Skip to main content
PLOS One logoLink to PLOS One
. 2020 Mar 17;15(3):e0229043. doi: 10.1371/journal.pone.0229043

Granulosa secreted factors improve the developmental competence of cumulus oocyte complexes from small antral follicles in sheep

Shiva Rouhollahi Varnosfaderani 1, Mehdi Hajian 1, Farnoosh Jafarpour 1, Faezeh Ghazvini Zadegan 1, Mohammad Hossein Nasr-Esfahani 1,*
Editor: Wilfried A Kues2
PMCID: PMC7077809  PMID: 32182244

Abstract

Oocyte in vitro maturation can be improved by mimicking the intra-follicular environment. Oocyte, cumulus cells, granulosa cells, and circulating factors act as meiotic regulators in follicles and maintain oocyte in the meiotic phase until oocyte becomes competent and ready to be ovulated. In a randomized experimental design, an ovine model was used to optimize the standard in vitro maturation media by Granulosa secreted factors. At first, the development capacity of oocyte derived from medium (>4 to 6 mm) and small (2 to ≤4 mm) size follicles was determined. Differential gene expression of granulosa secreted factors and their receptors were compared between the cumulus cells of the two groups. Then, the best time and concentration for arresting oocytes at the germinal vesicle stage by natriuretic peptide type C (CNP) were determined by nuclear staining in both groups. Oocyte quality was further confirmed by calcein uptake and gene expression. The developmental competence of cumulus oocyte complexes derived from small size follicles that were cultured in the presence of CNP in combination with amphiregulin (AREG) and prostaglandin E2 (PGE2) for 24 h was determined. Finally, embryo quality was specified by assessing expressions of NANOG, SOX2, CDX2, OCT4, and TET1. The cumulus oocyte complexes derived from small size follicles had a lower capacity to form blastocyst in comparison with cumulus oocyte complexes derived from medium size follicles. Prostaglandin E receptor 2 and prostaglandin-endoperoxide synthase 2 had significantly lower expression in cumulus cells derived from small size follicles in comparison with cumulus cells derived from medium size follicles. Natriuretic peptide type C increased the percentage of cumulus oocyte complexes arresting at the germinal vesicle stage in both oocytes derived from medium and small follicles. Gap junction communication was also improved in the presence of natriuretic peptide type C. In oocytes derived from small size follicles; best blastocyst rates were achieved by sequential exposure of cumulus oocyte complexes in [TCM+CNP (6 h), then cultured in TCM+AREG+PGE2 (18h)] and [TCM+CNP (6 h), then cultured in conventional IVM supplements+AREG+PGE2 (18h)]. Increased SOX2 expression was observed in [TCM+CNP (6 h), then cultured in TCM+AREG+PGE2 (18h)], while decreased OCT4 expression was observed in [TCM+CNP (6 h), then cultured in conventional IVM supplements+AREG+PGE2 (18h)]. It seems that the natriuretic peptide type C modulates meiotic progression, and oocyte development is probably mediated by amphiregulin and prostaglandin E2. These results may provide an alternative IVM method to optimize in vitro embryo production in sheep and subsequently for humans.

Introduction

Perhaps the greatest challenge of assisted reproductive techniques is in vitro maturation. Edwards reported the first IVM in humans, and Cha showed the first live birth after IVM in a woman with premature ovarian failure (POF). Since then, a great result has been achieved by capacitation pre-maturation-IVM (CAPA-IVM). Despite this recent progress in CAPA-IVM, this method has not replaced the conventional IVM procedure in humans and other species [1–3].

Improved development of in vitro matured oocytes can only be achieved by expanding our knowledge regarding the complex dialog between the oocyte and its surrounding somatic cells within follicle [4,5]. Nevertheless, this has proven to be challenging because: 1) dealing with a heterogeneous population of oocytes harvested from follicles of different size (2–6 mm in sheep and goat, 2–8 mm in bovine and < 12mm in human) is a formidable issue; 2) cumulus oocyte complexes (COCs) derived from small antral follicles possess less competence in response to regulatory and specific ligands because of an immature signaling capacity [6–10]; and 3) Isolation of COCs from their natural follicular environment results in spontaneous meiotic progression and, thus, asynchronization of nuclear and cytoplasmic maturation [11].

Recent microarray analyses between developmentally competent and incompetent COCs identified differential expression of quality marker genes in human and bovine [12–15]. Based on these studies, critical deficiencies in IVM may be related to a lack of granulosa cell-COC communication. The well-known factors secreted from granulosa cells (GCs) during in vivo maturation process are natriuretic peptides (NPs), epidermal growth factor (EGF)-like factors, and prostaglandins (PGs) that regulated extracellular cellular matrix, metabolism and immune system [12,16–19].

Members of the NP peptides include atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and c-type natriuretic peptide (CNP). They are secreted by granulosa cells [20]. CNP is considered as the main NP and binds to natriuretic peptide receptor 2 (NPR2) on CCs, inducing the production of cyclic guanosine monophosphate (cGMP). Cyclic GMP enters oocyte via GJC and regulates levels of cyclic adenosine monophosphate (cAMP) by suppressing the hydrolyzing activity of oocyte-specific phosphodiesterases 3A (PDE3A). Increased cAMP level maintains meiotic arrest of immature oocytes within follicles [14, 21–23]. Besides, it has been stated that estradiol can mediate the expression of NPR2 on CCs [22].

EGF-like factors, AREG, epiregulin (EREG), and betacellulin (BTC) act on EGF receptor (EGFR) and activate the extracellular signal-regulated protein kinases 1 and 2 (ERK1/2), protein kinase C (PKC) pathways and other signaling pathways in granulosa and cumulus cells (CCs), which make the COCs competent to respond to Luteinizing hormone (LH) surge [17, 24]. One of the target genes of the ERK1/2 pathway is prostaglandin synthase 2 (PTGS2), which leads to the production of PGE2 through a positive feedback loop between AREG and PGE2. Prostaglandin E2 (PGE2), an arachidonic acid-derived lipid mediator, is an autocrine/paracrine factor that mediates gonadotrophin (Gn) stimulation of cumulus expansion and oocyte maturation [16, 25–28].

Culture of COCs in medium containing granulosa secreted factors has been suggested to increase the proximity of in vitro culture to in vivo condition and improve the efficiency of in vitro oocyte maturation, especially in COCs derived from small follicles (2 to ≤ 4mm) with lower developmental competence compared to follicles of ≥ 4 to 6mm or of greater size [29, 30]. Our goal is to select ovine as a model for human IVM in future studies.

To achieve this aim, we initially exposed COCs from small follicles to CNP for 6 h and then to TCM 199 as a base of routine culture medium in the presence of AREG and/or PGE2, and the results of each group were compared with their corresponding group.

Materials and methods

All procedures were approved by the Institutional Review Board of the Royan Institute (the ethical guidelines established by the Institutional Ethical Committee of the Royan Institute). The majority of chemicals and media were obtained from Sigma Chemical Co. (St. Louis, MO, USA) and Gibco (Grand Island, NY, USA), respectively. Other chemicals used for specific experiments from other companies are cited in the text as required.

In vitro maturation (IVM)

Ovine ovaries from a local abattoir were transported to the laboratory at 6:00 pm in saline (15°C–20°C) and stored for an additional 12 h at 15°C since the lab working hours start in the morning [31, 32]. COCs were isolated from medium (≥ 4 to 6 mm) and small (2 to ≤ 4 mm) size follicles with the aid of 21-G needles. COCs with more than three layers of cumulus cells and homogenous cytoplasm were washed with the HEPES tissue culture medium 199 (HTCM199) + 1 mg/mL PVA+ 4 mg/mL BSA. Finally, 50 COCs were cultured in 400 μl containing 1 mg/mL PVA+ 8 mg/mL BSA in each group, according to experimental design (Fig 1) in 4 well dishes without mineral oil for 24 h at 38.5°C and 5% CO2 in the air [33, 34].

Fig 1. Experimental design.

Fig 1

Nuclear status

COCs were treated with 300 IU/mL hyaluronidase and vortexes to remove CCs. Denuded oocytes (DOs) were subsequently fixed for 20 minutes in 4% paraformaldehyde. To visualize chromatin, DOs were stained with Hoechst 33342 (10 μg/mL) for 5 minutes. After mounting, images of stained oocytes were captured and assessed by high-resolution digital camera (DP-72 Olympus, Japan) using DP2-BSW software [35]. The percentage of oocytes at the GV stage in each group was determined.

Cumulus expansion index (CEI)

After 24 h IVM, CEI was scored on a 0 to 4 scale, as described by Vanderhyden et al., 1999: score 0, no expansion; score 1, no CC expansion but cells appear as spherical; score 2, only the outermost layers of CCs have expanded; score 3, all cell layers have expanded except the corona radiata; and score 4, expansion has occurred in all cell layers including the corona radiate [36].

