Skip to main content
Plants logoLink to Plants
. 2020 Feb 17;9(2):254. doi: 10.3390/plants9020254

A Molecular Phylogenetic Study of the Genus Phedimus for Tracing the Origin of “Tottori Fujita” Cultivars

Sung Kyung Han 1, Tae Hoon Kim 2, Jung Sung Kim 1,*
PMCID: PMC7076367  PMID: 32079195

Abstract

It is very important to confirm and understand the genetic background of cultivated plants used in multiple applications. The genetic background is the history of crossing between maternal and paternal plants to generate a cultivated plant. If the plant in question was generated from a simple origin and not complicated crossing, we can easily confirm the history using a phylogenetic tree based on molecular data. This study was conducted to trace the origin of “Tottori Fujita 1gou” and “Tottori Fujita 2gou”, which are registered as cultivars originating from Phedimus kamtschaticus. To investigate the phylogenetic position of these cultivars, the backbone tree of the genus Phedimus needed to be further constructed because it retains inarticulate phylogenetic relationships among the wild species. We performed molecular phylogenetic analysis for P. kamtschaticus, Phedimus takesimensis, Phedimus aizoon, and Phedimus middendorffianus, which are assumed as the species of origin for “Tottori Fujita 1gou” and “Tottori Fujita 2gou”. The molecular phylogenetic tree based on the internal transcribed spacer (ITS) and psbA-trnH sequences showed the monophyly of the genus Phedimus, with P. takesimensis forming a single clade. However, P. kamtschaticus and P. aizoon were scattered in the tree. It was verified that “Tottori Fujita 1gou” and “Tottori Fujita 2gou” were embedded in a clade with P. takesimensis and not P. kamtschaticus. Therefore, origination from P. takesimensis was strongly supported. Based on these results, molecular phylogenetic analysis is suggested as a powerful tool for clearly tracing the origin of cultivated plants.

Keywords: Phedimus takesimensis, cultivar, origin, molecular phylogeny

1. Introduction

Crassulaceae belong to the order Saxifragales of the core eudicots. It is also called the “stonecrop family” because it mostly comprises perennial herbaceous plants and many members have fleshy leaves. In this family, the Angiosperm Phylogeny Group (APG) IV system [1] currently contains three subfamilies, namely, Crassuloideae, Kalanchoideae, and Sempervivoideae, and it includes around 29–34 genera and 1400 species. Crassulaceae is distributed worldwide and has high species diversity in South Africa, Mexico, and mountainous areas in Asia. The family lives mostly in dry locations and is often found in saline areas. Crassulaceae is an important plant group that has been developed as horticultural cultivars for various morphological characteristics and vigorous growth in dry environments.

Regarding Crassulaceae classification, Berger [2] recognized 35 genera and 15,000 species in six subfamilies, but the largest genus, Sedum L., contains over 500 species with unclear phylogenetic relationships. To understand the taxonomic limitations of Sedum, numerous approaches have been undertaken by many researchers. Among them, Rafinesque [3] described an independent genus Phedimus Raf. from the genus Sedum, including the two species Phedimus uniflorus Raf. and Phedimus stellatus (L.) Raf., which have five-part calyx, unequal sepals longer than the petals, five equal petals, 10 stamens, and five ovaries. The author ‘t Hart [4] examined new combinations in Phedimus using phylogenetic analysis. They divided Crassulaceae into two subfamilies, namely, Crassuloideae and Sedoideae, and separated the subfamily Sedoideae into tribes Kalanchoeae and Sedeae. The Sedeae were again divided into subtribes Telephiinae and Sedinae, with Telephiinae including the genera Rhodiola L., Hylotelephium H. Ohba, and Orostachys Fisch. as well as Meterostachys Nakai and Phedimus, which were newly combined. Later, Ohba [5] divided Phedimus into subgenera Phedimus and Aizoon and established the current concept of the genus Phedimus, including the variants of P. aizoon and Phedimus hsinganicus (Y.C. Chu ex S.H. Fu and Y.H. Huang) H. Ohba, K.T. Fu, and B.M. Barthol. Since then, numerous molecular phylogenetic studies on Sedinae have been continuously conducted, and Phedimus has been separated from existing Sedum species. However, researchers have often continued to use a broad concept of intermixed “Sedum” and the newly defined “Phedimus” until now, even though the monophyly of Phedimus has been proven by molecular phylogenetic analysis [6,7,8]. Therefore, we have treated the genus Phedimus in accordance with the views of ‘t Hart [4] and Ohba [5] here.

For a long time, Phedimus has been primarily used to develop horticultural cultivars. The increasing of various developed and cultivated plants has led to the issue of their origination due to ambiguous information about their genetic origins. For example, P. takesimensis (Nakai) ‘t Hart is an endemic species to South Korea and was first introduced as “Sedum takesimense Nakai” at the UK Horticultural Society magazine “Sedum Society” in the early 1990s [9,10]. P. takesimensis was called the “evergreen Sedum” in this magazine because, unlike other plants in the Aizoon group that were widespread in Europe at the time (such as Sedum aizoon L., Sedum kamtschaticum Fisch., Sedum middendorffianum Maxim., Sedum kurilense Vorosch., and S. kamtschaticum subsp. ellacombianum (Praeger) R.T. Clausen), it retains green leaves even in the winter season. Because of these characteristics, P. takesimensis has been recognized as an important material for developing a horticultural plant based on its potential value, and it has entered the European market for greening and gardening. It has also been used as road landscaping plants since it was introduced to Japan in 2011 [11] as well as sold in Japanese markets in the form of seeds or young potted plants. In the case of the newly registered cultivars of “Tottori Fujita 1gou” and “Tottori Fujita 2gou”, the applicant reported P. kamtschaticus (Fisch.) ‘t Hart as the plant of origin to the National Korea Forest Seed and Variety Center in South Korea. However, this was controversial as the cultivated plants were morphologically closer to P. takesimensis than P. kamtschaticus (Figure 1). In the present study, we traced and clarified the definite origin of these cultivars using a molecular phylogenetic approach to overcome the limitations of discrimination via morphological characteristic comparisons. Since the controversy over the origin of these cultivars arose, no attempts have yet been made to resolve the issue using molecular phylogenetic analysis. Therefore, we suggest that it is possible to specifically trace the cultivar origin using molecular phylogenetic analysis in the case study of Phedimus.

Figure 1.

Figure 1

Plant materials of the genus Phedimus used for analysis. (A) Phedimus kamtschaticus, (B) Phedimus takesimensis, (C) Phedimus aizoon, (D) Phedimus middendorffianus, (E) “Tottori Fujita 1gou”, and (F) “Tottori Fujita 2gou”.

2. Results

2.1. Sequence Variations within Phedimus

The nuclear ribosomal internal transcribed spacer (ITS) region (including ITS1, ITS2, 5.8S, and the partial 28S ribosomal gene) and the psbA-trnH spacer region of chloroplast DNA sequences of 85 individuals of the genus Phedimus were determined in this study.

Within the genus, the ITS region comprised 606–607 base pairs (bp), and the total aligned length was 608 bp. There were 471 constant sites (76.84% of all sites) and 115 parsimonious informative sites. In the aligned ITS region sequence, P. kamtschaticus and P. aizoon (L.) ‘t Hart showed similar nucleotide polymorphisms, although there was sequence variation within the same species. In P. takesimensis, excluding sample J6, the sequence was 607 bp in length, and “Tottori Fujita 1gou” and “Tottori Fujita 2gou” were also 607 bp. There were no species-specific variations in P. takesimensis; however, when comparing P. takesimensis sequences, they were divided into three types: α type (according to nucleotide substitution at 549 and 564 bp), β type (549 bp only), and γ type (564 bp only). “Tottori Fujita 1gou” and “Tottori Fujita 2gou” were both included in these three types (Figure 2). P. middendorffianus (Maxim) ‘t Hart, which showed a similar nucleotide sequence to P. takesimensis, had two species-specific nucleotide substitutions at 342 and 578bp, unlike other taxa.

Figure 2.

Figure 2

Three types based on nucleotide substitution in internal transcribed spacer (ITS) sequences of P. takesimensis, cultivar “Tottori Fujita 1gou” and “Tottori Fujita 2gou”.

In the psbA-trnH region, the length variation was 375–400 bp, and a small inversion was identified (Figure S1). There were 383 constant sites (90.12% of all sites) and 29 parsimonious informative sites in an aligned 413bp matrix. The shortest-length sequence of 375 bp had a 7 bp deletion of “GAATAGG” at 360–366 bp in the aligned sequences. Samples K8, K9, K10 (P. takesimensis), and K68 (“Tottori Fujita 1gou”), which had lengths of 377 bp, showed a 5bp deletion of “CATTT” at 200–204 bp. Only sample K48 (P. aizoon var. floribundus) had a length of 388bp due to a 6bp repeat sequence insertion of “CGGTAT” at 67–72 bp. The 7bp repeat sequence of “TTACTTA” was inserted at 166–172 bp in K38, K39, K40 (P. kamtschaticus), K42, K43, K47 (P. aizoon), and J13 (P. aizoon var. floribundus), which each had a length of 389 bp. K44 (P. aizoon) was 400 bp long due to a 25bp insertion at 162–186 bp and a 7bp deletion at 360–366 bp. A small inversion at 119–125 bp also occurred, but it was not a species-specific polymorphism. Species-specific nucleotide substitution appeared in P. takesimensis at 270 bp (C) (Figure S1). This same nucleotide substitution appeared in “Tottori Fujita 1gou” and “Tottori Fujita 2gou”, except for J6 and J7. Meanwhile, samples sharing the same deletion at 360–366 bp had common nucleotide substitutions at 261 (T), 266 (G), 270 (T), 318 (G), and 334 bp (G).

2.2. Origin and Phylogenetic Relationship of Cultivated Phedimus

Maximum likelihood (ML) trees of the ITS and psbA-trnH regions showed the monophyly of the genus Phedimus with 100% bootstrap support and 100% Shimodaira–Hasegawa (SH)-like approximate likelihood ratio test (SH-aLRT) support (Figure 3, Figure 4 and Figure 5).

Figure 3.

Figure 3

Maximum likelihood (ML) tree of the genus Phedimus based on ITS sequence. Numbers on the branches indicate the bootstrap values and Shimodaira–Hasegawa (SH)-like approximate likelihood ratio test (SH-aLRT) support.

Figure 4.

Figure 4

ML tree of the genus Phedimus using psbA-trnH sequence without correcting for the inversion. Numbers on branches indicate the bootstrap values and SH-aLRT support.

Figure 5.

Figure 5

ML tree of the genus Phedimus using psbA-trnH sequence after correcting for the inversion. Numbers on branches indicate the bootstrap values and SH-aLRT support.

The tree length of the ITS region was 0.3632, and the sum of the internal branch lengths was 0.2592, accounting for 71.36% of the tree length. This was divided into two clades (Figure 3). P. aizoon and P. kamtschaticus formed Clade I with 75% bootstrap value and 90% SH-aLRT support. Clade II, comprising P. takesimensis and P. middendorffianus, was supported with 69% bootstrap value and 89% SH-aLRT support. P. middendorffianus formed a subclade within Clade II with 95% bootstrap value and 91.8% SH-aLRT support. P. takesimensis formed three subclades, which matched the three types of P. takesimensis sequence variation (α, β, and γ) of the ITS region. “Tottori Fujita 1gou”, “Tottori Fujita 2gou”, and Phedimus sp. were included in all three subclades of P. takesimensis. Regarding K31, K41, J6, J8, and J9, each showed a position that differed from their identification.

ML analysis for psbA-trnH was performed in two cases: corrected and uncorrected small inversion. The ML tree length was 0.1818, and the sum of the internal branch lengths was 0.0991, which was 71.36% of the tree length. The tree Baysian Information Criterion (BIC) score was 2128.3260 (Figure 4). The highly supported long branch of the tree (100% bootstrap value and 99.7% SH-aLRT support; taxa within the box in Figure 4) collapsed into the tree after correction of the inversed sequence (Figure 5). The ML tree length with corrected inversion was 0.1619, and the sum of the internal branch lengths was 0.0805, which was 49.70% of the tree length. The BIC score was 1943.4605. In the tree, only P. takesimensis composed a unique clade, unlike other species, with 80% bootstrap value and 86.6% SH-aLRT support. On the other hand, P. kamtschaticus, P. aizoon, and P. middendorffianus were scattered in the tree.

3. Discussion

Molecular phylogenetic study showed that the genus Phedimus separated from Sedum was monophyletic. Although there were several exceptions, closer relationships were found between P. takesimensis and P. middendorffianus as well as P. kamtschaticus and P. aizoon in the genus. Interestingly, three haplotypes were found in P. takesimensis, and all cultivars were embedded in those types.

3.1. The Origin of Cultivar “Tottori Fujita”

The controversy surrounding the origin of the two Phedimus cultivars “Tottori Fujita 1gou” and “Tottori Fujita 2gou” arose due to the lack of an established correct phylogenetic relationship of Phedimus. Although the reliance of cultivar origin on external morphological characteristics tends to depend on the arguments of the applicant, there is a problem with the authenticity of the claims due to the absence of definite classification characteristics, such as morphological variations within the species of the genus Phedimus.

The genus Phedimus was separated from Sedum, the largest genus in Crassulaceae, and recombined by ‘t Hart [4] and Ohba [5]. However, there were uncertain phylogenetic relationships among wild species, which caused confusion in applying species names and identifying taxa. Thus, we expected that the difficulty of tracing the origin of the registered cultivars would be resolved based on the analysis of the molecular phylogenetic relationships of Phedimus.

The results showed that the cultivars “Tottori Fujita 1gou” and “Tottori Fujita 2gou”, which were registered as new cultivars at the National Korea Forest Seed and Variety Center, formed a clade with P. takesimensis. The results also strongly indicated that the parental plant samples (marked as Phedimus sp. in data) submitted by the applicant as the species of origin P. kamtschaticus when registering these two new cultivars at the National Korea Forest Seed and Variety Center were also embedded in the P. takesimensis clade rather than P. kamtschaticus. Therefore, contrary to the information provided by the applicant, it was demonstrated that the cultivars “Tottori Fujita 1gou” and “Tottori Fujita 2gou” originated from P. takesimensis.

3.2. Application of Molecular Phylogenetic Analysis to Evaluate Misidentified Plants

We could also reidentify several Phedimus samples that were used in the present study and suspected of misidentification. For example, in the cases of J6 and J7, they were germinated and grown from purchased P. takesimensis seeds, which are currently sold at seed stores in Nagano Prefecture, Japan. However, unlike other P. takesimensis samples, which have a 1bp gap at 515 bp in the ITS region, J6 and J7 have an additional 1bp gap at 398 bp and a 1bp nucleotide substitution at 113 bp. This shows the same pattern as P. kamtschaticus and P. aizoon; however, not all sequence variances are perfectly consistent with these two species. Furthermore, samples K41, J8, and J9, which were identified as P. kamtschaticus, were exactly the same as the J6 and J7 sequences, and they formed a single clade in all trees. Therefore, it is reasonable to recognize them as P. kamtschaticus or P. aizoon rather than P. takesimensis. Accordingly, Phedimus seeds released on the market should be handled carefully due to the probability of misidentification to avoid confusion.

3.3. Hybridization Leading to Discordance on the Phylogenetic Tree

Hybridization is an important mechanism that obtains new genotypes through a combination of different genomes. And then, the plant species is generally diversified into other species that are evolutionarily competitive [12]. Some plants are also generated by selective breeding that suits useful values, such as building a new lineage that maximizes the specific character manifestation [13]. In natural conditions, when an interspecific hybridization has been occurred, it may be used to recognize a new species and give a caution to carefully define the boundary of species [14]. Therefore, researchers have investigated hybridization in wild species and cultivars by morphological, physiological, and genetic approaches [15,16,17].

Hybrids originating from wild species of the genus Phedimus have been reported in Korean taxa [18,19]. In addition, various hybrid plants have been reported in the subspecies P. aizoon, and it has caused a lot of confusion in the recognition of Japanese species [20]. This is particularly the case for P. kamtschaticus and P. aizoon, which are generally identified by their leaf type. The boundary of species is still unclear because there is no apparent morphological difference between them, and interspecific hybrids have been reported.

The present study also showed that these two species were not distinguishable from each other in the phylogenetic tree. Clade I containing P. kamtschaticus and P. aizoon and the clade of P. middendorffinus were clearly recognizable in the ITS tree (Figure 3). However, all three species were scattered in the psbA-trnH tree (Figure 5). It is assumed that hybridization has occurred among species in Phdimus except for P. takesimnesis.

The K52 and K54 samples (P. middendorffianus) formed a subclade with another P. middendorffianus in the ITS tree. However, these samples were separated from them in the psbA-trnH tree and formed one subclade with several P. kamtschaticus (Figure 3 and Figure 5). This finding made us speculate that the K52 and K54 samples had different maternal origin than the rest of the P. middendorffianus samples.

In the case of sample K31 (P. kamtschaticus), a hybrid origin was also suspected because it showed a similar pattern to P. takesimensis in the ITS region but a similar tendency to P. kamtschaticus in the psbA-trnH region.

Meanwhile, the J10 sample (P. aizoon) was included in Clade I of the ITS tree, but in the case of the psbA-trnH tree, the J10 sample was separate from the clade that included all the Phedimus samples (Figure 3 and Figure 5). Besides, a unique sequence variation (A) was found at 337 bp position of the psbA-trnH sequence of J10. This suggests the possibility of de novo mutation in the J10 sample.

3.4. Molecular Marker Development for Further Study

In addition, we found the species-specific variations for P. middendorffianus at 342 bp in the ITS region (Figure 2) and at 275 bp in the psbA-trnH region for P. takesimensis (Figure S1). It is anticipated that these polymorphic sequence sites may be used to develop molecular markers to identify the two species among the different Phedimus species.

In the horticultural and forestry industries, all countries encourage and promote development and sale based on cooperation with the International Union for the Protection of New Varieties of Plants (UPOV). However, the importance of providing accurate information for cultivated plants has often been ignored, including the history of their generation and genetic background to evaluate the characteristics of plants in the market. In fact, in most cases, a plant can be accepted as a new cultivar if it maintains just one unique characteristic compared to the plant of origin. To establish a system to protect plant cultivars, the genetic background must be provided along with the morphological features in the future. Based on the results of this study, it is suggested that the technique of molecular phylogenetic analysis be used to trace the definite origin of cultivars and to define the phylogenetic boundary between species. Molecular phylogenetic analysis can be used as a powerful tool to produce a genetic backbone tree for tracking the origin of cultivars.

4. Materials and Methods

4.1. Plant Materials and Sampling

In total, 85 individuals (69 from Korea and 16 from Japan) were used in this study, including the “Tottori Fujita 1gou” and “Tottori Fujita 2gou” cultivars, which were provided from the National Korea Forest Seed and Variety Center, and four species of Phedimus, which occur in wild habitats in Korea and Japan (Figure 1). In addition, the sequence data of the related taxa, i.e., Pseudosedum and Rhodiola [21,22,23], were downloaded from the National Center for Biotechnology Information (NCBI) database (Table 1).

Table 1.

List of plant materials with accession numbers deposited in the National Center for Biotechnology Information (NCBI) database.

Sample ID Species Collection Information of Locality or Reference Acc. No.
ITS psbA-trnH
K1 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN908990 MN935682
K2 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN908991 MN935683
K3 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN908992 MN935684
K4 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN908993 MN935685
K5 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea - MN935686
K6 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN908994 MN935687
K7 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN908995 MN935688
K8 Phedimus takesimensis collectcollected from the natural locality MN908996 MN935689
K9 Phedimus takesimensis collected from the natural locality (not specified) MN908997 MN935690
K10 Phedimus takesimensis collected from the natural locality (not specified) MN908998 MN935691
K11 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN908999 MN935692
K12 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN909000 MN935693
K13 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN909001 MN935694
K14 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN909002 MN935695
K15 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN909003 MN935696
K16 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN909004 MN935697
K17 Phedimus takesimensis Dokdo-ri, Ulleung-gun, Gyeongsangbuk-do, Korea MN909005 MN935698
K18 Phedimus takesimensis Dokdo-ri, Ulleung-gun, Gyeongsangbuk-do, Korea MN909006 MN935699
K19 Phedimus takesimensis Dokdo-ri, Ulleung-gun, Gyeongsangbuk-do, Korea MN909007 MN935700
K20 Phedimus takesimensis collected from the natural locality (not specified) MN909008 MN935701
K21 Phedimus takesimensis collected from the natural locality (not specified) MN909009 MN935702
K22 Phedimus takesimensis collected from the natural locality (not specified) MN909010 MN935703
K23 Phedimus takesimensis Dokdo-ri, Ulleung-gun, Gyeongsangbuk-do, Korea MN909011 MN935704
K24 Phedimus takesimensis Dokdo-ri, Ulleung-gun, Gyeongsangbuk-do, Korea MN909012 MN935705
K25 Phedimus takesimensis Dokdo-ri, Ulleung-gun, Gyeongsangbuk-do, Korea MN909013 MN935706
K26 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN909014 MN935707
K27 Phedimus takesimensis Ulleung-gun, Gyeongsangbuk-do, Korea MN909015 MN935708
K28 Phedimus kamtschaticus Pohang-si, Gyeongsangbuk-do, Korea MN908958 MN935733
K29 Phedimus kamtschaticus Goseong-gun, Gangwon-do, Korea MN908959 MN935734
K30 Phedimus kamtschaticus Bonghwa-gun, Gyeongsangbuk-do, Korea MN908960 MN935735
K31a Phedimus kamtschaticus Pocheon-si, Gyeonggi-do, Korea MN908961 MN935736
K32 Phedimus kamtschaticus Pocheon-si, Gyeonggi-do, Korea MN908962 MN935737
K33 Phedimus kamtschaticus Pocheon-si, Gyeonggi-do, Korea MN908963 MN935738
K34 Phedimus kamtschaticus Seocho-gu, Seoul, Korea MN908964 MN935739
K35 Phedimus kamtschaticus Seocho-gu, Seoul, Korea MN908965 MN935740
K36 Phedimus kamtschaticus Seocho-gu, Seoul, Korea MN908966 MN935741
K37 Phedimus kamtschaticus collected from the natural locality (not specified) MN908967 MN935742
K38 Phedimus kamtschaticus Pohang-si, Gyeongsangbuk-do, Korea MN908968 MN935743
K39 Phedimus kamtschaticus Pohang-si, Gyeongsangbuk-do, Korea MN908969 MN935744
K40 Phedimus kamtschaticus Pohang-si, Gyeongsangbuk-do, Korea MN908970 MN935745
K41b Phedimus kamtschaticus Ulleung-gun, Gyeongsangbuk-do, Korea MN908971 MN935748
K42 Phedimus aizoon collected from the natural locality (not specified) MN908974 MN935749
K43 Phedimus aizoon collected from the natural locality (not specified) MN908975 MN935750
K44 Phedimus aizoon collected from the natural locality (not specified) - MN935751
K45 Phedimus aizoon farm, Pyeongchang-gun, Gangwon-do, Korea MN908976 MN935752
K46 Phedimus aizoon farm, Pyeongchang-gun, Gangwon-do, Korea MN908977 MN935753
K47 Phedimus aizoon farm, Pyeongchang-gun, Gangwon-do, Korea MN908978 MN935754
K48 Phedimus aizoon var. florivundus Gyeongju-si, Gyeongsangnam-do, Korea MN908980 MN935758
K49 Phedimus middendorffianus collected from the natural locality (not specified) MN908985 MN935761
K50 Phedimus middendorffianus collected from the natural locality (not specified) MN908986 MN935762
K51 Phedimus middendorffianus collected from the natural locality (not specified) MN908987 MN935763
K52 Phedimus middendorffianus farm, Uiwang-si, Gyeonggi-do, Korea MN908988 MN935764
K53 Phedimus middendorffianus farm, Uiwang-si, Gyeonggi-do, Korea - MN935765
K54 Phedimus middendorffianus farm, Uiwang-si, Gyeonggi-do, Korea MN908989 MN935766
K55 “Tottori Fujita 1gou” generated and submitted by applicant MN909025 MN935716
K56 “Tottori Fujita 1gou” generated and submitted by applicant MN909026 MN935717
K57 “Tottori Fujita 1gou” generated and submitted by applicant MN909027 MN935718
K58 “Tottori Fujita 1gou” generated and submitted by applicant MN909028 MN935719
K59 “Tottori Fujita 1gou” generated and submitted by applicant MN909029 MN935720
K60 “Tottori Fujita 1gou” generated and submitted by applicant MN909030 MN935721
K61 “Tottori Fujita 2gou” generated and submitted by applicant MN909032 MN935723
K62 “Tottori Fujita 2gou” generated and submitted by applicant MN909033 MN935724
K63 “Tottori Fujita 2gou” generated and submitted by applicant MN909034 MN935725
K64 “Tottori Fujita 2gou” generated and submitted by applicant MN909035 MN935726
K65 “Tottori Fujita 2gou” generated and submitted by applicant MN909036 MN935727
K66 “Tottori Fujita 2gou” generated and submitted by applicant MN909037 MN935728
K67 Phediums sp. generated and submitted by applicant MN909023 MN935730
K68 Phediums sp. generated and submitted by applicant MN909022 MN935731
K69 Phediums sp. generated and submitted by applicant MN909024 MN935732
J1 Phedimus takesimensis Seed store, Nagano Pref., Japan MN909016 MN935709
J2 Phedimus takesimensis Seed store, Nagano Pref., Japan MN909017 MN935710
J3 Phedimus takesimensis Seed store, Nagano Pref., Japan MN909018 MN935711
J4 Phedimus takesimensis Seed store, Nagano Pref., Japan MN909019 MN935712
J5 Phedimus takesimensis Seed store, Nagano Pref., Japan MN909020 MN935713
J6 b Phedimus takesimensis Seed store, Nagano Pref., Japan MN909021 MN935714
J7 b Phedimus takesimensis Seed store, Nagano Pref., Japan - MN935715
J8 b Phedimus kamtschaticus Hokkaido, Obihiro-si, Japan MN908972 MN935746
J9 b Phedimus kamtschaticus Hokkaido, Memuro-cho, Japan MN908973 MN935747
J10 Phedimus aizoon Nagano Pref., Japan MN908979 MN935755
J11 Phedimus aizoon var. floribundus Nigata Pref. Kasiwazaki-si, Japan MN908981 MN935756
J12 Phedimus aizoon var. floribundus Kagawa Pref. Kankakei, Japan MN908982 MN935757
J13 Phedimus aizoon var. floribundus Seed store, Osaka Pref., Japan MN908983 MN935759
J14 Phedimus aizoon var. floribundus Nigata Pref. Sado-si, Japan MN908984 MN935760
J15 “Tottori Fujita 1gou” Tottori Pref. Iwami-cho, Japan MN909031 MN935722
J16 “Tottori Fujita 2gou” Tottori Pref. Iwami-cho, Japan MN909038 MN935729
Outgroup
Pseudosedum lievenii Zhang, J.Q. et al., 2014 [21] KJ569920 KJ570048
Rhodiola integrifolia Guest, H.J. et al., 2014 [22] KF879823 KF879860
Rhodiola rhodantha Guest, H.J. et al., 2014 [22] KF879828 KF879860
Rhodiola rosea Guest, H.J. et al., 2014 [22], Gyorgy, Z., et al., 2018 [23] KF879829 MG938151

a: plant material suspected of a hybrid origin, b: plant materials suspected of misidentification.

4.2. DNA Extraction, PCR Amplification, and Sequencing

Total genomic DNA was extracted from silica-gel-dried leaf tissues using a modified CTAB method [24] or the DNeasy Plant Mini Kit (QIAGEN, Germany) following the manufacturer’s instructions. The quantity and quality of the extracted DNA were analyzed using 1% agarose gel electrophoresis with 1X Tri-acetate-EDTA (TAE) buffer and a spectrophotometer (Thermo Scientific™ NanoDrop 2000, Thermo Fisher Scientific, Waltham, MA, USA). We amplified the ITS region (rDNA) and the psbA-trnH region (cpDNA). To amplify the target regions, we used primer pairs of ITS1 and ITS4 [25] and of psbA and trnH [26] (Table 2). The PCR reaction for the ITS region was initialized at 95 °C for 1 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 51 °C for 30 s, and extension at 72 °C for 1 min; the final extension step was performed at 72 °C for 5 min. For the psbA-trnH region, PCR was initialized at 95 °C for 1 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min; the final extension step was performed at 72 °C for 5 min. The PCR products were run on 1% agarose gels in 1X TAE buffer and purified using the Expin PCR SV Mini Kit (GeneAll, Seoul, South Korea). Sequencing was carried out by the 3730XL Automated DNA Sequencing System (Applied Biosystems, Foster City, CA, USA).

Table 2.

Primer information applied for the present study.

Region Primer Sequence (5′→ 3′) Reference
ITS (rDNA) ITS1 TCCGTAGGTGAACCTGCGG White et al. [25]
ITS4 TCCTCCGCTTATTGATATGC White et al. [25]
psbA-trnH
(cpDNA)
psbA3_f GTTATGCATGAACGTAATGCTC CBOL Plant Working Group [26]
trnHf_05 CGCGCATGGTGGATTCACAATCC CBOL Plant Working Group [26]

4.3. Molecular Phylogenetic Analyses of ITS and Plastid DNA Regions

The nuclear ITS region sequence and plastid noncoding regions, psbA-trnH, were used to compose the phylogeny. Geneious 7.1.9 [27] was used to assemble the DNA sequences resulting from the PCR products. Sequences were initially aligned with the MAFFT v7.017 alignment program [28] in Geneious 7.1.9 using the default parameter values. Then, all sequences were manually checked, and amendments were directly made.

Phylogenetic analysis was performed using maximum likelihood methods with W-IQ-TREE 1.6.11 [29], and gaps were treated as missing data. The best evolutionary substitution model identified by the Bayesian information criterion [30] was selected at TIM3e + G4 for the ITS region, F81 + F + I for the psbA-trnH region after correcting for the small inversion, and F81 + F + G4 for the psbA-trnH region with uncorrected inversion using W-IQ-TREE 1.6.11. The supporting value for each clade was estimated from 1000 bootstrap replicates [31], and we performed 1000 replications for the SH-aLRT as the branch test [32].

Acknowledgments

This study was supported by the Basic Science Research Program through National Research Foundation of Korea (NRF) funded by the Ministy of Education (2017R1D1A1A02018573) and Chungbuk National University (2018). The authors express their appreciation to Mr. Yoshio Shikata who collected the plant materials from wild locations and Japanese markets for this study.

Supplementary Materials

The following are available online at https://www.mdpi.com/2223-7747/9/2/254/s1, Figure S1: Three types based on nucleotide substitution in psbA-trnH sequences of Phedimus investigated in the present study including cultivar “Tottori Fujita 1gou” and “Tottori Fujita 2gou”.

Author Contributions

S.K.H. performed the research design, wrote the manuscript, and conducted lab work and data analysis. T.H.K. collected samples and provided a part of the sequence data. J.S.K. contributed to design of the research, arranged plant collection, and wrote and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1.Chase M.W., Christenhusz M., Fay M., Byng J., Judd W.S., Soltis D., Mabberley D., Sennikov A., Soltis P.S., Stevens P.F. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV. Bot. J. Linn. Soc. 2016;181:1–20. [Google Scholar]
  • 2.Berger A. Crassulaceae. In: Engler A., Prantl K., editors. Die natürlichen Pflanzenfamilien. Volume 2. Verlag Wilhelm Englmann; Leipzig, German: 1930. pp. 352–483. [Google Scholar]
  • 3.Rafinesque C.S. Museum of Natural Sciences. Am. Mon. Ma. Crit. Rev. 1817;1:431–442. [Google Scholar]
  • 4.Hart H. Infrafamilial and generic classification of the Crassulaceae. In: Hart H., Eggli U., editors. Evolution and Systematics of the Crassulaceae. Backhuys; Leiden (NL), The Netherlands: 1995. pp. 159–172. [Google Scholar]
  • 5.Ohba H., Bartholomew B.M., Turland N.J., Kunjun F., Kun-Tsun F. New combinations in Phedimus (Crassulaceae) Novon. 2000;10:400–402. doi: 10.2307/3392995. [DOI] [Google Scholar]
  • 6.Mort M.E., Soltis D.E., Soltis P.S., Francisco-Ortega J., Santos-Guerra A. Phylogenetic relationships and evolution of Crassulaceae inferred from matK sequence data. Am. J. Bot. 2001;88:76–91. doi: 10.2307/2657129. [DOI] [PubMed] [Google Scholar]
  • 7.Mayuzumi S., Ohba H. The phylogenetic position of eastern Asian Sedoideae (Crassulaceae) inferred from chloroplast and nuclear DNA sequences. Syst. Bot. 2004;29:587–598. doi: 10.1600/0363644041744329. [DOI] [Google Scholar]
  • 8.Gontcharova S., Gontcharov A. Molecular phylogeny and systematics of flowering plants of the family Crassulaceae DC. Mol. Biol. 2009;43:794. doi: 10.1134/S0026893309050112. [DOI] [PubMed] [Google Scholar]
  • 9.Ray S., Harris J.G.S. How Sedum takesimense was interoduced into cultivation. Sedum Soc. Newsl. 1991;19:4. [Google Scholar]
  • 10.Ray S., Harris J.G.S. Sedum takesimense—Some cultural notes. Sedum Soc. Newsl. 1991;19:6–7. [Google Scholar]
  • 11.Kentaro I. Where the naturalized plant attein? Evergreen Sedum (Sedum takesimense NAKAI) J. Jpn. Soc. Reveget. Tech. 2001;36:446. (In Japanese) [Google Scholar]
  • 12.Arnold M.L., Hodges S.A. Are natural hybrids fit or unfit relative to their parents? Trends Ecol. Evol. 1995;10:67–71. doi: 10.1016/S0169-5347(00)88979-X. [DOI] [PubMed] [Google Scholar]
  • 13.Rudolf-Pilih K., Petkovšek M., Jakse J., Štajner N., Murovec J., Bohanec B. New hybrid breeding method based on genotyping, inter-pollination, phenotyping and paternity testing of selected elite F1 hybrids. Front. Plant Sci. 2019;10:1111. doi: 10.3389/fpls.2019.01111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fitzpatrick B.M., Ryan M.E., Johnson J.R., Corush J., Carter E.T. Hybridization and the species problem in conservation. Curr. Zool. 2015;61:206–216. doi: 10.1093/czoolo/61.1.206. [DOI] [Google Scholar]
  • 15.Huamán Z., Spooner D.M. Reclassification of landrace populations of cultivated potatoes (Solanum sect. Petota) Am. J. Bot. 2002;89:947–965. doi: 10.3732/ajb.89.6.947. [DOI] [PubMed] [Google Scholar]
  • 16.Lema M., Ali M.Y., Retuerto R. Domestication influences morphological and physiological responses to salinity in Brassica oleracea seedlings. Aob Plants. 2019;11:plz046. doi: 10.1093/aobpla/plz046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Huang H., Liu Y. Natural hybridization, introgression breeding, and cultivar improvement in the genus Actinidia. Tree Genet. Genomes. 2014;10:1113–1122. doi: 10.1007/s11295-014-0771-8. [DOI] [Google Scholar]
  • 18.Chung Y.H., Kim J.H. A taxonomic study of Sedum section Aizoon in Korea. Korean J. Plant Taxon. 1989;19:189–227. doi: 10.11110/kjpt.1989.19.4.189. (In Korean) [DOI] [Google Scholar]
  • 19.Yoo Y., Park K. A test of the hybrid origin of Korean endemic Sedum latiovalifolium (Crassulaceae) Korean J. Plant Taxon. 2016;46:378–391. doi: 10.11110/kjpt.2016.46.4.378. (In Korean) [DOI] [Google Scholar]
  • 20.Amano M. Biosystematic study of Sedum, L. Subgenus Aizoon (Crassulaceae) Bot. Mag. Tokyo. 1990;103:67–85. doi: 10.1007/BF02488412. [DOI] [Google Scholar]
  • 21.Zhang J., Meng S., Allen G.A., Wen J., Rao G. Rapid radiation and dispersal out of the Qinghai-Tibetan 1 Plateau of an alpine plant lineage Rhodiola (Crassulaceae) Mol. Phylogenet. Evol. 2014;77:147–158. doi: 10.1016/j.ympev.2014.04.013. [DOI] [PubMed] [Google Scholar]
  • 22.Guest H.J., Allen G.A. Geographical origins of North American Rhodiola (Crassulaceae) and phylogeography of the western roseroot, Rhodiola integrifolia. J. Biogeogr. 2014;41:1070–1080. doi: 10.1111/jbi.12267. [DOI] [Google Scholar]
  • 23.György Z., Tóth E.G., Incze N., Molnár B., Höhn M. Intercontinental migration pattern and genetic differentiation of arctic-alpine Rhodiola rosea L.: A chloroplast DNA survey. Ecol. Evol. 2018;8:11508–11521. doi: 10.1002/ece3.4589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Doyle J.J., Doyle J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987;19:11–15. [Google Scholar]
  • 25.White T., Bruns T., Lee S., Taylor J. Amplification and direct sequencing of fungal ribosomal RNA Genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J., editors. PCR Protocols: A guide to Methods and Applications. Academic Press; San Diego, CA, USA: 1990. pp. 315–322. [Google Scholar]
  • 26.CBOL Plant Working Group A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA. 2009;106:12794–12797. doi: 10.1073/pnas.0905845106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz S., Duran C. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Katoh K., Standley D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Trifinopoulos J., Nguyen L., Von Haeseler A., Minh B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016;44:W232–W235. doi: 10.1093/nar/gkw256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Schwarz G. Estimating the dimension of a model. Ann. Stat. 1978;2:461–464. doi: 10.1214/aos/1176344136. [DOI] [Google Scholar]
  • 31.Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 1985;39:783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x. [DOI] [PubMed] [Google Scholar]
  • 32.Anisimova M., Gascuel O. Approximate likelihood-ratio test for branches: A fast, accurate, and powerful alternative. Syst. Biol. 2006;55:539–552. doi: 10.1080/10635150600755453. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Plants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES