Isolation and molecular characterization of coxsackievirus A6 and coxsackievirus A16 from a case of recurrent Hand, Foot and Mouth Disease in Mumbai, Maharashtra, India, 2018

Abstract

Hand, Foot and Mouth Disease (HFMD) is caused by multiple Enterovirus (EV) serotypes mainly coxsackievirus A6 (CV-A6), coxsackievirus A16 (CV-A16) and Enterovirus 71 (EV-A71). Recurrent HFMD infections are rarely reported. An unusual rise in HFMD cases was reported in Mumbai during May–June 2018. Stool and throat swab specimens were referred from seven children from two hospitals for laboratory diagnosis. The age group of cases ranged from 9 months to 5 years with median age 13 months. Out of seven cases, three were males and four females. One 13-month-old female case was reported twice within 21 days. Stool, throat swab specimens were tested by pan enterovirus RT-PCR and also by virus isolation using human rhabdomyosarcoma cell line for detection of Enteroviruses. Out of seven HFMD cases, CV-A6 and CV-A16 viruses were isolated from five and two cases respectively. The phylogenetic analysis of CV-A6 viruses showed their similarity with CV-A6 viruses from Finland and China, whereas the two CV-A16 isolates showed similarity with those from Japan, France, China, Sarawak and Thailand. For the recurrent HFMD case, CV-A6 and CV-A16 were isolated from the stool specimens collected during the first and second episodes, respectively. There are no reports of isolation and molecular characterization of CV-A6 and CV-A16 viruses from recurrent HFMD cases. The present study reports molecular characterization of two Enterovirus serotypes CV-A6 and CV-A16 from a recurrent HFMD case, highlighting need of virological and molecular surveillance of HFMD.

Hand, Foot and Mouth Disease (HFMD) is an infectious, self-limiting disease affecting mostly children younger than 5 years of age for a short duration of approximately 7 to 10 days. It is highly contagious and spreads in the community in close contacts. It is caused by multiple Enterovirus (EV) serotypes mainly coxsackievirus A6 (CV-A6), coxsackievirus A16 (CV-A16) and Enterovirus 71 (EV-A71). The symptoms include fever, blisters on the hands and feet, and vesicles in the mouth with occasional development of neurological complications which can be fatal mainly due to EV-A71 infection [9]. The infection is diagnosed mainly based on clinical manifestations; however, confirmation is done by detection and isolation of the virus from throat swabs, stool and/or vesicular fluid specimens. Sporadic cases as well outbreaks of HFMD have been reported worldwide. Co-circulation of multiple Enteroviruses has also been reported. Re-infection or recurrence of HFMD is uncommon and reported rarely without viral etiology.

In Mumbai, HFMD cases are generally reported during the months September–November, which is a winter season [15]. However, there were reports of HFMD cases in South Mumbai in the months of May–June 2018, which is a summer and pre-monsoon season, suggesting an unusual inter-seasonal occurrence of HFMD. One case showed recurrent infection of HFMD. The present study reports findings of molecular characterization of two Enterovirus serotypes CV-A6 and CV-A16 from a recurrent HFMD case.

Cases of HFMD were reported in Mumbai during May–June, 2018. A case of Hand, Foot and Mouth Disease was defined as maculopapular rashes and/or vesicles on palms, elbows, trunk, buttocks, knees or soles, ulcers in the mouth with or without fever in children. Written consent for specimen collection was obtained from the parents by the hospital authorities.

Stool and throat swab specimens were referred from seven children from two hospitals. The age group of the seven cases ranged from 9 months to 5 years with a median age of 13 months. Out of seven cases, three were males and four females. One 13-month-old female case was reported twice within 21 days (first visit on 23 May, 2018 and second visit on 15 June, 2018) to the paediatrician in South Mumbai, from whom two stool specimens were collected during two visits. All the specimens were stored at 4 to 8 °C until transported to the laboratory and one throat swab and eight stool specimens were processed at the ICMR-National Institute of Virology, Mumbai Unit.

All specimens were tested using Enterovirus-specific reverse-transcription PCR (RT-PCR) for direct detection of Enteroviruses. In addition, the specimens were inoculated onto human rhabdomyosarcoma (RD) cells for virus isolation. Specimens showing cytopathic effect (CPE) were processed for EV typing by partial or complete VP1 sequencing.

Virus isolation was performed using RD cells as per the protocol mentioned in the WHO Laboratory Manual [20]. The cultures were incubated at 37 °C and CPE was observed for 5 days. Specimens were scored negative when three serial passages were negative for presence of CPE. Once CPE was observed, tissue culture material was harvested for RNA extraction using QIAGEN Mini RNA Extraction Kit according to the manufacturer’s instructions (Qiagen, Germany).

Pan-EV RT-PCR was performed using primers EV1 and EV2 [22]. Partial VP1 gene (RT-snPCR) and completeVP1 PCR were performed as described earlier [10, 12, 13]. Details of primers used in this study are given in Table 1. QIAquick Gel Extraction Kit (Qiagen, Germany) was used for purification of partial and complete VP1 PCR products for sequencing using ABI 3130xlautomated sequencer. Virus serotypes were identified using BLASTn program from GenBank [11]. The sequences have been deposited in GenBank under the accession numbers MH780756, MH780757, MH796397 to MH796401.

Table 1.

Primers used for EV PCR amplification and sequencing

Primers	Sequences (5′–3′)	Region	Nucleotide positions
EV1	ACACGGACACCCAAAGTAGTCGGTTCC	5′NTR	539–565
EV2	TCCGGCCCCTGAATGCGGCTAATCC	5′NTR	452–476
AN89	CAGCACTGACAGCAGYNGARAYNGG	VP1	2602–2627
AN88	TACTGGACCACCTGGNGGNAYRWACAT	VP1	2977–2951
224	GCIATGYTIGGIACICAYRT	VP3	1977–1996
222	CICCIGGIGGIAYRWACAT	VP1	2969–2951
011	GCICCIGAYTGITGICCRAA	2A	3408–3389
240	ATICCICCRCARTCICCIGG	2A	3690–3671

The complete genome was determined using Illumina Miniseq platform [21]. The reads generated from the run were analyzed using CLC Genomics Workbench software Version 10 (CLC, Qiagen). Both, reference mapping and de-novo method were used to retrieve the complete sequences of the etiological agent. Maximum likelihood tree was constructed for both, VP1 gene and complete genome using MEGA software version 7. A bootstrap of 1000 replication was performed.

A total of nine specimens (one throat swab, and eight stools) collected from seven cases with typical symptoms of HFMD were tested using pan EV RT-PCR. All stool specimens were positive for presence of EV RNA, while throat swab was negative.

The stool specimens inoculated in RD cell cultures showed CPE, however the throat swab specimen was negative in RD cell culture. The partial and complete VP1 PCR products were sequenced to determine the EV serotypes of the viral isolates. The sequence analysis using BLASTn program showed that sequences of five specimens were similar to CV-A6 virus and sequences of three specimens were similar to CV-A16 virus. Interestingly, two stool specimens collected from the 13-month-old female child within an interval of 21 days showed recurrent infections with two enterovirus serotypes CV-A6 and CV-A16 in two independent episodes of HFMD infections.

The complete VP1 sequences of seven virus isolates were used for phylogenetic analysis. Also, the complete VP1 sequences of EV species A strains, poliovirus type 1 (PV-1 Sabin), coxsakievirus B5 (CV-B5) and enterovirus D68 (EV-68) prototype viruses retrieved from GenBank were included in the analysis. Phylogenetic analysis of the VP1 sequences obtained from seven isolates demonstrated that the five isolates clustered with CV-A6 isolates and the remaining two isolates with CV-A16 isolates (Fig. 1a). All five CV-A6 isolates were genetically close to each other with sequence similarity of > 99%. Similarly, both CV-A16 isolates showed > 99% sequence similarity. The present study shows that HFMD infections in Mumbai were caused by CV-A6 and CV-A16 viruses. The phylogenetic analysis of CV-A6 viruses showed their similarity with CV-A16 viruses from Finland and China, whereas the two CV-A16 isolates showed similarity with CV-A16 viruses from Japan, France, China, Sarawak and Thailand. No EV-A71 was isolated from any case during the outbreak. The complete genome sequencing of two isolates of the recurrent HFMD case was performed, which showed that both CV-A6 and CV-A16 viruses from a case with recurrent infection were similar to the other viruses isolated from Mumbai during this episode (Fig. 1b).

Fig. 1.

Genetic relationship of a complete VP1 sequences of enteroviruses isolated from HFMD cases in Mumbai, India during May–June, 2018 with all known enterovirus serotypes of A species. For enterovirus species A, outgroup names indicate enterovirus type, prototype name and GenBank accession number b complete genome of enteroviruses isolated from recurrent case of HFMD

In the past two decades, several outbreaks of HFMD have been reported from South East Asian countries, including Malaysia, Japan, Singapore, Vietnam, Cambodia and China [1, 5] and also in recent years from many parts of India [8, 16–18]. However, there is no systematic surveillance performed in India to study the disease burden of HFMD.

HFMD cases have been reported in Mumbai during September–November, which is a winter season (personal communication). However, in 2018 unusually high number of cases were reported during May–June 2018, which is a summer and pre-monsoon season in Mumbai.

Most studies on HFMD from sporadic cases or from outbreaks in different parts of India are based on the clinical findings without any viral etiology [8, 15–18]. The present study showed co-circulation of CV-A6 and CV-A16 during May–June, 2018 in Mumbai causing HFMD using the RT-PCR and sequencing of the entire VP1 gene of the viral isolates. Co-circulation of multiple EV serotypes have also been documented from HFMD cases from Bhubaneswar, Odisha in 2009 [8], southern and eastern parts of India during 2009–2010 [4], and North Kerala in 2015–2016 [14] suggesting CV-A6 and CV-A16 being the predominant Enteroviruses causing HFMD in India. Younger children are mostly at high risk of recurrent HFMD from multiple Enterovirus serotypes as compared to children belonging to the higher age group.

The most significant observation of the present study was the recurrent HFMD infection caused by CV-A6 and CV-A16 in a 13-month-old female child in Mumbai, India within 21 days’ interval. Recurrence of HFMD in children is a rare phenomenon but not unusual, mostly associated with two subsequent episodes due to either similar (occasional) or mostly different Enterovirus serotypes [7]. Studies from West Virginia, USA [19] and India [3, 14, 17] have also reported the recurrence of Enterovirus infection causing HFMD in children. However, their studies failed to confirm the Enterovirus etiologies as the diagnoses were made only on clinical findings without virus isolation and molecular characterization. Only limited data on virologically confirmed recurrent HFMD cases is available. A study from China reported only 0.44% (1767/398,010) cases with the laboratory confirmed recurrent HFMD during 2008–2015 [6].

The present study clearly emphasizes the appropriateness and importance of virological and molecular diagnosis. Isolation of CV-A6 and CV-A16 in two subsequent episodes during the present study provides substantial evidence of relapse of viral infection. It is important to mention that during HFMD outbreak in May–June, 2018, recurrence of HFMD was reported by paediatricians in a few children of less than 2 years (Personal Communication). Natural infection with an Enterovirus serotype does not provide any cross protection against other Enterovirus serotypes [6]. Therefore, multiple HFMD episodes can occur due to limited cross-protection from infections of different Enterovirus serotypes. A recent report on the epidemiology of recurrent HFMD cases in China between 2008 and 2015 suggested a high burden of HFMD recurrence among the children in China [6]. The studies on clinical trials using inactivated EV-A71 vaccines in China in recent years provided high protection against EV-A71 infection but failed to confer cross-protection against other Enterovirus serotypes causing HFMD [23].

The symptoms of the child with recurrent infection were mild and almost similar during both the episodes (CV-A6 and CV-A16 infections). All seven HFMD cases reported in the present study recovered without any complications. Recurrent HFMD infection with lesions extending beyond the characteristic distribution over the body have been reported [2]. Therefore disease severity of recurrent HFMD cases due to different Enterovirus serotypes needs to further study. The interval between two consecutive HFMD episodes is also an important parameter to study recurrence. During the present study an interval of 21 days was found, which is in agreement with similar observations in China [6].

There are no reports of isolation and molecular characterization of CV-A6 and CV-A16 viruses from recurrent HFMD cases. The present study reports molecular characterization of two Enterovirus serotypes CV-A6 and CV-A16 from a recurrent HFMD case, highlighting need of virological and molecular surveillance of HFMD.

Funding

This work was supported by intramural grant from the Indian Council of Medical Research.

Compliace with ethical standards

Conflict of interest

The author(s) declare that they have no competing interests.