In vitro fertilization (IVF)

Domestic sheep breed, Rouge de l'ouest, was used for in vitro fertilization. Motile sperms were separated using a swim-up preparation; 100 μl of fresh sperm (from a ram of proven fertility) was kept under Tyrode’s albumin lactate pyruvate medium in 5% CO2, 38.5°C, and humidified air for up to 45 minutes to allow motile sperm to swim up. Subsequently, insemination was carried out by adding 5×103 sperm/ matured COCs in fertilization medium (NaCl 114 mM, KCl 3.15 mM, NaH2PO4 0.39 mM, Na-lactate 13.3 mM, CaCl2 2 mM, MgCl2 0.5 mM, Na-pyruvate 0.2 mM, Penicillin 50 IU/ml, Streptomycin 50 μg/ml, NaHCO3 25 mM, Heparin 10 μg/ml, 6 mg/ml BSA) for 20 h at 38.5°C under 5% CO2 in humidified air overlaid with light mineral oil. On the next day, to remove the cumulus cells, the presumptive zygotes were vortexed in HTCM199 + 1mg/ml PVA+ 4mg/ml BSA for 3 minutes [37]. Then, they were cultured for 8 days in BO-IVC (Brackett-Oliphant in vitro culture) medium (Bioscience, UK) at 39°C, 6% CO2, 5% O2 in humidified air under mineral oil. Day 0 was defined as the day of insemination. Therefore, cleavage and blastocyst rates (over cleavage) were determined on days 3 and 7 post embryo culture.

Relative gene expression

In each group, at the desired time, CCs were collected from COCs after vortexing for 4 minutes. Then, CCs were separated from oocytes, and CCs were stored in RLT buffer at -70°C until RNA extraction. RNA was extracted from CCs with the aid of an RNeasyMini Kit (Qiagen) followed by DNase I (Fermenas; EN0521) treatment. Total RNA (1000 ng) was reverse-transcribed using a Takara cDNA Synthesis kit (Takara; #RR07A) according to the manufacturer’s instructions. The primers were designed using Beacon and Oligo7 softwares. Efficiency correction for each primer was performed by serial dilution of positive control cDNA as a template. Please note that we are comparing the level of expression within different periods; we have no control group. Therefore, the transcripts abundance of 6 genes (AREG, EGFR, NPPC, NPR2, PTGER2, PTGS2, GJA4, and GJA1) (Table 1) was normalized to B-actin as reference gene using 2^-(delta CT) rather than using 2^-(delta delta CT).

Table 1. Primer sequences.

Gene symbol Forward primer (5´-3´) Reverse primer (5´-3´) Annealing temp. (°C)
OCT4 GGAAAGGTGTTCAGCCA ATTCTCGTTGTTGTCAGC 57
NANOG CCTCTCAACATACAGCC TCTTATTGGACTCATTACC 51
SOX2 GAGAACAATGACACACCAA TGCTGAAATGAGGAGGAG 57
CDX2 CCCCAAGTGAAAACCAG TGAGAGCCCCAGTGTG 56
TET1 CGGAAGAAAGAAGGTCGTC GAATAACACCAAATGAGCGG 57
AREG ATACTGCTGGATTAGATG CTGTGGTTCATTATCATAC 49
EGFR ACAAGACAATAAGCCACTT CACCCAAAGGAGAGAAAG 50
NPPC CCAATCTCAAGGACGAC TTGGACAAACCCTTCTT 53
NPR2 AACTCCACTCTCAACTCTG CTCTGAATTGCCGAACTG 56
PTGS2 CTTCCAGCCGCAGTAG GGCATCTATGTCTCCGTA 58
PTGER2 CATCCTGAGACCTCCTGTTC CTACCACTTCTTAACTACCATCCT 58
GJA4 TCCTTCCTAATGACCAGAG GTAAGTTGTCTCCGAATCC 53
GJA1 GTGTCGTTGGTGTCTCTTG CAGTGGTAGTGTGGTAAGGA 61
β-actin CCATCGGCAATGAGCGGT CGTGTTGGCGTAGAGGTC 58

Total RNA of five blastocysts in each group that was stored in RLT buffer at -70°C was extracted with the aid of Micro- RNeasy kit (Qiagen, Canada). For reverse transcription, 14 μl of total RNA (1μg) was used in a final volume of 20 μl reaction that contained 1 μl of random hexamer, 2 μl RT buffer (10x), 1 μl of RNase inhibitor (40 IU), 1 μl of reverse transcriptase (Takara; #RR07A), and 1 μl DEPC water. Reverse transcription was carried out at 37°C for 15 minutes, followed by 85°C for 5 seconds. Moreover, real-time PCR was implemented using 1 μl of cDNA (50 ng), 5 μl of the SYBR Green qPCR Master Mix (2x) (Fermentas, Germany) and 1 μl of forward and reverse primers (5 pM) adjusted to a total volume of 10 μl using nuclease-free water. Real-time PCR program was 1) 95°C 4 min, 2) 94°C 10 s, 3) Ta 30 s, and 4) 72°C 30 s, for 40 cycles. The transcripts abundance of 5 genes (nanog homeobox (NANOG), SRY-Box transcription factor 2 (SOX2), caudal type homeobox 2 (CDX2), octamer-binding transcription factor 4 (OCT4) and ten-eleven translocation methylcytosine dioxygenase 1 (TET1)) (Table 1) were normalized to beta-actin as reference gene, and 2^-(delta delta CT) was presented.

Statistical analysis

Data percentages were modeled to a normal distribution by ArcSin transformation. Cleavage, blastocysts rates, and relative gene expression results among more than three groups were examined using a one-way ANOVA followed by Tukey’s post hoc tests (Figs 3–5, Fig 7 and Fig 9). The t-test was used for cleavage, blastocysts rates, and relative gene expression data between two groups (Fig 2, Fig 6 and Fig 8). The differences were considered significant at P<0.05. All results were presented as means ± standard error of the mean (SEM).

Fig 3. Gene expression of AREG, EGFR, NPPC, NPR2, PGE2, and PTGS2 between cumulus cells derived from medium (>4 to 6 mm) and small (2 to ≤4 mm) size follicles at 0, 12 and 24 h post- in vitro maturation in a conventional medium.

Fig 3

3 replicates and minimum number of cumulus cells in each replicate were 2×105. Different superscripts demonstrate significant differences (P<0.05) within columns with the same color. The asterisks represent significant differences between the two groups at the same time of maturation. 2^-(delta CT) was presented for gene expression. AREG: amphiregulin, NPPC: natriuretic peptide precursor C, PTGS2: prostaglandin-endoperoxide synthase 2, EGFR: epidermal growth factor receptor, NPR2: natriuretic peptide receptor B, PGE2: prostaglandin E synthase 2.

Fig 5. Percentage of oocytes at the GV stage during 24 h IVM in four experimental groups (TCM, E2, CNP, CNP+E2).

Fig 5

A: medium size follicles (>4 to 6 mm) B: small size follicles (2 to ≤4 mm). 3 replicates and the minimum number of oocytes in each replicate were 20. Different superscripts demonstrate significant differences (P<0.05) within columns with the same color. TCM: tissue culture medium, E2: estradiol, CNP: natriuretic peptide type C.

Fig 7. Developmental competence of COCs harvested from small size follicles (2 to ≤4 mm) in sheep sequentially exposed to CNP for 6 h, then cultured in TCM+PGE2 and/or AREG for 18 h.

Fig 7

Different superscripts demonstrated significant differences (P<0.05) within columns with the same color. 5 replicates and the minimum number of oocytes in each replicate were 50. TCM: tissue culture medium, CNP: natriuretic peptide type C, AREG: amphiregulin, PGE2: prostaglandin E2.

Fig 9. Assessment of relative expression of pluripotency and epigenetic markers in blastocysts derived from TCM, conventional IVM (24 h), [TCM+CNP (6 h), then cultured in TCM+AREG+PGE2 (18 h)] and [TCM+CNP (6 h), then cultured in conventional IVM supplements + AREG + PGE2 (18 h)] groups.

Fig 9

3 replicates and the minimum number of blastocysts in each replicate were 5. 2^-(delta delta CT) was presented. The asterisks represent significant differences within columns with the same color. TCM: tissue culture medium, CNP: natriuretic peptide type C, AREG: amphiregulin, PGE2: prostaglandin E2.

Fig 2. Developmental competency of in vitro conventional maturation of COCs derived from medium (>4 to 6 mm) compared to small (2 to ≤4 mm) size follicles.

Fig 2

5 replicates and minimum number of oocytes in each replicate were 50. Culture medium was conventional maturation medium containing TCM + LH (10μg/ml) + FSH (10μg/ml) + IGF (100ng/ml) + EGF (10ng/ml) + Cys (0.1mM) + FBS (15%) + E2 (1μg/ml). The asterisk represents a significant difference (P<0.05) within columns with the same color.

Fig 6.

Fig 6

A, B, C: Gene expression of GJA4 and GJA1 between TCM and CNP groups in medium (>4 to 6 mm) and small (2 to ≤4 mm) size follicles. 3 replicates and the minimum number of oocytes and cumulus cells in each replicate were 30 and 2×105 cells, respectively. D: Calcein uptake through gap junctions between TCM and CNP groups in COCs derived from small size follicles (2 to ≤4 mm). 3 replicates and the minimum number of oocytes in each replicate were 10. The asterisks represent a significant difference. GJA: gap junction protein alpha, TCM: tissue culture medium, CNP: natriuretic peptide type C.

Fig 8. In vitro development of COCs derived from medium (>4 to 6 mm) compared to small (2 to ≤4 mm) size follicles that cultured in TCM (control) or TCM+NP then cultured in TCM+AREG+PGE2 (treatment).

Fig 8

5 replicates and the minimum number of oocytes in each replicate were 50. The asterisks represent the significant difference for blastocyst rate in small size follicles. TCM: tissue culture medium, CNP: natriuretic peptide type C, AREG: amphiregulin, PGE2: prostaglandin E2.

Results

Comparison of developmental competence and gene expression between COCs derived from medium (>4 to 6 mm) and small (2 to ≤4 mm) size follicles

The COCs derived from small size follicles had a lower capacity to form blastocyst in comparison with COCs derived from medium size follicles [16.6 ± 5.0 vs. 42.9 ± 3.5; p<0.05; Fig 2; see the experimental design (Fig 1, part I)].

No significant difference was found for AREG gene expression between CCs derived from two groups at 3 time points. EGFR gene expression in CCs derived from medium size follicles at 12 h post-maturation was significantly higher than small size follicles (p<0.05). No significant difference was found for NPPC gene expression between CCs derived from two groups at 3 time points. NPR2 gene expression significantly declined during the first 12 h of maturation in CCs derived from small size follicles (p<0.05). Expressions of PTGER2 and PTGS2 genes between two groups at 3 time points were lower in CCs derived from small size follicles, except for PTGER2 that had higher expression in small compared with medium size follicles at 0h post-maturation (p<0.05, Fig 3).

Effects of CNP on meiotic arrest, relative gene expression, and gap junction’s communications

As the concentration of CNP increased (10, 100, 1000 nM), the percentage of oocytes derived from medium follicles remaining at the GV stage increased (P<0.05). In another group, there was no significant difference between 100 and 1000 nM of CNP (P>0.05, Fig 4). According to these results, concentrations of 1000 nM and 100 nM for CNP were selected for both medium and small size follicles, respectively [Fig 4, see the experimental design (Fig 1, part II)].

Fig 4. Determination of optimal concentration of CNP between oocytes derived from medium (>4 to 6 mm) and small (2 to ≤4 mm) size follicles.

Fig 4

3 replicates and the minimum number of oocytes in each replicate were 30. Different superscripts demonstrate significant differences (P<0.05). CNP: natriuretic peptide type C.

Meiotic progression of oocytes derived from medium follicles occurred around 6 h after the onset of IVM in TCM. The percentage of oocytes derived from medium size follicles at the GV stage after 24 h IVM was 20.3 ± 0.8 in TCM (Fig 5A). In this group, in the presence of CNP (1000 nM), the percentage of oocytes arrested at the GV stage after 24 h IVM was 71.7 ± 4.4 [Fig 5A, see the experimental design (Fig 1, part II)].

Meiotic progression of oocytes derived from small size follicles occurred around 8 h after the onset of IVM in TCM. The percentage of oocytes derived from small size follicles at the GV stage after 24 h IVM was 20.9 ± 2 in TCM (Fig 5B). In this group, in the presence of CNP (100 nM), the percentage of oocytes arrested at the GV stage after 24 h IVM was 37.3 ± 10.3 [Fig 5B, see the experimental design (Fig 1, part II)]. Our results also showed E2 independently or in the presence of CNP did not affect meiotic arrest (Fig 5A and 5B).

Both gene expression of gap junction protein alpha 1 and 4 (GJA1, GJA4) in cumulus cells and calcein uptake through gap junctions in COCs derived from small and medium size follicles increased in the presence of CNP. But in the oocyte, GJA4 gene expression in the presence of TCM or CNP in each group did not show any significant difference [Fig 6, see the experimental design (Fig 1, part II)].

Developmental competence of COCs in the presence of AREG and PGE2

Optimal concentration of AREG in COCs derived from small size follicles (2 to ≤4 mm) was 300 nM because of the highest CEI (1.93), rate of M II (46.453 ± 0.73), cleavage (75.7± 3.9) and blastocyst rates (41.5± 1.5) (Table 2) (P<0.05).

Table 2. Determination of optimal concentration of AREG in COCs derived from small size follicles.

Groups CEI M II (%) Cleavage Rate (%) Blastocyst Rate (%)
Control 0.21c 20.46 ± 2.11 b 63.70 ± 5.03 16.35± 3.07 b
50 nM AREG 0.92 b 42.043 ± 4.83 ab 70.67± 2.22 21.63± 2.70 b
100 nM AREG 1.20b 57.143 ± 9.18 a 71.90 ± 3.83 29.06± 4.76 ab
300 nM AREG 1.93 a 46.453 ± 0.73 a 75.71± 3.96 41.52± 1.51 a

CEI: cumulus expansion index, M II (%): Percentage of oocytes at the M II stage. Cleavage and Blastocyst rates were assessed by in vitro fertilization in COCs. Different superscripts demonstrate significant differences (P< 0.05) within each column. 5 replicates and the minimum number of oocytes in each replicate were 50, 20 and 20 for assessment of development, MII rate and CEI, respectively.

Optimal concentration of PGE2 in COCs derived from small size follicles (2 to ≤4 mm) was 10 μM because of the highest rate of blastocyst (38.40 ± 0.51), but M II (%) (39.1 ± 1.6) did not show significant difference in comparison with 0.1 μM (36.4 ± 4.1) and 1 μM (31.0 ± 4.0) PGE2 (P>0.05). Also, the cleavage rate was not different between groups. The highest CEI was achieved in the presence of 1 μM PGE2 (P<0.05) (Table 3).

Table 3. Determination of optimal concentration of PGE2 in COCs derived from small size follicles.

Groups CEI M II (%) Cleavage Rate (%) Blastocyst Rate (%)
Control 0.21c 21.07 ± 1.02 b 68.79 ± 2.27 20.16 ± 2.94 b
0.1 μM PGE2 1.22 b 31.05 ± 4.07 ab 73.15 ± 2.87 32.53 ± 8.3 b
1 μM PGE2 2.20a 36.4 ± 4.1 a 75.18 ± 2.58 30.67 ± 0.21 b
10 μM PGE2 1.42 b 39.18 ± 1.63 a 76.96 ± 3.2 38.40 ± 0.51 a

CEI: cumulus expansion index, M II (%): Percentage of oocytes at the M II stage. Cleavage and Blastocyst rates were assessed by in vitro fertilization in COCs. Different superscripts demonstrate significant differences (P< 0.05) within each column. 5 replicates and the minimum number of oocytes in each replicate were 50, 20 and 20 for assessment of development, MII rate, and CEI, respectively.

Developmental competence of sequential COCs exposure to CNP, AREG and/or PGE2

To achieve this aim, 6 experimental groups were designed [Fig 7, see the experimental design (Fig 1, part III)]. Sequential exposure of COCs to group 3 [TCM+CNP (6 h), then cultured in TCM+AREG (18 h)], group 5 [TCM+CNP (6 h), then cultured in TCM+ AREG+PGE2 (18 h)], and group 6 [TCM+CNP (6 h), then cultured in conventional IVM supplements+AREG+PGE2 (18h)] showed higher blastocyst yield in comparison with TCM (P<0.05). But, group 4 [TCM+CNP (6 h), then cultured in TCM+PGE2 (18 h)] showed lowest blastocyst yield in comparison with the three aforementioned (3, 5, 6) groups (P<0.05) (Fig 7).

Moreover, we checked for any differences between the [TCM+CNP (12 h), then cultured in TCM+AREG+PGE2 (12 h)] and [TCM+CNP (24 h), then cultured in TCM+AREG+PGE2 (24 h)] groups, but the development yields were not different for cleavage (97.56±5, 99±3.24) and blastocyst (26.22±1.5, 23±4.2) rates, respectively.

Also, CEI, cleavage and blastocyst rates of conventional IVM (24 h), [TCM+CNP (6 h), were compared, then cultured in TCM+AREG+PGE2 (18 h)] and [TCM+CNP (6 h), then cultured in conventional IVM supplements + AREG + PGE2 (18 h)]. It was seen that COCs in [TCM+CNP then cultured in conventional IVM supplements + AREG + PGE2] had higher CEI (3.56) and blastocyst rate (41±2.51) compared to conventional IVM (3.1 and 35.9± 5.0) and [TCM+CNP then cultured in TCM+AREG+PGE2] (3 and 34.9 ± 2.1) (P>0.05).

[TCM+CNP (6 h), then cultured in TCM+AREG+PGE2 (18 h)] could only improve the development of oocyte derived from small follicles (P<0.05) [Fig 8, see the experimental design (Fig 1, part III)]. In order to investigate whether [TCM+CNP (6 h), then cultured in TCM+AREG+PGE2 (18 h)] has the same effect on medium size follicles, we compared this treatment with TCM for medium size follicles. The results revealed no significant effect on cleavage and blastocyst rates in medium size follicles.

Assessment of pluripotency and epigenetic markers in blastocysts derived from small size follicles

The only significant difference in gene expression was for SOX2 which increased in the [TCM+CNP (6 h), then cultured in TCM+AREG+PGE2 (18 h)] group and for OCT4 which decreased in the [TCM+CNP (6 h), then cultured in conventional IVM supplements + AREG + PGE2 (18 h)] group (P<0.05). NANOG, CDX2, and TET1 did not show any significant differences among the groups (P>0.05) [Fig 9, (see Fig 1, part III)].

Discussion

One of the limiting factors in the application of IVM is a heterogeneous stage of follicles developing within or between ovaries. The heterogeneous populations of COCs derived from one ovary or different ovaries or from different abattoir have various developmental capacities or outcomes [10, 38]. Differences in morphology, adenosine triphosphate (ATP) content, metabolism, mitochondria distribution, protein, mRNA pattern, and methylation lead to different outcomes in in vitro production of the embryo (IVP) [10, 39]. Consistent with previous reports, in the present study, a reduction was observed in the developmental potential of ovine oocytes derived from small (2 to ≤ 4 mm) compared to medium (>4 to 6 mm) follicles, concluding that the follicular size affects developmental competency of COCs.

It is well defined that the isolation of COCs from the natural follicular environment results in spontaneous meiotic progression [40]. Granulosa cells under physiological conditions regulate the expression of transcripts like NPPC/NPR2, PTGER2 /PTGS2, AREG/EGFR involved in oocyte maturation, cumulus expansion, and ovulation through autocrine or paracrine mediators rather than circulating hormones [10, 28]. As we have shown, expression of these transcripts, especially PTGER2 /PTGS2, is lower in CCs isolated from small size follicles compared to medium ones. Also, our data showed that the relative NPR2 transcript level decreased by passing of time during maturation in CCs derived from small follicles. Thus, the addition of these factors during IVM may improve IVP outcomes.

When CNP binds to guanylyl cyclase (GC)-coupled NPR2, cGMP production increases, and oocytes are maintained at the GV stage [41]. Therefore, it is not surprising to see that the CNP or Npr2 knockout rodent model results in an early resumption of meiosis, concluding the role of CNP in meiotic arrest. Similar functions for NPs were reported in mice, human, goat, cattle, pig, sheep, rat, and cat [42, 43]. In summary, the higher mRNA abundance of NP receptors in the dominant or medium follicles compared to the subordinate or smaller size follicles may be used as an indicator of follicle health and suggests that NPs signaling may regulate steroidogenesis and/or cell proliferation and differentiation [44]. The present study showed that the addition of 1000 nM and 100 nM CNP could arrest the majority of COCs derived from medium and small follicles for 24 h and 12 h, respectively. Recently, some studies have shown 6 h of culture with CNP (100 nM) can enhance oocyte development in cattle and goat [45, 46]. Furthermore, markers of gap junction communication (GJA4 and GJA1) increased in the presence of CNP. Moreover, based on literature, chromatin configuration changes from non-surrounded nucleolus (NSN) to surrounded nucleolus (SN) during oocyte maturation, and this is regulated in vitro by NPs [47, 48]. Recently, a novel mechanism for the CNP-induced oocyte meiotic arrest has been introduced in bovine. Based on these results, bovine oocytes have NPR2 receptors and can mediate meiotic arrest [23]. Furthermore, inhibition of meiotic resumption with NPs instead of synthetic reagents like forskolin, PDE inhibitors and specific inhibitors of cyclin-dependent kinases (CDKs) and meiosis promoting factor (MPF) have been shown to have better outcomes as they maintain gap junction activity, and also support key gene expression, which are critical for oocyte development [49–51]. In addition, it has been stated that E2 can mediate NPR2 gene expression and may affect meiotic arrest [22]. Our results showed E2 independently or in the presence of CNP did not affect the meiotic arrest.

On the other hand, the final stage of oocyte maturation and ovulation is mediated by EGF-like peptides after surging with gonadotrophins. The mRNA levels of CNP in granulosa and Npr2 in cumulus cells reduce after LH/hCG treatment despite stimulation of EGF-like factors and activation of EGFR [44, 52]. But, according to our observation and other studies, the level of EGFR transcript decreases in the final stage of in vitro maturation in CCs derived from small size follicles. Therefore, it has been stated that the addition of AREG during maturation enhances bovine and porcine oocyte developmental competence [17, 42].

In ovulating follicles, the EGFR signaling cascade involves many other signaling networks in cumulus and granulosa cells, which participate in the development of oocyte competence. Follicle-stimulating hormone (FSH) mediates the induction of AREG mRNA via P38 mitogen-activated protein kinases (p38MAPK). AREG also induces PTGS2 expression via ERK1/2. PGs, also acting via PTGER2 in cumulus cells, provide a secondary, autocrine pathway to regulate expression of AREG in COCs. PGE2 acts on a group of G-protein-coupled receptors and can maintain high cAMP levels. PGE2 in our study resulted in mild cumulus expansion, similar to cow [53]. Previous findings indicate that the addition of PGE2 during IVM improves embryonic cell survival of blastocysts and post-hatching development. In this regard, PTGS2-/- mice present severe failure in the expansion of cumulus cells and extrusion of the first polar body. Our results also indicated that the addition of PGE2 improves cumulus expansion, percentage of MII oocytes, and developmental competency. Besides, we showed that all three factors (AREG, PGE2, and CNP) independently improved the development of COCs derived from small size follicles with TCM as a base medium [8, 14, 17, 43].

We also revealed that sequential exposure of ovine COCs to CNP then to AREG and/or PGE2 improved rate of blastocyst formation in [TCM+CNP, then cultured in TCM+AREG], [TCM+CNP, then cultured in TCM+AREG+PGE2], and [TCM+CNP, then cultured in conventional IVM supplements + AREG + PGE2] compared to TCM, with the best result observed in the latter group. Amongst the treatment groups, the latter also showed higher CEI compared to conventional IVM and [TCM + CNP, then cultured in TCM+AREG+PGE2].

Expansion of the extra-cellular matrix during oocyte maturation is essential for acquiring molecular machinery competence in vivo but in vitro overexpansion by promoting the hexosamine biosynthesis pathway (HBP) negatively influences in vitro oocyte competence [47, 54–56]. Therefore, despite higher CEI in this group, super developmental capacity was not observed.

Expression of embryo quality markers at RNA level revealed that their patterns were not different between conventional IVM, [TCM+CNP, then cultured in TCM+AREG+PGE2], and [TCM+CNP, then cultured in conventional IVM supplements + AREG+PGE2] for NANOG, CDX2, and TET1. But SOX2 significantly increased in [TCM+CNP (6 h), then cultured in AREG+PGE2], and OCT4 decreased in [TCM+CNP (6 h), then cultured in conventional IVM supplements + AREG + PGE2]. In mammals, despite specific species differences, the transcription of triad factors (NANOG, SOX2, and OCT4) is governed through feedback loops in a steady state. Therefore, knock-down of one factor results in the up-regulation of one or two of the other triad factors [57]. In the studies assessing temporal expression of the triad factors in ruminants, it was shown that the temporal expression of triads is stage-specific dependent, and the expression of OCT4 is induced during oocyte maturation and declines following development to blastocyst stage, while SOX2 and NANOG are transcribed during maternal/zygote transition and among triads, SOX2 presents the highest expression relative to references gene [58]. Therefore, the high expression of SOX2 in the treated group is consistent with the literature, and higher expression of SOX2 suggests improved zygote genomics activation in the treated group. Further emphasized, improved in vitro maturation in this group reflects itself in an improved effect on SOX2 expression. But, these propositions need further experiments and verifications. One of the shortcomings of this study is that we did not perform concomitant differential staining to observe whether this differential expression may have any effect on total cell numbers and cell allocations.

Conclusion

Despite interspecies differences among sheep with human and other farm animals, the sequential maturation of sheep oocyte by stimulating NP/NPR2, AREG/EGFR, and PGE2/PTGSR2 system can improve the quality of COCs that have reduced expression of these functional pathways, meaning that COCs derived from small size follicles are less competent due to lower expression of above genes. Therefore, based on the results of this study and others, the supplementation of IVM medium with products of COCs [59] and GCs secreted factors improves developmental capacity and is an alternative to synthetic chemical treatment.

Acknowledgments

We thank Professor Jeremy G Thompson, The University of Adelaide, for his helpful assistance suggesting the study and assistance with editing.

Data Availability

All relevant data are within the manuscript text, tables and figures.

Funding Statement

The authors received no specific funding for this work.

References

  • 1.Cha KY, Koo JJ, Ko JJ, Choi DH, Han SY, Yoon TK. Pregnancy after in vitro fertilization of human follicular oocytes collected from nonstimulated cycles, their culture in vitro and their transfer in a donor oocyte program. Fertility and sterility. 1991. January 1;55(1):109–13. 10.1016/s0015-0282(16)54068-0 [DOI] [PubMed] [Google Scholar]
  • 2.Edwards RG. Maturation in vitro of human ovarian oocytes. The Lancet. 1965. November 6;286(7419):926–9. [DOI] [PubMed] [Google Scholar]
  • 3.Vuong LN, Ho TM, Gilchrist RB, Smitz J. The Place of In Vitro Maturation in Assisted Reproductive Technology. Fertility & Reproduction. 2019. March 6;1(01):11–5. [Google Scholar]
  • 4.Gilchrist RB. Recent insights into oocyte–follicle cell interactions provide opportunities for the development of new approaches to in vitro maturation. Reproduction, Fertility and Development. 2010. December 7;23(1):23–31. [DOI] [PubMed] [Google Scholar]
  • 5.Coticchio G, Dal Canto M, Mignini Renzini M, Guglielmo MC, Brambillasca F, Turchi D, et al. Oocyte maturation: gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization. Human reproduction update. 2015. March 4;21(4):427–54. 10.1093/humupd/dmv011 [DOI] [PubMed] [Google Scholar]
  • 6.Chaube SK. Role of meiotic maturation regulatory factors in developmental competency of mammalian oocytes. HPPI. 2001;24:218–31. [Google Scholar]
  • 7.Kwak SS, Yoon JD, Cheong SA, Jeon Y, Lee E, Hyun SH. The new system of shorter porcine oocyte in vitro maturation (18 hours) using≥ 8 mm follicles derived from cumulus-oocyte complexes. Theriogenology. 2014. January 15;81(2):291–301. 10.1016/j.theriogenology.2013.09.028 [DOI] [PubMed] [Google Scholar]
  • 8.Sugimura S, Ritter LJ, Rose RD, Thompson JG, Smitz J, Mottershead DG, et al. Promotion of EGF receptor signaling improves the quality of low developmental competence oocytes. Developmental biology. 2015. July 15;403(2):139–49. 10.1016/j.ydbio.2015.05.008 [DOI] [PubMed] [Google Scholar]
  • 9.Yang M, Hall J, Fan Z, Regouski M, Meng Q, Rutigliano HM, et al. Oocytes from small and large follicles exhibit similar development competence following goat cloning despite their differences in meiotic and cytoplasmic maturation. Theriogenology. 2016. December 1;86(9):2302–11. 10.1016/j.theriogenology.2016.07.026 [DOI] [PubMed] [Google Scholar]
  • 10.Pandey S, Somal AN, Parmar MS, Gupta S, Chandra V, Sai Kumar G, et al. Comparative analysis of developmental and molecular correlates of developmental competence of buffalo oocytes derived from small and large follicles. Indian J Anim Sci. 2017. October 1;87:1194–9. [Google Scholar]
  • 11.Celik O, Celik N, Gungor S, Haberal ET, Aydin S. Selective regulation of oocyte meiotic events enhances progress in fertility preservation methods. Biochemistry insights. 2015. January;8:BCI-S28596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ouandaogo ZG, Frydman N, Hesters L, Assou S, Haouzi D, Dechaud H, et al. Differences in transcriptomic profiles of human cumulus cells isolated from oocytes at GV, MI and MII stages after in vivo and in vitro oocyte maturation. Human Reproduction. 2012. May 22;27(8):2438–47. 10.1093/humrep/des172 [DOI] [PubMed] [Google Scholar]
  • 13.Sugimura S, Kobayashi N, Okae H, Yamanouchi T, Matsuda H, Kojima T, et al. Transcriptomic signature of the follicular somatic compartment surrounding an oocyte with high developmental competence. Scientific reports. 2017. July 28;7(1):6815 10.1038/s41598-017-07039-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhang T, Fan X, Li R, Zhang C, Zhang J. Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes. Biochemical and biophysical research communications. 2018. February 26;497(1):200–6. 10.1016/j.bbrc.2018.02.054 [DOI] [PubMed] [Google Scholar]
  • 15.Zhang Y, Yan Z, Qing Q, Nisenblat V, Yu Y, Wang T, et al. Transcriptome Landscape of Human Oocytes and Granulosa Cells Throughout Folliculogenesis. bioRxiv. 2018. January 1:285445. [Google Scholar]
  • 16.Liu C, Sun W, Zhuo G, Zhang Z. Impacts of macrophage colony-stimulating factor (M-CSF) on the expression of natriuretic peptide precursor type C (NPPC) and regulation of meiotic resumption. Gynecological Endocrinology. 2019. April 3;35(4):320–3. 10.1080/09513590.2018.1532989 [DOI] [PubMed] [Google Scholar]
  • 17.Siqueira LC, Barreta MH, Gasperin B, Bohrer R, Santos JT, Junior JB, et al. Angiotensin II, progesterone, and prostaglandins are sequential steps in the pathway to bovine oocyte nuclear maturation. Theriogenology. 2012. June 1;77(9):1779–87. 10.1016/j.theriogenology.2011.12.022 [DOI] [PubMed] [Google Scholar]
  • 18.Sugimura S, Ritter LJ, Sutton-McDowall ML, Mottershead DG, Thompson JG, Gilchrist RB. Amphiregulin co-operates with bone morphogenetic protein 15 to increase bovine oocyte developmental competence: effects on gap junction-mediated metabolite supply. Molecular human reproduction. 2014. February 19;20(6):499–513. 10.1093/molehr/gau013 [DOI] [PubMed] [Google Scholar]
  • 19.Fang Y, Zhang X, Zhang J, Zhong R, Zhou D. Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Animal reproduction science. 2016. January 1;164:144–51. 10.1016/j.anireprosci.2015.11.022 [DOI] [PubMed] [Google Scholar]
  • 20.Brown HM, Dunning KR, Sutton-McDowall M, Gilchrist RB, Thompson JG, Russell DL. Failure to launch: aberrant cumulus gene expression during oocyte in vitro maturation. Reproduction. 2017. March 1;153(3):R109–20. 10.1530/REP-16-0426 [DOI] [PubMed] [Google Scholar]
  • 21.De Cesaro MP, Dos Santos JT, Ferst JG, Nobrega JE Jr, Rosa PR, Rovani MT, et al. Natriuretic peptide system regulation in granulosa cells during follicle deviation and ovulation in cattle. Reproduction in domestic animals. 2018. June;53(3):710–7. 10.1111/rda.13161 [DOI] [PubMed] [Google Scholar]
  • 22.Franciosi F, Coticchio G, Lodde V, Tessaro I, Modina SC, Fadini R, et al. Natriuretic peptide precursor C delays meiotic resumption and sustains gap junction-mediated communication in bovine cumulus-enclosed oocytes. Biology of reproduction. 2014. September 1;91(3):61–1. 10.1095/biolreprod.114.118869 [DOI] [PubMed] [Google Scholar]
  • 23.Kim SM, Kim SH, Cho KW, Young S. Expression of C-type Natriuretic Peptide and its Specific Guanylyl Cyclase-Coupled Receptor in Pig Ovarian Granulosa Cells.
  • 24.Xi G, An L, Jia Z, Tan K, Zhang J, Wang Z, et al. Natriuretic peptide receptor 2 (NPR2) localized in bovine oocyte underlies a unique mechanism for C-type natriuretic peptide (CNP)-induced meiotic arrest. Theriogenology. 2018. January 15;106:198–209. 10.1016/j.theriogenology.2017.09.003 [DOI] [PubMed] [Google Scholar]
  • 25.Shimada M, Umehara T, Hoshino Y. Roles of epidermal growth factor (EGF)-like factor in the ovulation process. Reproductive medicine and biology. 2016. October 1;15(4):201–16. 10.1007/s12522-016-0236-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nuttinck F, Gall L, Ruffini S, Laffont L, Clement L, Reinaud P, et al. PTGS2-related PGE2 affects oocyte MAPK phosphorylation and meiosis progression in cattle: late effects on early embryonic development. Biology of reproduction. 2011. June 1;84(6):1248–57. 10.1095/biolreprod.110.088211 [DOI] [PubMed] [Google Scholar]
  • 27.Marei WF, Abayasekara DR, Wathes DC, Fouladi-Nashta AA. Role of PTGS2-generated PGE2 during gonadotrophin-induced bovine oocyte maturation and cumulus cell expansion. Reproductive biomedicine online. 2014. March 1;28(3):388–400. 10.1016/j.rbmo.2013.11.005 [DOI] [PubMed] [Google Scholar]
  • 28.Blaha M, Prochazka R, Adamkova K, Nevoral J, Nemcova L. Prostaglandin E2 stimulates the expression of cumulus expansion-related genes in pigs: the role of protein kinase B. Prostaglandins & other lipid mediators. 2017. May 1;130:38–46. [DOI] [PubMed] [Google Scholar]
  • 29.Takahashi T, Hagiwara A, Ogiwara K. Prostaglandins in teleost ovulation: A review of the roles with a view to comparison with prostaglandins in mammalian ovulation. Molecular and cellular endocrinology. 2018. February 5;461:236–47. 10.1016/j.mce.2017.09.019 [DOI] [PubMed] [Google Scholar]
  • 30.Jahromi BN, Mosallanezhad Z, Matloob N, Davari M, Ghobadifar MA. The potential role of granulosa cells in the maturation rate of immature human oocytes and embryo development: A co-culture study. Clinical and experimental reproductive medicine. 2015. September 1;42(3):111–7. 10.5653/cerm.2015.42.3.111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sahu K, Gupta A, Sharma A, Tiwari M, Pandey AN, Prasad S, et al. Role of granulosa cell mitogen-activated protein kinase 3/1 in gonadotropin-mediated meiotic resumption from diplotene arrest of mammalian oocytes. Growth Factors. 2018. March 4;36(1–2):41–7. 10.1080/08977194.2018.1475372 [DOI] [PubMed] [Google Scholar]
  • 32.Pezhman M, Hosseini SM, Ostadhosseini S, Varnosfaderani SR, Sefid F, Nasr-Esfahani MH. Cathepsin B inhibitor improves developmental competency and cryo-tolerance of in vitro ovine embryos. BMC developmental biology. 2017. December;17(1):10 10.1186/s12861-017-0152-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sefid F, Ostadhosseini S, Hosseini SM, Zadegan FG, Pezhman M, Esfahani MH. Vitamin K2 improves developmental competency and cryo-tolerance of in vitro derived ovine blastocyst. Cryobiology. 2017. August 1;77:34–40. 10.1016/j.cryobiol.2017.06.001 [DOI] [PubMed] [Google Scholar]
  • 34.Varnosfaderani SR, Ostadhosseini S, Hajian M, Hosseini SM, Khashouei EA, Abbasi H, et al. Importance of the GDF9 signaling pathway on cumulus cell expansion and oocyte competency in sheep. Theriogenology. 2013. September 15;80(5):470–8. 10.1016/j.theriogenology.2013.05.009 [DOI] [PubMed] [Google Scholar]
  • 35.Varnosfaderani SR, Ostadhosseini S, Hosseini SM, Hajian M, Nasr-Esfahani MH. In vitro development of ovine oocytes cultured in the presence of GDF9 at chemically defined or undefined maturation medium. Small Ruminant Research. 2014. July 1;120(1):78–83. [Google Scholar]
  • 36.Azari-Dolatabad N, Rahmani HR, Hajian M, Ostadhosseini S, Hosseini SM, Nasr-Esfahani MH. Effects of cilostamide and/or forskolin on the meiotic resumption and development competence of growing ovine oocytes selected by brilliant cresyl blue staining. Theriogenology. 2016. May 1;85(8):1483–90. 10.1016/j.theriogenology.2016.01.008 [DOI] [PubMed] [Google Scholar]
  • 37.Vanderhyden BC, Caron PJ, Buccione R, Eppig JJ. Developmental pattern of the secretion of cumulus expansion-enabling factor by mouse oocytes and the role of oocytes in promoting granulosa cell differentiation. Developmental biology. 1990. August 1;140(2):307–17. 10.1016/0012-1606(90)90081-s [DOI] [PubMed] [Google Scholar]
  • 38.Moradi M, Riasi A, Ostadhosseini S, Hajian M, Hosseini M, Hosseinnia P, et al. Expression profile of FGF receptors in preimplantation ovine embryos and the effect of FGF2 and PD173074. Growth Factors. 2015. September 3;33(5–6):393–400. 10.3109/08977194.2015.1102138 [DOI] [PubMed] [Google Scholar]
  • 39.Palmerini MG, Nottola SA, Leoni GG, Succu S, Borshi X, Berlinguer F, et al. In vitro maturation is slowed in prepubertal lamb oocytes: ultrastructural evidences. Reproductive Biology and Endocrinology. 2014. December;12(1):115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Leoni GG, Palmerini MG, Satta V, Succu S, Pasciu V, Zinellu A, et al. Differences in the kinetic of the first meiotic division and in active mitochondrial distribution between prepubertal and adult oocytes mirror differences in their developmental competence in a sheep model. PLoS One. 2015. April 20;10(4):e0124911 10.1371/journal.pone.0124911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Oskouei BS, Pashaiasl M, Heidari MH, Salehi M, Veladi H, Pakdel FG, et al. Evaluation of mouse oocyte in vitro maturation developmental competency in dynamic culture systems by design and construction of a lab on a chip device and its comparison with conventional culture system. Cell Journal (Yakhteh). 2016. July;18(2):205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Conti M, Andersen CB, Richard F, Mehats C, Chun SY, Horner K, et al. Role of cyclic nucleotide signaling in oocyte maturation. Molecular and cellular endocrinology. 2002. February 22;187(1–2):153–9. 10.1016/s0303-7207(01)00686-4 [DOI] [PubMed] [Google Scholar]
  • 43.Romero S, Sánchez F, Lolicato F, Van Ranst H, Smitz J. Immature oocytes from unprimed juvenile mice become a valuable source for embryo production when using C-type natriuretic peptide as essential component of culture medium. Biology of reproduction. 2016. September 1;95(3):64–1. 10.1095/biolreprod.116.139808 [DOI] [PubMed] [Google Scholar]
  • 44.Sánchez F, Lolicato F, Romero S, De Vos M, Van Ranst H, Verheyen G, et al. An improved IVM method for cumulus-oocyte complexes from small follicles in polycystic ovary syndrome patients enhances oocyte competence and embryo yield. Human reproduction. 2017. August 30;32(10):2056–68. 10.1093/humrep/dex262 [DOI] [PubMed] [Google Scholar]
  • 45.dos Santos JT, De Cesaro MP, Ferst JG, Dau AM, da Rosa PR, Pasqual BM, et al. Luteinizing hormone upregulates NPPC and downregulates NPR3 mRNA abundance in bovine granulosa cells through activation of the EGF receptor. Theriogenology. 2018. October 1;119:28–34. 10.1016/j.theriogenology.2018.06.012 [DOI] [PubMed] [Google Scholar]
  • 46.Soto-Heras S, Paramio MT, Thompson JG. Effect of pre-maturation with C-type natriuretic peptide and 3-isobutyl-1-methylxanthine on cumulus-oocyte communication and oocyte developmental competence in cattle. Animal reproduction science. 2019. March 1;202:49–57. 10.1016/j.anireprosci.2019.01.007 [DOI] [PubMed] [Google Scholar]
  • 47.Soto-Heras S, Menéndez-Blanco I, Catalá MG, Izquierdo D, Thompson JG, Paramio MT. Biphasic in vitro maturation with C-type natriuretic peptide enhances the developmental competence of juvenile-goat oocytes. PloS one. 2019. August 23;14(8):e0221663 10.1371/journal.pone.0221663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zuccotti M, Merico V, Cecconi S, Redi CA, Garagna S. What does it take to make a developmentally competent mammalian egg?. Human reproduction update. 2011. March 28;17(4):525–40. 10.1093/humupd/dmr009 [DOI] [PubMed] [Google Scholar]
  • 49.Sun MJ, Zhu S, Li YW, Lin J, Gong S, Jiao GZ, et al. An essential role for the intra-oocyte MAPK activity in the NSN-to-SN transition of germinal vesicle chromatin configuration in porcine oocytes. Scientific reports. 2016. March 24;6:23555 10.1038/srep23555 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kawashima I, Okazaki T, Noma N, Nishibori M, Yamashita Y, Shimada M. Sequential exposure of porcine cumulus cells to FSH and/or LH is critical for appropriate expression of steroidogenic and ovulation-related genes that impact oocyte maturation in vivo and in vitro. Reproduction. 2008. July 1;136(1):9 10.1530/REP-08-0074 [DOI] [PubMed] [Google Scholar]
  • 51.Caixeta FM, Sousa RV, Guimarães AL, Leme LO, Sprícigo JF, Netto SS, et al. Meiotic arrest as an alternative to increase the production of bovine embryos by somatic cell nuclear transfer. Zygote. 2017. February;25(1):32–40. 10.1017/S0967199416000289 [DOI] [PubMed] [Google Scholar]
  • 52.Egbert JR, Yee SP, Jaffe LA. Luteinizing hormone signaling phosphorylates and activates the cyclic GMP phosphodiesterase PDE5 in mouse ovarian follicles, contributing an additional component to the hormonally induced decrease in cyclic GMP that reinitiates meiosis. Developmental biology. 2018. March 1;435(1):6–14. 10.1016/j.ydbio.2018.01.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Shimada M, Hernandez-Gonzalez I, Gonzalez-Robayna I, Richards JS. Paracrine and autocrine regulation of epidermal growth factor-like factors in cumulus oocyte complexes (COCs) and granulosa cells: key roles for prostaglandin synthase 2 and progesterone receptor. Molecular Endocrinology. 2006. June 1;20(6):1352–65. 10.1210/me.2005-0504 [DOI] [PubMed] [Google Scholar]
  • 54.Nuttinck F, Jouneau A, Charpigny G, Hue I, Richard C, Adenot P, et al. Prosurvival effect of cumulus prostaglandin G/H synthase 2/prostaglandin2 signaling on bovine blastocyst: impact on in vivo posthatching development. Biology of reproduction. 2017. March 1;96(3):531–41. 10.1095/biolreprod.116.145367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Thompson JG, Lane M, Gilchrist RB. Metabolism of the bovine cumulus-oocyte complex and influence on subsequent developmental competence. Society of Reproduction and Fertility supplement. 2007. April 1;64:179 10.5661/rdr-vi-179 [DOI] [PubMed] [Google Scholar]
  • 56.Hu S, Rao M, Lei H, Wu Y, Wang Y, Ke D, et al. Expression patterns of p38αMAPK during follicular development in the ovaries of neonatal rats. Acta histochemica. 2017. June 1;119(5):538–42. 10.1016/j.acthis.2017.05.007 [DOI] [PubMed] [Google Scholar]
  • 57.Habibi R, Hosseini SM, Zadegan FG, Hajian M, Ostadhosseini S, Vash NT, et al. Functional characterization of NANOG in goat pre-implantation embryonic development. Theriogenology. 2018. October 15;120:33–9. 10.1016/j.theriogenology.2018.07.023 [DOI] [PubMed] [Google Scholar]
  • 58.HosseinNia P, Hajian M, Tahmoorespur M, Hosseini SM, Ostadhosseini S, et al. Expression Profile of Developmentally Important Genes in preand peri-Implantation Goat Embryos Produced In Vitro. International journal of fertility & sterility. 2016. October;10(3):310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Mottershead DG, Sugimura S, Al-Musawi SL, Li JJ, Richani D, White MA, et al. Cumulin, an oocyte-secreted heterodimer of the transforming growth factor-β family, is a potent activator of granulosa cells and improves oocyte quality. Journal of Biological Chemistry. 2015. September 25;290(39):24007–20. 10.1074/jbc.M115.671487 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Wilfried A Kues

15 Oct 2019

PONE-D-19-25159

Granulosa secreted factors improve developmental competence of cumulus-oocyte complexes from small antral follicles

PLOS ONE

Dear Dr nasr esfahani,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

In addition to the concerns regarding the content, pay particular attention to the English. Write in full sentencences instead using symbols (for example the used arrows, ll 34-38, but also ll358-380). Please mention the species in the title, and avoid abbreviations  in the Abstract.

We would appreciate receiving your revised manuscript by Nov 29 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Wilfried A. Kues, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional details regarding the sperm used in your study and ensure you have described the source. For more information regarding PLOS' policy on materials sharing and reporting, see https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-materials.

3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In the manuscript (granulosa secreted factors improve developmental competence of cumulus-oocyte complexes from small antral follicles - PONE-D-19-25159) by Shiva R. Varnosfaderani et al., the authors assess IVM in sheep oocytes originating from follicles of different sizes, and the effects of CNP, AREG and PGE2 on the development of those oocytes. Findings reported in this manuscript are of interest, but several major concerns have been identified.

Comments:

1. Experimental groups should be renamed and better defined to make figures cleaner and easier to understand. For example: ‘small’ and ‘large’ instead of ‘2 to ≤ 4mm’ and ‘≥ 4 to 6 mm’.

2. There are a considerable amount of grammatical and syntax errors throughout the manuscript. Pay special attention to the tense and plurality of words and phrases.

3. It is stated in the materials and methods section that ovaries were collected in saline and stored for an additional 12 hours at 15 °C. However, no explanation or purpose for this resting period and exposure to low temperatures was given.

4. Figure 1 showing the experimental design is helpful since it allows to the reader to understand what was done quickly. However, the figures referenced in it, do not match the figure order in the manuscript, and groups should be renamed to make it easier to understand.

5. In Figure 2, you show the cleavage and blastocyst rate among follicle sizes. Cleavage rates are shown to be over 90%, and yet later in a subsequent experiment, it is shown that maturation rates are below 80%. How do you account for these incongruences? Were non-mature oocytes removed in figure 2?

6. The groupings in figures should be consistent, with small follicles always on the left and large follicles always on the right, since, as it stands at the moment, small are sometimes on the left and sometimes on the right, and vice-versa.

7. The scales in the figures are also inconsistent, for example, in figure 5, the scale goes to 120%, this is redundant as it 100% would be the maximum.

8. In figure 3, what is the purpose of showing zero hour exposure? This should simply be the control.

9. In figure 4, the groupings and methodology for those groupings are unclear and poorly defined. How can you compare different CNP concentrations among follicle sizes, if they were matured for different time lengths? Furthermore, explicit explanation for this must be defined about this within the text.

10. In figure 5, it is impossible to compare small and large follicles since according to figure 4, they were matured for different lengths, with different CNP concentrations.

11. It is unclear what the differences between ‘CNP 6h � (A + P)18h’ and ‘CNP 6h � (Conventional IVM + A + P)18h’ are.

12. In Figure 9, why are there no error bars in the control TCM group? The huge change in the SOX2 expression in the ‘CNP � AREG + PGE2’ group must be explained and considered with more depth in the discussion section.

13. The materials and methods section is also unclear about specific experiments. What was the n in each experiment? How was blastocyst rate calculated (over cleavage or over oocyte?), were non-mature oocytes removed?

14. The discussion section is long and a little unfocused. For example, the first paragraph talks about IVM and how it relates to ART in human medicine, which is redundant in a manuscript using the ovine model.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Mar 17;15(3):e0229043. doi: 10.1371/journal.pone.0229043.r002

Author response to Decision Letter 0


2 Dec 2019

Dear Dr. Wilfried A. Kues,

Hereby, we are submitting the revised version of our manuscript entitled: “Granulosa secreted factors improve developmental competence of cumulus-oocyte complexes from small antral follicles” (PONE-D-19-25159). We would like to thank you and respected reviewer for their valuable comments. Below are our responses to the editor's and reviewers’ comments. The original comments of the Editor's and reviewers are in black and our responses are in blue. For better check out, the implemented changes were defined as underlined in the revised manuscript. We hope the changes are satisfactory.

Best Regards

M. H. Nasr-Esfahani,

Email: mh.nasr-esfahani@royaninstitute.org

Editor comments:

In addition to the concerns regarding the content, pay particular attention to the English. Write in full sentencences instead using symbols (for example the used arrows, ll 34-38, but also ll358-380). Please mention the species in the title, and avoid abbreviations in the Abstract.

Reply:

Thanks for your comments; the manuscript was edited by a native English speaker. We hope the substantial changes are satisfactory.

The name of sheep has been added to the title of the article.

Abbreviations were removed from the abstract.

The symbols were also removed in the text.

All above changes were underlined in the text.

Journal Requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

Reply: The PLOS ONE's style is implemented we hope the changes are satisfactory.

2. In your Methods section, please provide additional details regarding the sperm used in your study and ensure you have described the source. For more information regarding PLOS' policy on materials sharing and reporting, see https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-materials.

Reply: Details were added to the Methods section (L: 112, 138, 163, 185).

3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Reply: The information for this section was added (L: 290, 293).

Reviewer comments:

Reviewer #1: In the manuscript (granulosa secreted factors improve developmental competence of cumulus-oocyte complexes from small antral follicles - PONE-D-19-25159) by Shiva R. Varnosfaderani et al., the authors assess IVM in sheep oocytes originating from follicles of different sizes, and the effects of CNP, AREG and PGE2 on the development of those oocytes. Findings reported in this manuscript are of interest, but several major concerns have been identified.

Thanks, we have addressed the issues raised (statistical analysis section, groups name and English) and the paper have modified accordingly. We hope the changes are satisfactory.

1. Experimental groups should be renamed and better defined to make figures cleaner and easier to understand. For example: ‘small’ and ‘large’ instead of ‘2 to ≤ 4mm’ and ‘≥ 4 to 6 mm’.

Reply: Experimental groups renamed in the text. The symbols (�) were also removed in the text. Also, ‘2 to ≤ 4mm’ and ‘≥ 4 to 6 mm’ defined to ‘small’ and ‘medium’. All changes were underlined in the text.

2. There are a considerable amount of grammatical and syntax errors throughout the manuscript. Pay special attention to the tense and plurality of words and phrases.

Reply: Grammatical, syntax errors, tense, plurality of words and phrases throughout the manuscript was edited to best of our ability and we hope the changes is satisfactory.

3. It is stated in the materials and methods section that ovaries were collected in saline and stored for an additional 12 hours at 15 °C. However, no explanation or purpose for this resting period and exposure to low temperatures was given.

Reply: L:112-114 was rewritten and please see the below reason, we provided a reference for this.

In our country, local slaughterhouses (Fasaran slaughterhouse in Isfahan, Iran) get started at 2:00 PM and store meat in refrigerator for 12 hours to complete rigor mortis. Thus, ovaries are transported and arrived into the lab at 6:00 PM. Since the lab working hours starts in the morning, they are stored at 15 °C for 12 hours. It is worth noting that this temperature and the duration are set up in our lab as the best conditions for maintenance of ovaries based on pervious literature (ref:32,33).

4. Figure 1 showing the experimental design is helpful since it allows to the reader to understand what was done quickly. However, the figures referenced in it, do not match the figure order in the manuscript, and groups should be renamed to make it easier to understand.

Reply: Thank you for your precision. We have checked and corrected the order. Please see Figure 1.

5. In Figure 2, you show the cleavage and blastocyst rate among follicle sizes. Cleavage rates are shown to be over 90%, and yet later in a subsequent experiment, it is shown that maturation rates are below 80%. How do you account for these incongruences? Were non-mature oocytes removed in figure 2?

Reply: Thanks for your precision. Please note that for IVM (Figure 2) the medium contain all the ingredients or supplements to show that small follicles are less component than large follicles. While in the remaining experiments, the IVM medium is simple TCM and one or two or more component of the supplements. Therefore, lower maturation rate is not unexpected. To make the point easier for readers the text (group’s name) was modified.

6. The groupings in figures should be consistent, with small follicles always on the left and large follicles always on the right, since, as it stands at the moment, small are sometimes on the left and sometimes on the right, and vice-versa.

Reply: Thank you for your precision. This note was corrected in Figure 6 and the text.

7. The scales in the figures are also inconsistent, for example, in figure 5, the scale goes to 120%, this is redundant as it 100% would be the maximum.

Reply: Thanks, this note was corrected.

8. In figure 3, what is the purpose of showing zero hour exposure? This should simply be the control.

Reply: To show the trend of mRNA changes over the IVM period, 2^-(delta CT) was presented. Please see the changes in the text (L: 163).

9. In figure 4, the groupings and methodology for those groupings are unclear and poorly defined. How can you compare different CNP concentrations among follicle sizes, if they were matured for different time lengths? Furthermore, explicit explanation for this must be defined about this within the text.

Reply: Thanks, yes, we did not compare the small and large follicles. For better readout we separated the groups in Fig 4.

10. In figure 5, it is impossible to compare small and large follicles since according to figure 4, they were matured for different lengths, with different CNP concentrations.

Reply: Yes, you are correct and we did not compare the small and large follicles. But to make the point clear we have modified the text (L: 238-248).

11. It is unclear what the differences between ‘CNP 6h � (A + P)18h’ and ‘CNP 6h � (Conventional IVM + A + P)18h’ are.

Reply: Conventional IVM contains TCM + LH (10µg/ml) + FSH (10µg/ml) + IGF (100ng/ml) + EGF (10ng/ml) + Cys (0.1mM) + FBS (15%) + E2 (1µg/ml). For better readout of the manuscript this information was added where appropriate (Figure1, L: 203).

12. In Figure 9, why are there no error bars in the control TCM group?

Reply: Thanks, as we used the formula 2^-(delta delta CT) and the data is normalized with control (TCM) therefore, our control group (TCM) would always one and therefore, the error bar would be zero, that cannot be shown.

Compared the expression of the target genet compared to the huge change in the SOX2 expression in the ‘CNP � AREG + PGE2’ group must be explained and considered with more depth in the discussion section.

Reply: Thanks for your constructive comment. We search the literature and we believe we reach a better explanation. Therefore, that paragraph was removed and a new paragraph was added.

13. The materials and methods section is also unclear about specific experiments. What was the n in each experiment? How was blastocyst rate calculated (over cleavage or over oocyte?), were non-mature oocytes removed?

Reply: Numbers were added to figure legends. Blastocysts rate was over cleavage and added in the text (L: 152). Details were added to the Methods section (L: 112, 138, 163, 185).

14. The discussion section is long and a little unfocused. For example, the first paragraph talks about IVM and how it relates to ART in human medicine, which is redundant in a manuscript using the ovine model.

Reply: Discussion was shortened and unnecessary information (first paragraph) was deleted. All changes were underlined in the text.

Attachment

Submitted filename: reply to PLOS ONE .docx

Decision Letter 1

Wilfried A Kues

18 Dec 2019

PONE-D-19-25159R1

Granulosa secreted factors improve developmental competence of cumulus-oocyte complexes from small antral follicles in sheep

PLOS ONE

Dear Dr nasr esfahani,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Feb 01 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Wilfried A. Kues, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The revised manuscript has been significantly improved and all the major concerns were addressed.

Compared to the first version, major improvements have been made to the grammar making the manuscript much easier to read and understand. However, some minor grammar mistakes still persist.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Mar 17;15(3):e0229043. doi: 10.1371/journal.pone.0229043.r004

Author response to Decision Letter 1


27 Jan 2020

Dear Dr. Wilfried A. Kues,

Hereby, we are submitting the revised version of our manuscript entitled: “Granulosa secreted factors improve the developmental competence of cumulus oocyte complexes from small antral follicles” (PONE-D-19-25159R2).

We would like to thank you and respected reviewer for valuable comments. The original comment is in black and our response is in blue. For better check out, the implemented changes were defined as underlined in the revised manuscript. We hope it has now acquired the high status to meet the requirements for publication in your esteemed journal.

Best Regards

M. H. Nasr-Esfahani,

Email: mh.nasr-esfahani@royaninstitute.org

Reviewer comment:

Reviewer #1: The revised manuscript has been significantly improved and all the major concerns were addressed. Compared to the first version, major improvements have been made to the grammar making the manuscript much easier to read and understand. However, some minor grammar mistakes still persist.

Reply: The authors appreciate the reviewer’s valuable comment. All grammar mistakes throughout the manuscript were carefully edited, and we hope the changes are satisfactory. All changes were underlined in the text.

Attachment

Submitted filename: reply to PLOS ONE .docx

Decision Letter 2

Wilfried A Kues

29 Jan 2020

Granulosa secreted factors improve the developmental competence of cumulus oocyte complexes from small antral follicles in sheep

PONE-D-19-25159R2

Dear Dr. nasr esfahani,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Wilfried A. Kues, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Wilfried A Kues

3 Feb 2020

PONE-D-19-25159R2

Granulosa secreted factors improve the developmental competence of cumulus oocyte complexes from small antral follicles in sheep

Dear Dr. nasr esfahani:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Wilfried A. Kues

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: reply to PLOS ONE .docx

    Attachment

    Submitted filename: reply to PLOS ONE .docx

    Data Availability Statement

    All relevant data are within the manuscript text, tables and figures.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES