4293. [DOI] [PubMed] [Google Scholar]
  2. Bangs FK, Schrode N, Hadjantonakis AK, Anderson KV. Lineage specificity of primary cilia in the mouse embryo. Nature Cell Biology. 2015;17:113–122. doi: 10.1038/ncb3091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barral DC, Garg S, Casalou C, Watts GF, Sandoval JL, Ramalho JS, Hsu VW, Brenner MB. Arl13b regulates endocytic recycling traffic. PNAS. 2012;109:21354–21359. doi: 10.1073/pnas.1218272110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bay SN, Long AB, Caspary T. Disruption of the ciliary GTPase Arl13b suppresses sonic hedgehog overactivation and inhibits medulloblastoma formation. PNAS. 2018;115:1570–1575. doi: 10.1073/pnas.1706977115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Briscoe J, Chen Y, Jessell TM, Struhl G. A hedgehog-insensitive form of patched provides evidence for direct long-range morphogen activity of sonic hedgehog in the neural tube. Molecular Cell. 2001;7:1279–1291. doi: 10.1016/S1097-2765(01)00271-4. [DOI] [PubMed] [Google Scholar]
  6. Briscoe J, Thérond PP. The mechanisms of hedgehog signalling and its roles in development and disease. Nature Reviews Molecular Cell Biology. 2013;14:416–429. doi: 10.1038/nrm3598. [DOI] [PubMed] [Google Scholar]
  7. Casalou C, Seixas C, Portelinha A, Pintado P, Barros M, Ramalho JS, Lopes SS, Barral DC. Arl13b and the non-muscle myosin heavy chain IIA are required for circular dorsal ruffle formation and cell migration. Journal of Cell Science. 2014;127:2709–2722. doi: 10.1242/jcs.143446. [DOI] [PubMed] [Google Scholar]
  8. Caspary T, Larkins CE, Anderson KV. The graded response to sonic hedgehog depends on cilia architecture. Developmental Cell. 2007;12:767–778. doi: 10.1016/j.devcel.2007.03.004. [DOI] [PubMed] [Google Scholar]
  9. Cavenagh MM, Breiner M, Schurmann A, Rosenwald AG, Terui T, Zhang C, Randazzo PA, Adams M, Joost HG, Kahn RA. 'ADP-ribosylation factor (ARF)-like 3, a new member of the ARF family of GTP-binding proteins cloned from human and rat tissues'. The Journal of Biological Chemistry. 1994;269:18937–18942. [PubMed] [Google Scholar]
  10. Cevik S, Hori Y, Kaplan OI, Kida K, Toivenon T, Foley-Fisher C, Cottell D, Katada T, Kontani K, Blacque OE. Joubert syndrome Arl13b functions at ciliary membranes and stabilizes protein transport in Caenorhabditis elegans. The Journal of Cell Biology. 2010;188:953–969. doi: 10.1083/jcb.200908133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE. Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain. PLOS Genetics. 2013;9:e1003977. doi: 10.1371/journal.pgen.1003977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chávez M, Ena S, Van Sande J, de Kerchove d'Exaerde A, Schurmans S, Schiffmann SN. Modulation of ciliary phosphoinositide content regulates trafficking and sonic hedgehog signaling output. Developmental Cell. 2015;34:338–350. doi: 10.1016/j.devcel.2015.06.016. [DOI] [PubMed] [Google Scholar]
  13. Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H, Beachy PA. Cyclopia and defective axial patterning in mice lacking sonic hedgehog gene function. Nature. 1996;383:407–413. doi: 10.1038/383407a0. [DOI] [PubMed] [Google Scholar]
  14. Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF. Vertebrate smoothened functions at the primary cilium. Nature. 2005;437:1018–1021. doi: 10.1038/nature04117. [DOI] [PubMed] [Google Scholar]
  15. Cortellino S, Wang C, Wang B, Bassi MR, Caretti E, Champeval D, Calmont A, Jarnik M, Burch J, Zaret KS, Larue L, Bellacosa A. Defective ciliogenesis, embryonic lethality and severe impairment of the sonic hedgehog pathway caused by inactivation of the mouse complex A intraflagellar transport gene Ift122/Wdr10, partially overlapping with the DNA repair gene Med1/Mbd4. Developmental Biology. 2009;325:225–237. doi: 10.1016/j.ydbio.2008.10.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. D'Souza-Schorey C, Chavrier P. ARF proteins: roles in membrane traffic and beyond. Nature Reviews Molecular Cell Biology. 2006;7:347–358. doi: 10.1038/nrm1910. [DOI] [PubMed] [Google Scholar]
  17. Dessaud E, Yang LL, Hill K, Cox B, Ulloa F, Ribeiro A, Mynett A, Novitch BG, Briscoe J. Interpretation of the sonic hedgehog morphogen gradient by a temporal adaptation mechanism. Nature. 2007;450:717–720. doi: 10.1038/nature06347. [DOI] [PubMed] [Google Scholar]
  18. Dyson JM, Conduit SE, Feeney SJ, Hakim S, DiTommaso T, Fulcher AJ, Sriratana A, Ramm G, Horan KA, Gurung R, Wicking C, Smyth I, Mitchell CA. INPP5E regulates phosphoinositide-dependent cilia transition zone function. The Journal of Cell Biology. 2017;216:247–263. doi: 10.1083/jcb.201511055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. East MP, Bowzard JB, Dacks JB, Kahn RA. ELMO domains, evolutionary and functional characterization of a novel GTPase-activating protein (GAP) domain for arf protein family GTPases. Journal of Biological Chemistry. 2012;287:39538–39553. doi: 10.1074/jbc.M112.417477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Firestone AJ, Weinger JS, Maldonado M, Barlan K, Langston LD, O'Donnell M, Gelfand VI, Kapoor TM, Chen JK. Small-molecule inhibitors of the AAA+ ATPase motor cytoplasmic dynein. Nature. 2012;484:125–129. doi: 10.1038/nature10936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Garcia-Gonzalo FR, Phua SC, Roberson EC, Garcia G, Abedin M, Schurmans S, Inoue T, Reiter JF. Phosphoinositides regulate ciliary protein trafficking to modulate hedgehog signaling. Developmental Cell. 2015;34:400–409. doi: 10.1016/j.devcel.2015.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Goetz SC, Ocbina PJ, Anderson KV. The primary cilium as a hedgehog signal transduction machine. Methods in Cell Biology. 2009;94:199–222. doi: 10.1016/S0091-679X(08)94010-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gotthardt K, Lokaj M, Koerner C, Falk N, Gießl A, Wittinghofer A. A G-protein activation cascade from Arl13B to Arl3 and implications for ciliary targeting of lipidated proteins. eLife. 2015;4:e11859. doi: 10.7554/eLife.11859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hanke-Gogokhia C, Wu Z, Gerstner CD, Frederick JM, Zhang H, Baehr W. Arf-like protein 3 (ARL3) Regulates protein trafficking and ciliogenesis in mouse photoreceptors. Journal of Biological Chemistry. 2016;291:7142–7155. doi: 10.1074/jbc.M115.710954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Haycraft CJ, Banizs B, Aydin-Son Y, Zhang Q, Michaud EJ, Yoder BK. Gli2 and Gli3 localize to cilia and require the intraflagellar transport protein polaris for processing and function. PLOS Genetics. 2005;1:e53. doi: 10.1371/journal.pgen.0010053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Higginbotham H, Eom TY, Mariani LE, Bachleda A, Hirt J, Gukassyan V, Cusack CL, Lai C, Caspary T, Anton ES. Arl13b in primary cilia regulates the migration and placement of interneurons in the developing cerebral cortex. Developmental Cell. 2012;23:925–938. doi: 10.1016/j.devcel.2012.09.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hori Y, Kobayashi T, Kikko Y, Kontani K, Katada T. Domain architecture of the atypical Arf-family GTPase Arl13b involved in cilia formation. Biochemical and Biophysical Research Communications. 2008;373:119–124. doi: 10.1016/j.bbrc.2008.06.001. [DOI] [PubMed] [Google Scholar]
  28. Horner VL, Caspary T. Disrupted dorsal neural tube BMP signaling in the cilia mutant Arl13b hnn stems from abnormal shh signaling. Developmental Biology. 2011;355:43–54. doi: 10.1016/j.ydbio.2011.04.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Houde C, Dickinson RJ, Houtzager VM, Cullum R, Montpetit R, Metzler M, Simpson EM, Roy S, Hayden MR, Hoodless PA, Nicholson DW. Hippi is essential for node cilia assembly and sonic hedgehog signaling. Developmental Biology. 2006;300:523–533. doi: 10.1016/j.ydbio.2006.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Huangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV. Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature. 2003;426:83–87. doi: 10.1038/nature02061. [DOI] [PubMed] [Google Scholar]
  31. Huangfu D, Anderson KV. Cilia and hedgehog responsiveness in the mouse. PNAS. 2005;102:11325–11330. doi: 10.1073/pnas.0505328102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Huangfu D, Anderson KV. Signaling from smo to ci/Gli: conservation and divergence of hedgehog pathways from Drosophila to vertebrates. Development. 2006;133:3–14. doi: 10.1242/dev.02169. [DOI] [PubMed] [Google Scholar]
  33. Humbert MC, Weihbrecht K, Searby CC, Li Y, Pope RM, Sheffield VC, Seo S. ARL13B, PDE6D, and CEP164 form a functional network for INPP5E ciliary targeting. PNAS. 2012;109:19691–19696. doi: 10.1073/pnas.1210916109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Humke EW, Dorn KV, Milenkovic L, Scott MP, Rohatgi R. The output of hedgehog signaling is controlled by the dynamic association between suppressor of fused and the gli proteins. Genes & Development. 2010;24:670–682. doi: 10.1101/gad.1902910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Ingham PW, Nakano Y, Seger C. Mechanisms and functions of hedgehog signalling across the metazoa. Nature Reviews Genetics. 2011;12:393–406. doi: 10.1038/nrg2984. [DOI] [PubMed] [Google Scholar]
  36. Ivanova AA, Caspary T, Seyfried NT, Duong DM, West AB, Liu Z, Kahn RA. Biochemical characterization of purified mammalian ARL13B protein indicates that it is an atypical GTPase and ARL3 guanine nucleotide exchange factor (GEF) Journal of Biological Chemistry. 2017;292:11091–11108. doi: 10.1074/jbc.M117.784025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kahn RA, Bruford E, Inoue H, Logsdon JM, Nie Z, Premont RT, Randazzo PA, Satake M, Theibert AB, Zapp ML, Cassel D. Consensus nomenclature for the human ArfGAP domain-containing proteins. The Journal of Cell Biology. 2008;182:1039–1044. doi: 10.1083/jcb.200806041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kim J, Kato M, Beachy PA. Gli2 trafficking links Hedgehog-dependent activation of smoothened in the primary cilium to transcriptional activation in the nucleus. PNAS. 2009;106:21666–21671. doi: 10.1073/pnas.0912180106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Kong JH, Siebold C, Rohatgi R. Biochemical mechanisms of vertebrate hedgehog signaling. Development. 2019;146:dev166892. doi: 10.1242/dev.166892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Kuwabara PE, Lee MH, Schedl T, Jefferis GS. A C. elegans patched gene, ptc-1, functions in germ-line cytokinesis. Genes & Development. 2000;14:1933–1944. [PMC free article] [PubMed] [Google Scholar]
  41. Larkins CE, Aviles GD, East MP, Kahn RA, Caspary T. Arl13b regulates ciliogenesis and the dynamic localization of shh signaling proteins. Molecular Biology of the Cell. 2011;22:4694–4703. doi: 10.1091/mbc.e10-12-0994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Li Y, Kelly WG, Logsdon JM, Schurko AM, Harfe BD, Hill-Harfe KL, Kahn RA. Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans. The FASEB Journal. 2004;18:1834–1850. doi: 10.1096/fj.04-2273com. [DOI] [PubMed] [Google Scholar]
  43. Li Y, Wei Q, Zhang Y, Ling K, Hu J. The small GTPases ARL-13 and ARL-3 coordinate intraflagellar transport and ciliogenesis. The Journal of Cell Biology. 2010;189:1039–1051. doi: 10.1083/jcb.200912001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Liem KF, He M, Ocbina PJ, Anderson KV. Mouse Kif7/Costal2 is a cilia-associated protein that regulates sonic hedgehog signaling. PNAS. 2009;106:13377–13382. doi: 10.1073/pnas.0906944106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Liem KF, Ashe A, He M, Satir P, Moran J, Beier D, Wicking C, Anderson KV. The IFT-A complex regulates shh signaling through cilia structure and membrane protein trafficking. The Journal of Cell Biology. 2012;197:789–800. doi: 10.1083/jcb.201110049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Lim YS, Chua CE, Tang BL. Rabs and other small GTPases in ciliary transport. Biology of the Cell. 2011;103:209–221. doi: 10.1042/BC20100150. [DOI] [PubMed] [Google Scholar]
  47. Liu A, Wang B, Niswander LA. Mouse intraflagellar transport proteins regulate both the activator and repressor functions of gli transcription factors. Development. 2005;132:3103–3111. doi: 10.1242/dev.01894. [DOI] [PubMed] [Google Scholar]
  48. Logsdon JM. In: Arf Family GTPases. Kahn R. A, editor. Springer Nature; 2004. [DOI] [Google Scholar]
  49. Lu H, Toh MT, Narasimhan V, Thamilselvam SK, Choksi SP, Roy S. A function for the Joubert syndrome protein Arl13b in ciliary membrane extension and ciliary length regulation. Developmental Biology. 2015;397:225–236. doi: 10.1016/j.ydbio.2014.11.009. [DOI] [PubMed] [Google Scholar]
  50. Mariani LE, Bijlsma MF, Ivanova AA, Suciu SK, Kahn RA, Caspary T. Arl13b regulates shh signaling from both inside and outside the cilium. Molecular Biology of the Cell. 2016;27:3780–3790. doi: 10.1091/mbc.e16-03-0189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Miertzschke M, Koerner C, Spoerner M, Wittinghofer A. Structural insights into the small G-protein Arl13B and implications for Joubert syndrome. Biochemical Journal. 2014;457:301–311. doi: 10.1042/BJ20131097. [DOI] [PubMed] [Google Scholar]
  52. Milenkovic L, Scott MP, Rohatgi R. Lateral transport of smoothened from the plasma membrane to the membrane of the cilium. The Journal of Cell Biology. 2009;187:365–374. doi: 10.1083/jcb.200907126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Murdoch JN, Copp AJ. The relationship between sonic hedgehog signaling, cilia, and neural tube defects. Birth Defects Research Part A: Clinical and Molecular Teratology. 2010;88:633–652. doi: 10.1002/bdra.20686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Murray SA, Morgan JL, Kane C, Sharma Y, Heffner CS, Lake J, Donahue LR. Mouse gestation length is genetically determined. PLOS ONE. 2010;5:e12418. doi: 10.1371/journal.pone.0012418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Nachtergaele S, Whalen DM, Mydock LK, Zhao Z, Malinauskas T, Krishnan K, Ingham PW, Covey DF, Siebold C, Rohatgi R. Structure and function of the smoothened extracellular domain in vertebrate hedgehog signaling. eLife. 2013;2:e01340. doi: 10.7554/eLife.01340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Nozaki S, Katoh Y, Terada M, Michisaka S, Funabashi T, Takahashi S, Kontani K, Nakayama K. Regulation of ciliary retrograde protein trafficking by the joubert syndrome proteins ARL13B and INPP5E. Journal of Cell Science. 2017;130:563–576. doi: 10.1242/jcs.197004. [DOI] [PubMed] [Google Scholar]
  57. Nüsslein-Volhard C, Wieschaus E. Mutations affecting segment number and polarity in Drosophila. Nature. 1980;287:795–801. doi: 10.1038/287795a0. [DOI] [PubMed] [Google Scholar]
  58. Placzek M, Briscoe J. Sonic hedgehog in vertebrate neural tube development. The International Journal of Developmental Biology. 2018;62:225–234. doi: 10.1387/ijdb.170293jb. [DOI] [PubMed] [Google Scholar]
  59. Raleigh DR, Reiter JF. Misactivation of hedgehog signaling causes inherited and sporadic cancers. Journal of Clinical Investigation. 2019;129:465–475. doi: 10.1172/JCI120850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Revenkova E, Liu Q, Gusella GL, Iomini C. The joubert syndrome protein ARL13B binds tubulin to maintain uniform distribution of proteins along the ciliary membrane. Journal of Cell Science. 2018;131:jcs212324. doi: 10.1242/jcs.212324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Rink JC, Gurley KA, Elliott SA, Sánchez Alvarado A. Planarian hh signaling regulates regeneration polarity and links hh pathway evolution to cilia. Science. 2009;326:1406–1410. doi: 10.1126/science.1178712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Rivero-Gutiérrez B, Anzola A, Martínez-Augustin O, de Medina FS. Stain-free detection as loading control alternative to ponceau and housekeeping protein immunodetection in western blotting. Analytical Biochemistry. 2014;467:1–3. doi: 10.1016/j.ab.2014.08.027. [DOI] [PubMed] [Google Scholar]
  63. Roelink H, Augsburger A, Heemskerk J, Korzh V, Norlin S, Ruiz i Altaba A, Tanabe Y, Placzek M, Edlund T, Jessell TM. Floor plate and motor neuron induction by vhh-1, a vertebrate homolog of hedgehog expressed by the notochord. Cell. 1994;76:761–775. doi: 10.1016/0092-8674(94)90514-2. [DOI] [PubMed] [Google Scholar]
  64. Rohatgi R, Milenkovic L, Scott MP. Patched1 regulates hedgehog signaling at the primary cilium. Science. 2007;317:372–376. doi: 10.1126/science.1139740. [DOI] [PubMed] [Google Scholar]
  65. Roy S. Cilia and hedgehog: when and how was their marriage solemnized? Differentiation. 2012;83:S43–S48. doi: 10.1016/j.diff.2011.11.010. [DOI] [PubMed] [Google Scholar]
  66. Ruiz i Altaba A. 'Combinatorial Gli gene function in floor plate and neuronal inductions by Sonic hedgehog'. Development. 1998;125:2203–2212. doi: 10.1242/dev.125.12.2203. [DOI] [PubMed] [Google Scholar]
  67. Schlacht A, Mowbrey K, Elias M, Kahn RA, Dacks JB. Ancient complexity, opisthokont plasticity, and discovery of the 11th subfamily of arf GAP proteins. Traffic. 2013;14:636–649. doi: 10.1111/tra.12063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Seixas C, Choi SY, Polgar N, Umberger NL, East MP, Zuo X, Moreiras H, Ghossoub R, Benmerah A, Kahn RA, Fogelgren B, Caspary T, Lipschutz JH, Barral DC. Arl13b and the exocyst interact synergistically in ciliogenesis. Molecular Biology of the Cell. 2016;27:308–320. doi: 10.1091/mbc.e15-02-0061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Sigg MA, Menchen T, Lee C, Johnson J, Jungnickel MK, Choksi SP, Garcia G, Busengdal H, Dougherty GW, Pennekamp P, Werner C, Rentzsch F, Florman HM, Krogan N, Wallingford JB, Omran H, Reiter JF. Evolutionary proteomics uncovers ancient associations of cilia with signaling pathways. Developmental Cell. 2017;43:744–762. doi: 10.1016/j.devcel.2017.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Stolc V, Samanta MP, Tongprasit W, Marshall WF. Genome-wide transcriptional analysis of flagellar regeneration in Chlamydomonas reinhardtii identifies orthologs of ciliary disease genes. PNAS. 2005;102:3703–3707. doi: 10.1073/pnas.0408358102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Sztul E, Chen PW, Casanova JE, Cherfils J, Dacks JB, Lambright DG, Lee FS, Randazzo PA, Santy LC, Schürmann A, Wilhelmi I, Yohe ME, Kahn RA. ARF GTPases and their GEFs and GAPs: concepts and challenges. Molecular Biology of the Cell. 2019;30:1249–1271. doi: 10.1091/mbc.E18-12-0820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Taylor SP, Dantas TJ, Duran I, Wu S, Lachman RS, Nelson SF, Cohn DH, Vallee RB, Krakow D, University of Washington Center for Mendelian Genomics Consortium Mutations in DYNC2LI1 disrupt cilia function and cause short rib polydactyly syndrome. Nature Communications. 2015;6:7092. doi: 10.1038/ncomms8092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Thacker JS, Yeung DH, Staines WR, Mielke JG. Total protein or high-abundance protein: which offers the best loading control for western blotting? Analytical Biochemistry. 2016;496:76–78. doi: 10.1016/j.ab.2015.11.022. [DOI] [PubMed] [Google Scholar]
  74. The C. elegans Sequencing Consortium Genome sequence of the nematode C. elegans: A Platform for Investigating Biology. Science. 1998;282:2012–2018. doi: 10.1126/science.282.5396.2012. [DOI] [PubMed] [Google Scholar]
  75. Tran PV, Haycraft CJ, Besschetnova TY, Turbe-Doan A, Stottmann RW, Herron BJ, Chesebro AL, Qiu H, Scherz PJ, Shah JV, Yoder BK, Beier DR. THM1 negatively modulates mouse sonic hedgehog signal transduction and affects retrograde intraflagellar transport in cilia. Nature Genetics. 2008;40:403–410. doi: 10.1038/ng.105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Tuz K, Bachmann-Gagescu R, O'Day DR, Hua K, Isabella CR, Phelps IG, Stolarski AE, O'Roak BJ, Dempsey JC, Lourenco C, Alswaid A, Bönnemann CG, Medne L, Nampoothiri S, Stark Z, Leventer RJ, Topçu M, Cansu A, Jagadeesh S, Done S, Ishak GE, Glass IA, Shendure J, Neuhauss SC, Haldeman-Englert CR, Doherty D, Ferland RJ. Mutations in CSPP1 cause primary cilia abnormalities and Joubert syndrome with or without jeune asphyxiating thoracic dystrophy. The American Journal of Human Genetics. 2014;94:62–72. doi: 10.1016/j.ajhg.2013.11.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Van Valkenburgh H, Shern JF, Sharer JD, Zhu X, Kahn RA. ADP-ribosylation factors (ARFs) and ARF-like 1 (ARL1) have both specific and shared effectors: characterizing ARL1-binding proteins. The Journal of Biological Chemistry. 2001;276:22826–22837. doi: 10.1074/jbc.M102359200. [DOI] [PubMed] [Google Scholar]
  78. Wang Y, Zhou Z, Walsh CT, McMahon AP. Selective translocation of intracellular smoothened to the primary cilium in response to hedgehog pathway modulation. PNAS. 2009;106:2623–2628. doi: 10.1073/pnas.0812110106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Warner JF, McCarthy AM, Morris RL, McClay DR. Hedgehog signaling requires motile cilia in the sea urchin. Molecular Biology and Evolution. 2014;31:18–22. doi: 10.1093/molbev/mst176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Wen X, Lai CK, Evangelista M, Hongo JA, de Sauvage FJ, Scales SJ. Kinetics of hedgehog-dependent full-length Gli3 accumulation in primary cilia and subsequent degradation. Molecular and Cellular Biology. 2010;30:1910–1922. doi: 10.1128/MCB.01089-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Zhang Q, Li Y, Zhang Y, Torres VE, Harris PC, Ling K, Hu J. GTP-binding of ARL-3 is activated by ARL-13 as a GEF and stabilized by UNC-119. Scientific Reports. 2016;6:24534. doi: 10.1038/srep24534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Zugasti O, Rajan J, Kuwabara PE. The function and expansion of the patched- and Hedgehog-related homologs in C. elegans. Genome Research. 2005;15:1402–1410. doi: 10.1101/gr.3935405. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Jeremy F Reiter1

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Thank you for submitting your article "ARL13B regulates Sonic Hedgehog signaling from outside primary cilia" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Anna Akhmanova as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

This work builds on Mariani et al., 2016 which demonstrated that restricting Arl13b from localizing to cilia does not interfere with Hh signaling, but does interfere with Shh-stimulated chemotaxis. The previous work demonstrated that Arl13b-GFP mutants R200C and V358A do not localize in cilia, but are able to support normal Hh responses and SMO localization to cilia. The R200C mutant, as described by Nozaki et al., 2016, could be detected inside cilia (Figure 3F). The major advance in this manuscript is the creation and phenotypic analysis of a mouse Arl13bV358A allele. V358A excludes, as much as is measurable, ARL13B protein from the cilia. This work is a bit unusual in that the advances are based on negative results (absence of phenotypes and absence of localization).

Essential revisions:

Surprisingly, mice homozygous for the Arl13bV358A allele do not display overt developmental defects, suggesting that Arl13b functions outside the cilium to promote Hh signaling. The authors conclude in their title: "Arl13b regulates Sonic Hedgehog signaling from outside primary cilia." The major limitation to their conclusions is that a small amount of ARL13B may be in cilia and that is sufficient for SHH function and, as the authors acknowledge elsewhere in the manuscript, "It is formally possible that an extremely small amount of Arl13bV358A remains in cilia." As I'm sure the authors also realize, demonstrating that a protein does not localize to or function within a subdomain of the cell, especially an enzymatic protein that may operate at substoichiometric levels, is difficult. Although the expression level of Arl13bV358A appears to be only slightly reduced compared to Wt Arl13b, it is concerning that no Arl13B signal could be detected anywhere in neural tube of V358A/V358A embryos (Figure 2C). This raises the concern that the antibodies used do not sensitively detect Arl13bV358A. To make claims that Arl13bV358A does not function in the cilium, the authors should use an orthogonal approach, such as tethering wild type Arl13b outside the cilium in the null MEFs, to assess whether it can operate outside the cilium. Additionally, it would be good to provide some estimate of the lowest level of detectable protein in the cilium to provide a statement indicating that only if "x" percentage of ARL13B were ciliary and sufficient for SHH signaling, then the conclusions would not be valid.

Figure 1 is not sufficiently interpretable in its present form. In the present data, the kinetics of ARL3 GEF activity by wild type or V358A reaches maximum activity ~40 seconds into the time course. By adding excessive protein, the reaction is too rapid to show any quantitative differences in the activity of the wild type and mutant proteins. This experiment, as currently presented, shows that the mutant protein does have some activity, but could mask a 10-fold lower activity than wild type. The argument that the mutation is outside the homology defining the catalytic domain and thus unlikely to function only for targeting ignores the possibility of interdomain allostery/regulation, which is found in many small GTPases. For example, the C-terminus could fold over and inhibit the GTPase domain when engaged with its trafficking machinery, and this inhibition would be relieved to activate the GTPase when properly localized. The authors should compare various concentrations of wild type and mutant protein to see if the kinetic profiles are separable at lower concentrations.

The other source for the claim that Arl13bV358A cannot localize to cilia is the finding that ciliobrevin-D, a dynein inhibitor, does not cause the ciliary accumulation of Arl13bV358A. It appears that ciliobrevin D treatment may not be efficiently blocking retrograde IFT as the increase of IFT88 in the majority of the ciliobrevin D-treated cells is subtle. Moreover, it is not clear that all ciliary proteins leave cilia in a dynein-dependent way. Nor is it clear that dynein is functional inside cilia of cells expressing Arl13bV358A as Arl3 localization is decreased and Arl3 is important for dynactin and cargo unloading from dynein (Jin et al., Nature Communications 2014). Some of these limitations should be included in the Discussion.

The authors demonstrate that Arl3 localization is compromised in Arl13bV358A-expressing mice. As Arl3 is thought to function at cilia, the prediction is that Arl13bV358A mice would possess phenotypes similar to Arl3 loss of function. The authors do a nice job of assessing Hh-associated phenotypes. Do the mutant homozygous mice possess Arl3-associated phenotypes such as renal cysts and retinal degeneration? If not, do the authors propose that Arl3 also functions outside of the cilium?

eLife. 2020 Mar 4;9:e50434. doi: 10.7554/eLife.50434.sa2

Author response


Essential revisions:Surprisingly, mice homozygous for the Arl13bV358A allele do not display overt developmental defects, suggesting that Arl13b functions outside the cilium to promote Hh signaling. The authors conclude in their title: "Arl13b regulates Sonic Hedgehog signaling from outside primary cilia." The major limitation to their conclusions is that a small amount of ARL13B may be in cilia and that is sufficient for SHH function and, as the authors acknowledge elsewhere in the manuscript, "It is formally possible that an extremely small amount of Arl13bV358A remains in cilia." As I'm sure the authors also realize, demonstrating that a protein does not localize to or function within a subdomain of the cell, especially an enzymatic protein that may operate at substoichiometric levels, is difficult. Although the expression level of Arl13bV358A appears to be only slightly reduced compared to Wt Arl13b, it is concerning that no Arl13B signal could be detected anywhere in neural tube of V358A/V358A embryos (Figure 2C). This raises the concern that the antibodies used do not sensitively detect Arl13bV358A.

We appreciate the reviewers’ recognition that we acknowledge subdetectable amounts of ARL13B may be present in Arl13bV358A/V358Acilia. As to the concern regarding ARL13B signal in the neural tube, we guide the reviewers to the overexposed images of neural tubes stained for ARL13B and IFT88 in Figure 2—figure supplement 1. Upon overexposure, where the cilia staining of wildtype cells is saturated, we do observe cell body staining in Arl13bV358A/V358Aneural tube that is above background levels detected in Arl13bhnn neural tube. We note that we do not detect any ARL13B in cilia in these images. In the images to which the reviewer refers in Figure 2, we calibrated to avoid saturation of the cilia in Arl13b+/+ and Arl13bV358A/+samples. Therefore, we acquired the Arl13bV358A/V358Aneural tube images under the same exposure parameters and conditions.

These data suggest that the cellular pool of ARL13B is difficult to detect. To explore this further, we examined ARL13B and acetylated a tubulin staining in IFT172wim MEFs which lack cilia. As controls we used wildtype, Arl13bhnn (lacking ARL13B), and IFT172wim Arl13bhnn (lacking ARL13B and cilia) MEFs. As expected, we found acetylated a tubulin stained cilia only in wildtype and Arl13bhnn MEFs, and no ARL13B positive cilia in Arl13bhnn cells. Like in the neural tube, we took pictures using exposure levels that avoided saturation of the ARL13B channel (which we call normal exposure) and at 4X the normal exposure level, where the ARL13B channel is saturated in the cilium (which we call 4X or over exposed). At normal exposure, we do not detect signal above background staining in the cell body of wildtype, IFT172wim, Arl13bhnn, and IFT172wim Arl13bhnn cells. At 4X exposure, we observe ARL13B throughout the cytoplasm of wildtype and IFT172wim cells, the signal is modestly higher than the background level that we detect in Arl13bhnn and IFT172wim Arl13bhnn controls. Taken together, these data indicate that cellular ARL13B is just at the cusp of being detectable- but is present. We modified the text to reflect these points and added the MEF data as Figure 2—figure supplement 2.

To make claims that Arl13bV358A does not function in the cilium, the authors should use an orthogonal approach, such as tethering wild type Arl13b outside the cilium in the null MEFs, to assess whether it can operate outside the cilium.

We note that this result is consistent with previous work using a D1R-RAB23S23N construct which greatly diminished, but did not ablate, DR’s ciliary localization (Figure 7, Leaf et al., 2015). Additionally, ARL13B is used to target proteins to cilia so this result indicates ARL13B is capable to target RAB23S23N to the cilium.

As the reviewers suggested, tethering ARL13B outside the cilium would be a clever approach to bolster our claim. To this end, we generated a wild type ARL13B-RAB23S23N fusion protein construct. The GTP-binding mutant RAB23S23N disrupts RAB23 cilia localization, as well as proteins to which it is fused. We expressed either ARL13B-RAB23S23N or ARL13B-GFP in Arl13bhnn cells and found, like ARL13B-GFP, ARL13BRab23S23N, localized in cilia (see Author response image 1. This indicates that we are not technically able to tether wild type ARL13B outside the cilium at this time.

Author response image 1. ARL13B-RAB23S23N fusion protein is present in the cilia of Arl13bhnn MEFs.

Author response image 1.

Arl13bhnn MEFs transfected with ARL13B-RAB23S23N, ARL13B-GFP, or control plasmid. (A) The ARL13BRAB23 S23N fusion protein is detectable in the cilium (acetylated a-tubulin, magenta) by ARL13B antibody (cyan, NeuroMab). (B) Wildtype ARL13B-GFP is present in the cilium in high- (left column) and low- (right column) expressing cells. (C) No ARL13B positive cilia were detected in control plasmid transfected cells. (D) Secondary only controls.

Additionally, it would be good to provide some estimate of the lowest level of detectable protein in the cilium to provide a statement indicating that only if "x" percentage of ARL13B were ciliary and sufficient for SHH signaling, then the conclusions would not be valid.

We understand the desire to ascribe a clear quantitative measurement to the amount of ciliary ARL13B that might exist in Arl13bV358A/V358A cilia. However, as the reviewers predicted, we are acutely aware of the challenges in doing so with, “an enzymatic protein that may operate at substoichiometric levels”. In reality, there is no way to know whether any estimate could be biologically meaningful. Rather, what our data clearly demonstrate that the cilia defects that we previously interpreted to be causing defective Shh signal transduction, persist in the Arl13bV358A/V358A mice. We have modified the text to highlight this point.

Figure 1 is not sufficiently interpretable in its present form. In the present data, the kinetics of ARL3 GEF activity by wild type or V358A reaches maximum activity ~40 seconds into the time course. By adding excessive protein, the reaction is too rapid to show any quantitative differences in the activity of the wild type and mutant proteins. This experiment, as currently presented, shows that the mutant protein does have some activity, but could mask a 10-fold lower activity than wild type. The argument that the mutation is outside the homology defining the catalytic domain and thus unlikely to function only for targeting ignores the possibility of interdomain allostery/regulation, which is found in many small GTPases. For example, the C-terminus could fold over and inhibit the GTPase domain when engaged with its trafficking machinery, and this inhibition would be relieved to activate the GTPase when properly localized. The authors should compare various concentrations of wild type and mutant protein to see if the kinetic profiles are separable at lower concentrations.

We completely agree with this reviewer that by measuring ARL3 GEF activity using a single concentration of ARL13B (or mutant) one cannot conclude that no change to affinity for substrate results from mutation. And we did not make such a claim; rather, only that the mutant retains activity. We have gone over the entire manuscript with a renewed resolve to ensure that a reader not come away with the mistaken impression that we make such a claim. We have previously used the same approach described in this submission to test a series of 7 other designed mutations in ARL13B (Ivanova et al., 2017) and a human patient mutation (Rafiullah et al., 2017). Note that in our assays, we are testing ARL3 GEF activities using equimolar substrate (ARL3) and “enzyme” (ARL13B). This is consistent with a single turnover catalytic event and poor sensitivity in the assay. In addition, because there is spontaneous release of GDP during the course of the assay incubation, the GEF (ARL13B)-stimulated release has a narrower window than for standard enzyme assays. We also want to point out that in the initial demonstration of ARL3 GEF activity by ARL13B (Gotthardt et al., 2015) in which a number of ARL13B mutants were examined, they too used a single concentration of ARL13B but in this case it was 10-fold (5μM) over that of the substrate (ARL3, 0.5 μM). In only one figure in that paper did they report the effects of different concentrations of ARL13B on the GEF activity and they show that an increase of 10-fold (0.5 vs. 5.0 μM) resulted in less than a 50% change in rate of GDP release. We are aware of the limitations imposed on interpretations resulting from the lack of detailed dose response curves. Unfortunately, for a number of technical reasons we have found that attempts to generate such dose response curves are problematic and not publishable. We hope this clarifies the situation and reviewers better understand the limitations imposed upon us by this assay, which although not robust in turnover, we believe is a valid way to assess whether a point mutation results in substantial changes to activity.

The other source for the claim that Arl13bV358A cannot localize to cilia is the finding that ciliobrevin D, a dynein inhibitor, does not cause the ciliary accumulation of Arl13bV358A. It appears that ciliobrevin D treatment may not be efficiently blocking retrograde IFT as the increase of IFT88 in the majority of the ciliobrevin D-treated cells is subtle.

The effect is subtle but present. We found that treating cells with ciliobrevin-D over a longer time period or with higher concentrations resulted in ciliary disassembly, consistent with it efficiently blocking retrograde IFT. Thus, the 60 minute timepoint was as long as we could leave the cells and still observe cilia. To corroborate the IFT88 result, we repeated the experiment using GLI3. GLI3 is normally transported via IFT and accumulates at the ciliary tip upon retrograde transport being blocked. We found a defined increase in GLI3 at the ciliary tip following treatment with ciliobrevin-D. The magnitude is on par with our previous finding with IFT88. We did not detect ciliary ARL13BV358A. We include these data and analysis in Figure 3, and amended the manuscript.

Moreover, it is not clear that all ciliary proteins leave cilia in a dynein-dependent way. Nor is it clear that dynein is functional inside cilia of cells expressing Arl13bV358A as Arl3 localization is decreased and Arl3 is important for dynactin and cargo unloading from dynein (Jin et al., Nature Communications 2014). Some of these limitations should be included in the Discussion.

The reviewers are correct that ARL13B movement in cilia may not be regulated by dynein motors and therefore would be unaffected by ciliobrevin-D treatment. The suggestion (below) to disrupt IFT27 function to address this possibility would be appropriate if we had the applicable reagents. As requested, we now discuss this possibility in the Discussion.

The authors demonstrate that Arl3 localization is compromised in Arl13bV358A-expressing mice. As Arl3 is thought to function at cilia, the prediction is that Arl13bV358A mice would possess phenotypes similar to Arl3 loss of function. The authors do a nice job of assessing Hh-associated phenotypes. Do the mutant homozygous mice possess Arl3-associated phenotypes such as renal cysts and retinal degeneration? If not, do the authors propose that Arl3 also functions outside of the cilium?

As indicated in the Materials and methods, we maintain Arl13bV358A/V358A mice on an FVB/NJ background, which carry the Pde6brd1 mutation that causes retinal degeneration and blindness by 3 weeks of age (Chang et al., 2002; Wong et al., 2006). We are crossing the mice to an appropriate background to examine the retinal phenotype. We do have some preliminary observations that Arl13bV358A/V358A mice display kidney cysts so we do not currently have any data to support ARL3 functioning from outside the cilium.

References:

Chang, B, NL Hawes, RE Hurd, MT Davisson, S Nusinowitz, and JR Heckenlively. 2002. Retinal degeneration mutants in the mouse, Vision research, 42: 517-25.

Gotthardt, K., M. Lokaj, C. Koerner, N. Falk, A. Giessl, and A. Wittinghofer. 2015. A G-protein activation cascade from Arl13B to Arl3 and implications for ciliary targeting of lipidated proteins, eLife, 4.

Ivanova, A. A., T. Caspary, N. T. Seyfried, D. M. Duong, A. B. West, Z. Liu, and R. A. Kahn. 2017. Biochemical characterization of purified mammalian ARL13B protein indicates that it is an atypical GTPase and ARL3 guanine nucleotide exchange factor (GEF), J Biol Chem, 292: 11091-108.

Leaf, Alison, and Mark Von Zastrow. 2015. Dopamine receptors reveal an essential role of IFTB, KIF17, and Rab23 in delivering specific receptors to primary cilia, eLife, 4: e06996.

Rafiullah, R., A. B. Long, A. A. Ivanova, H. Ali, S. Berkel, G. Mustafa, N. Paramasivam, M. Schlesner, S. Wiemann, R. C. Wade, E. Bolthauser, M. Blum, R. A. Kahn, T. Caspary, and G. A. Rappold. 2017. A novel homozygous ARL13B variant in patients with Joubert syndrome impairs its guanine nucleotide-exchange factor activity, Eur J Hum Genet, 25: 1324-34.

Wong, AA, and RE Brown. 2006. Visual detection, pattern discrimination and visual acuity in 14 strains of mice, Genes, Brain and Behavior, 5: 389-403.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 2—source data 1. ARL13B western blot quantification.
    Figure 3—source data 1. Analysis of ARL13B in MEFs.
    Figure 5—source data 1. Immunofluorescence of cilia proteins.
    Figure 6—source data 1. Analysis of ciliated MEFs.
    Transparent reporting form

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES