Abstract
A one-step multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection of five viruses causing diarrhea in adult cattle: bovine group A rotavirus (GAR), bovine group B rotavirus (GBR), bovine group C rotavirus (GCR), bovine coronavirus (BCV), and bovine torovirus (BToV). The detection limit of the one-step multiplex RT-PCR for GAR, GCR, BCV, and BToV was 102, 100, 101, and 102 TCID50/ml, respectively, and that for GBR was 106 copies/ml. The one-step multiplex RT-PCR with newly designed primers to detect GAR had higher sensitivity than a single RT-PCR with conventional primers, with no false-positive reactions observed for ten other kinds of bovine RNA viruses To assess its field applicability, 59 of 60 fecal samples containing one of these five viruses from all 25 epidemic diarrhea outbreaks in adult cattle were positive in the one-step multiplex RT-PCR assay. Furthermore, using four additional fecal samples containing two viruses (GBR and BCV or BToV), two amplified products of the expected sizes were obtained simultaneously. In contrast, all 80 fecal samples lacking the five target viruses from normal adult cattle were negative in the multiplex assay. Taken together, our results indicate that the one-step multiplex RT-PCR developed here for the detection of GAR, GBR, GCR, BCV, and BToV can be expected to be a useful tool for the rapid and cost-effective diagnosis and surveillance of viral diarrhea in adult cattle.
Keywords: Bovine Viral Diarrhea Virus, Bovine Respiratory Syncytial Virus, Adult Cattle, Bovine Ephemeral Fever Virus, Bovine Viral Diarrhea Virus Infection
Introduction
Epidemic outbreaks of diarrhea frequently occur in adult cattle, resulting in major economic losses to the dairy industry due to rapid decreases in milk production by affected cattle. Bovine coronavirus (BCV) is a primary cause of adult cattle diarrhea, including winter dysentery (WD), which is characterized by the sudden onset of epidemic diarrhea, which occasionally presents with bloody feces and reduced milk production during the winter season [15, 32, 36, 44]. In addition, bovine group A rotavirus (GAR) [14, 38], bovine group B rotavirus (GBR) [7, 18, 45], bovine group C rotavirus (GCR) [28, 42], and bovine torovirus (BToV) [19, 22] also have been identified in field cases of adult cattle diarrhea. However, the frequency of adult cattle diarrhea caused by these viruses remains unclear.
Rotaviruses are classified into seven groups (A-G) on the basis of antigenic and genomic analysis, and GAR, GBR, and GCR have been detected in cattle [12]. Bovine GAR is one of the major pathogens that causes acute diarrhea in neonatal calves worldwide [11] and is occasionally responsible for diarrhea in adult cattle [14, 38]. Bovine GBR and GCR have been associated with epidemic outbreaks of diarrhea in adult cattle but are relatively uncommon in calves [7, 18, 28, 42, 45], and in several outbreaks, marked drops in milk production have been observed [18, 28, 42]. Rotaviruses can be genotyped using the outer capsid proteins VP7 and VP4 to define the G and P genotype, respectively, based on sequence differences of the respective genes [12]. BToV, formerly called Breda virus, is a member of the genus Torovirus in the family Coronaviridae and was first detected from diarrheic calves in the United States in 1979 [47]. A few reports have found an association between BToV and adult cattle diarrhea, as well as calf diarrhea [19, 22].
Characterization of the clinical signs and epidemiology of these viral infections, with the exception of BCV, in adult cattle remains incomplete. Furthermore, as bloody feces are not always observed in BCV-associated diarrhea, viral detection is needed for differential diagnosis of viral diarrhea in adult cattle. To date, however, most diagnostic examinations have focused on BCV and GAR because commercial detection kits are only available for these two viruses [1, 14, 38]. As such, the isolation of GCR and BToV has only been reported in a few reports [26, 42], while GBR has not been successfully isolated to date [6, 46]. Reverse transcription PCR (RT-PCR) assays for sensitive and accurate detection of these RNA viruses has been used occasionally for the diagnosis of adult cattle diarrhea. However, conventional RT-PCR (single RT-PCR) assays targeting individual viruses is time-consuming, labor-intensive, and expensive. Thus, cost-effective, simple, and rapid laboratory assays are needed for the diagnosis of viral diarrhea in adult cattle.
Here, we attempted to develop a one-step multiplex RT-PCR assay for the simultaneous detection and differentiation of GAR, GBR, GCR, BCV, and BToV, and we evaluate the application of the assay using fecal samples collected from outbreaks of adult cattle diarrhea in Japan.
Materials and methods
Reference viruses
The bovine GAR strain Shimane (G6P[1]) [37] and nine bovine GAR field isolates from diarrheal adult cattle (one G8P[14], five G10P[11], one G6P[11], two GXP[11], and one G8P[X]; X indicates that the genotype could not be determined) were propagated in MA104 cells. The bovine GCR strain Shintoku [42] and BCV strains Kakegawa and Mebus [3, 29] were propagated in MA104 and HRT-18 cells, respectively. The BToV strain Aichi/2004 was propagated in HRT-18 cells [26]. The bovine GBR strain Nemuro was propagated in colostrum-deprived calves as described previously [45].
Ten other kinds of bovine RNA viruses were used as negative controls and propagated using standard techniques as follows: Bovine viral diarrhea virus (BVDV) type 1 strain Nose [24], BVDV type 2 strain KZ-91CP [31], bovine parainfluenza 3 virus strain BN-1 [20], and bovine rhinovirus strain M-17 [25] were propagated in MDBK cells. Akabane virus strain JaGAr-39 [34], Aino virus strain JaNAr-28 [41], Ibaraki virus strain Ibaraki [33], Chuzan virus strain K47 [30], and bovine ephemeral fever virus strain YHL [23] were propagated in HmLu-1 cells. Bovine respiratory syncytial virus strain NMK-7 [21] was propagated in Vero cells.
Fecal samples
A total of 60 diarrheal fecal samples collected from 60 adult cattle involved in 25 outbreaks of diarrhea between 2002 and 2011 in seven prefectures of Japan were used. The samples were positive for one of the five target viruses, as determined using conventional RT-PCR, as described below, a commercial antigen detection kit for GAR (Rotalex Dry, Orion Diagnostica, Espoo, Finland), or virus isolation [37]. Of the 60 fecal samples, eight were GAR positive from four outbreaks, eight were GBR positive from seven outbreaks, 10 were GCR positive from three outbreaks, 20 were BCV positive from eight outbreaks, and 14 were BToV positive from three outbreaks.
In addition, two fecal samples from calves infected with both GBR and BCV and two fecal samples from adult cattle infected with both GBR and BToV were also used. As negative controls, a total of 80 fecal samples collected in Saitama Prefecture, Japan, from clinically normal adult cattle that were negative for the five viruses by conventional RT-PCR assays were also used in the study.
To prepare samples for analysis, 10% fecal suspensions were made with Eagle’s MEM (Nissui Pharmaceutical, Tokyo, Japan). After centrifugation of the suspensions for 6 min at 1,200×g, the resulting supernatant was stored frozen at −80 °C until use.
RNA extraction and single RT-PCR
RNA was extracted from 250 μl of virus-infected cell culture supernatants or fecal suspensions using ISOGEN-LS (Nippon Gene, Tokyo, Japan) in accordance with the manufacturer’s instructions.
Single RT-PCR was performed using previously reported primers for the detection of specific genes of GAR [16], GBR [9], GCR [43], BCV [44], and BToV [39] using a OneStep RT-PCR Kit (QIAGEN, Valencia, CA, USA).
Primers for multiplex RT-PCR
The sequences and characteristics of the five primer pairs used for one-step multiplex RT-PCR are shown in Table 1. The three primer pairs used for the detection of GBR, BCV, and BToV were the same as those used for single RT-PCR. A forward primer for GAR was previously reported [27]. A reverse primer for GAR detection and a primer pair for GCR detection were designed in this study.
Table 1.
Primers used in the one-step multiplex RT-PCR
| Virus | Target gene | Primer | Sequence (5′–3′)a | Position | Product length (bp) | Reference No. |
|---|---|---|---|---|---|---|
| GAR | VP6 | GEN_VP6F | GGCTTTWAAACGAAGTCTTC | 1–20b | 928 | [27] |
| GAR VP6-928R | GGYGTCATATTYGGTGG | 928–912b | Newly designed | |||
| GBR | VP7 | 9B3 | CAGTAACTCTATCCTTTTACC | 171–191c | 281 | [9] |
| 9B4 | CGTATCGCAATACAATCCG | 451–433c | ||||
| GCR | VP6 | ShintokuVP6-370F | ATCGCATTAGCTTCATCAAA | 370–389d | 563 | Newly designed |
| ShintokuVP6-933R | CTGTACATACTGGGTCATAGC | 933–913d | ||||
| BCV | Nucleocapsid | BCV-N-F | GCCGATCAGTCCGACCAATC | 29475–29494e | 407 | [44] |
| BCV-N-R | AGAATGTCAGCCGGGGTAT | 29881–29863e | ||||
| BToV | Nucleocapsid | 1344 | GAGAAAGAGCCAAGATGAATT | 27761–27781f | 664 | [39] |
| 294 | CTTACATGGAGACACTCAACCA | 28424–28403f |
aW = A or T; Y = C or T
bBased on the VP6 gene of strain NCDV (accession no. AF317127)
cBased on the VP7 gene of strain Nemuro (accession no. AB016818)
dBased on the VP6 gene of strain Shintoku (accession no. M88768)
eBased on the complete genome of strain Mebus (accession no. U00735)
fBased on the complete genome of strain Breda 1 (accession no. AY427798)
Optimization of multiplex RT-PCR
Multiplex RT-PCR was performed using a OneStep RT-PCR Kit. To determine the optimum conditions for the assay, various primer concentrations (0.2-0.6 μM), annealing temperatures (45-60 °C), and numbers of amplification cycles (30-40 cycles) were examined using RNAs from all the reference viruses.
Sensitivity of single and multiplex RT-PCRs
The sensitivity of single and multiplex RT-PCR assays was evaluated on serial tenfold dilutions of RNAs of the target viruses. Prior to RNA extraction, GAR (Shimane), GCR (Shintoku), BCV (Mebus), and BToV (Aichi/2004) were adjusted to 105 median tissue culture infective dose (TCID50) per ml with Eagle’s MEM. RNAs were diluted serially with RNase-free water. For the sensitive assay against GBR, a plasmid containing the bovine GBR (Nemuro) VP7 gene was used. Briefly, a complete VP7 gene (816 bp) amplified by RT-PCR [45] was ligated into the pCR-Blunt II-TOPO vector (Invitrogen, Carlsbad, CA, USA), and mRNA was then generated from the plasmid DNA using SP6 RNA polymerase (Roche Applied Science, Penzberg, Germany) and purified by ethanol precipitation. Tenfold serial dilutions of the mRNA were prepared from a starting solution containing 109 copies per ml using RNase-free water. The limit of detection was reported as TCID50 or RNA copies per ml.
Results
Optimization of the one-step multiplex RT-PCR
The optimal conditions for the one-step multiplex RT-PCR included the use of a 0.4 μM concentration of each primer, an annealing temperature of 52 °C, and 35 amplification cycles. For the assay, 2 μl of extracted RNA was first heated with 1 μl of dimethyl sulfoxide and 12.2 μl of RNase-free water at 98 °C for 5 min, and the temperature was then held at 4 °C. A reaction mixture consisting of 5 μl 5× buffer, 1 μl dNTP Mix (10 mM each dNTP), and 1 μl enzyme mix from the OneStep RT-PCR Kit, 0.3 μl RNase OUT (Invitrogen), and 2.5 μl 10x primer mix (4 μM each primer) was then added to the RNA solution. The RT-PCR reaction was performed at 50 °C for 30 min and 95 °C for 15 min, followed by 35 cycles of 94 °C for 45 sec, 52 °C for 45 sec, and 72 °C for 1 min, and incubation at 72 °C for 10 min, after which the temperature was held at 4 °C. Under optimal conditions, only products of the expected sizes were amplified from RNA of the reference viruses, and these could be easily distinguished from each other following agarose gel electrophoresis (Fig. 1a). At annealing temperatures below 50 °C, nonspecific amplification products frequently appeared, while at temperatures above 54 °C, the amount of specific product for GAR, GBR, and BToV was clearly lower than that obtained at 52 °C (data not shown).
Fig. 1.

One-step multiplex RT-PCR products generated under optimal conditions for five reference viruses (a) and for fecal samples collected from cattle with concurrent infection caused by GBR and BCV or BToV (b). (a) Lane 1, GAR (strain Shimane); lane 2, GBR (strain Nemuro); lane 3, GCR (strain Shintoku); lane 4, BCV (strain Mebus); lane 5, BToV (strain Aichi/2004); lane M, 100-bp DNA ladder marker. (b) Lanes 1 and 2, fecal samples from GBR- and BCV-infected calves; lanes 3 and 4, fecal samples from GBR- and BToV-infected adult cattle; lane 5, negative control (water); lane 6, positive control (mixture of reference viral RNAs); lane M, 100-bp DNA ladder marker
Sensitivity comparison of single and one-step multiplex RT-PCRs
As shown in Fig. 2, the detection limits of the single and multiplex RT-PCRs were 104 and 102 TCID50/ml, respectively, for GAR, 101 and 102 TCID50/ml for BToV, 101 and 100 TCID50/ml for GCR, 102 and 101 TCID50/ml for BCV, and 105 and 106 copies/ml for GBR.
Fig. 2.

Sensitivity of conventional single RT-PCR (a) and one-step multiplex RT-PCR (b) for GAR (strain Shimane), BToV (Aichi/2004), GCR (strain Shintoku), BCV (Mebus), and GBR (Nemuro). Reactions were performed using tenfold serial dilutions of viral RNA. NC, negative control
Specificity testing of one-step multiplex RT-PCR
In the one-step multiplex RT-PCR for the five target viruses, no detectable amplification occurred with samples of BVDV type 1, BVDV type 2, bovine parainfluenza 3 virus, bovine rhinovirus, bovine respiratory syncytial virus, Akabane virus, Aino virus, Ibaraki virus, Chuzan virus, bovine ephemeral fever virus, or bovine respiratory syncytial virus. Furthermore, no PCR products were observed in assays performed with 80 fecal samples that were negative for target viruses. By contrast, all target viral genes were specifically amplified by the assay using the reference viruses (Fig. 1b, lane 6).
Application of the one-step multiplex RT-PCR with virus-positive field samples
The results of the single and one-step multiplex RT-PCRs for 60 virus-positive fecal samples collected during 25 outbreaks are summarized in Table 2. Consistent results were obtained for both assays, with the exception of outbreaks 2, 4 and 11. For outbreaks 2 and 4, the single RT-PCR failed to detect GAR in one or two samples, whereas the one-step multiplex RT-PCR detected GAR in these samples (Table 2, no. 3, 7 and 8). The presence of GAR in these samples had been confirmed using a Rotalex Dry kit and virus isolation. For outbreak 11, the one-step multiplex RT-PCR failed to detect GBR in one sample that was positive in the single RT-PCR (Table 2, no. 15). The presence of GBR in the sample was confirmed by direct sequencing of the single RT-PCR product (data not shown). No false-positive reactions were observed in any sample for either assay. When additional fecal samples with concurrent infections with GBR, and BCV or BToV were used in the one-step multiplex RT-PCR, two amplified products of the expected sizes were detected simultaneously (Fig. 1b, lanes 1-4).
Table 2.
Results of the single and one-step multiplex RT-PCRsa in 60 virus-positive fecal samples at 25 outbreaks
| Virus | Outbreak no. | Sample no. | Single RT-PCR | Multiplex RT-PCR |
|---|---|---|---|---|
| GAR | 1 | 1 | + | + |
| 2 | + | + | ||
| 2 | 3b | − | + | |
| 4 | + | + | ||
| 3 | 5 | + | + | |
| 6 | + | + | ||
| 4 | 7b | − | + | |
| 8b | − | + | ||
| GBR | 5 | 9 | + | + |
| 6 | 10 | + | + | |
| 7 | 11 | + | + | |
| 8 | 12 | + | + | |
| 9 | 13 | + | + | |
| 10 | 14 | + | + | |
| 11 | 15c | + | − | |
| 16 | + | + | ||
| GCR | 12 | 17 | + | + |
| 18 | + | + | ||
| 19 | + | + | ||
| 13 | 20 | + | + | |
| 21 | + | + | ||
| 22 | + | + | ||
| 14 | 23 | + | + | |
| 24 | + | + | ||
| 25 | + | + | ||
| 26 | + | + | ||
| BCV | 15 | 27 | + | + |
| 28 | + | + | ||
| 16 | 29 | + | + | |
| 30 | + | + | ||
| 17 | 31 | + | + | |
| 32 | + | + | ||
| 18 | 33 | + | + | |
| 34 | + | + | ||
| 19 | 35 | + | + | |
| 36 | + | + | ||
| 20 | 37 | + | + | |
| 38 | + | + | ||
| 21 | 39 | + | + | |
| 40 | + | + | ||
| 22 | 41 | + | + | |
| 42 | + | + | ||
| 43 | + | + | ||
| 44 | + | + | ||
| 45 | + | + | ||
| 46 | + | + | ||
| BToV | 23 | 47 | + | + |
| 48 | + | + | ||
| 49 | + | + | ||
| 50 | + | + | ||
| 51 | + | + | ||
| 52 | + | + | ||
| 24 | 53 | + | + | |
| 54 | + | + | ||
| 55 | + | + | ||
| 56 | + | + | ||
| 25 | 57 | + | + | |
| 58 | + | + | ||
| 59 | + | + | ||
| 60 | + | + |
aPositive and negative reactions are + and −, respectively
bGAR was detected by Rotalex Dry Kit and virus isolation
cGBR was confirmed by direct sequencing
Discussion
In newborn calves, GAR and BCV are common causes of viral diarrhea [1]; however, recent reports indicate that in addition to these viruses, GBR, GCR, and BToV are also associated with epidemic diarrhea in adult cattle. Although the simultaneous detection of GAR and BCV by multiplex RT-PCR assays has been reported [4, 10], to our knowledge, this represents the first report of a multiplex RT-PCR for the simultaneous detection of all five viruses.
In most previous studies on multiplex RT-PCR for detecting diarrheal viruses in calves, pigs, and humans, two-step assays in which the RT and PCR reactions are performed separately were adopted [4, 5, 17, 35, 40]. Therefore, here, we initially assessed a two-step multiplex RT-PCR assay using random primers in the RT step. However, the one-step multiplex RT-PCR assay showed greater sensitivity and specificity than the two-step assay (data not shown). Furthermore, as one-step assays are simpler and more convenient than two-step assays, the practical application of the one-step multiplex RT-PCR method developed in this study was further evaluated.
Diarrhea caused by BVDV infection is a symptom of mucosal disease in persistently infected cattle, or of acute infection in seronegative immunocompetent cattle [13]. However, BVDV-associated diarrhea occurs sporadically and is primarily observed in cattle under 24 months of age [13]. As mucosal disease is systemic and fatal, it is not difficult to make a clinical diagnosis. Furthermore, the incidence of diarrhea resulting from acute BVDV infection in adult cattle is extremely low based on our recent epidemiological survey (manuscript in preparation). Therefore, in this study, we did not include BVDV as a target virus for detection.
When the sensitivity was compared between the single and multiplex RT-PCRs against each of the five target viruses, a relatively large difference was observed for the detection of GAR. Notably, the sensitivity of the multiplex RT-PCR against GAR strain Shimane RNA was approximately 100-fold higher than that of the single RT-PCR. A similar difference was observed when the assays were used to assess GAR-positive fecal samples. Although the reason for the markedly reduced sensitivity of the single RT-PCR remains unclear, one possibility is that the primers (Beg9 and End9) [16] used for the assay might be unsuitable for the detection of some GAR strains.
A significant finding of our study was that the one-step multiplex RT-PCR could detect concurrent infections with different viruses for both laboratory and clinical samples. Chang et al. [8] examined concurrent infections with GAR and GCR in diarrheic adult cattle and found that dual infection with these two viruses in gnotobiotic calves enhanced the pathogenesis of both viruses. However, the diagnosis of adult cattle diarrhea is typically conducted against only BCV and GAR. Because BCV is a cause of WD, GAR can be easily examined with rapid diagnostic kits, such as immune chromatography and latex agglutination tests [2, 14, 38]. The routine use of the one-step multiplex RT-PCR assay developed here may allow elucidation of the epidemiology of these viral infections and detection of concurrent infections in adult cattle.
In conclusion, we have developed a one-step multiplex RT-PCR assay that is capable of detecting five viruses causing acute diarrhea in adult cattle. The sensitivity of the assay was similar to that of the single RT-PCR technique for all of the reference viruses examined, with the exception of GAR. Notably, the one-step multiplex RT-PCR was able to detect the causative agents for all 25 outbreaks of epidemic diarrhea that were examined. In addition, the required amounts of samples and reagents and inspection times can be decreased using this assay. Taken together, the one-step multiplex RT-PCR assay developed in this study may be a useful tool for the rapid and cost-effective diagnosis of the causative agents of viral diarrhea in adult cattle.
Acknowledgements
The authors thank Drs. Eya, Kamiyoshi, and Kuroda for providing fecal samples containing diarrheal viruses.
References
- 1.Abraham G, Roeder PL, Zewdu R. Agents associated with neonatal diarrhoea in Ethiopian dairy calves. Trop Anim Health Prod. 1992;24:74–80. doi: 10.1007/BF02356948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Al-Yousif Y, Anderson J, Chard-Bergstrom C, Kapil S. Development, evaluation, and application of lateral-flow immunoassay (immunochromatography) for detection of rotavirus in bovine fecal samples. Clin Diagn Lab Immunol. 2002;9:723–725. doi: 10.1128/CDLI.9.3.723-724.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Akashi H, Inaba Y, Miura Y, Tokuhisa S, Satoda K. Properties of a coronavirus isolated from a cow with epizootic diarrhea. Vet Microbiol. 1980;5:265–276. doi: 10.1016/0378-1135(80)90025-5. [DOI] [Google Scholar]
- 4.Asano KM, de Souza SP, de Barros IN, Ayres GR, Silva SO, Richtzenhain LJ, Brandão PE. Multiplex semi-nested RT-PCR with exogenous internal control for simultaneous detection of bovine coronavirus and group A rotavirus. J Virol Methods. 2010;169:375–379. doi: 10.1016/j.jviromet.2010.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Ben Salem AN, Chupin Sergei A, Bjadovskaya Olga P, Andreeva Olga G, Mahjoub A, Prokhvatilova Larissa B. Multiplex nested RT-PCR for the detection of porcine enteric viruses. J Virol Methods. 2010;165:283–293. doi: 10.1016/j.jviromet.2010.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bridger JC. Non-group A rotaviruses. In: Kapikian AZ, editor. Viral infections of the gastrointestinal tract. 2. New York: Marcel Dekker; 1994. pp. 369–407. [Google Scholar]
- 7.Chang KO, Parawani AV, Smith D, Saif LJ. Detection of group B rotaviruses in fecal samples from diarrheic calves and adult cows and characterization of their VP7 genes. J Clin Microbiol. 1997;35:2107–2110. doi: 10.1128/jcm.35.8.2107-2110.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chang KO, Nielsen PR, Ward LA, Saif LJ. Dual infection of gnotobiotic calves with bovine strains of group A and porcine-like group C rotaviruses influences pathogenesis of the group C rotavirus. J Viol. 1999;73:9284–9293. doi: 10.1128/jvi.73.11.9284-9293.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chinsangaram J, Akita GY, Osburn BI. Detection of bovine group B rotaviruses in feces by polymerase chain reaction. J Vet Diagn Invest. 1994;6:302–307. doi: 10.1177/104063879400600304. [DOI] [PubMed] [Google Scholar]
- 10.Cho YI, Kim WI, Liu S, Kinyon JM, Yoon KJ. Development of a panel of multiplex real-time polymerase chain reaction assays for simultaneous detection of major agents causing calf diarrhea in feces. J Vet Diagn Invest. 2010;22:509–517. doi: 10.1177/104063871002200403. [DOI] [PubMed] [Google Scholar]
- 11.Dhama K, Chauhan RS, Mahendran M, Malik SV. Rotavirus diarrhea in bovines and other domestic animals. Vet Res Commun. 2009;33:1–23. doi: 10.1007/s11259-008-9070-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Estes MK, Kapikian AZ (2007) Rotaviruses. In: Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE (eds) Fields Virology, 5th edn. Lippincott, Williams and Wilkins, Philadelphia, pp 1917–1974
- 13.Evermann JF, Barrington GM. Clinical features. In: Goyal SM, Ridpath JF, editors. Bovine viral diarrhea virus; diagnosis, management, and control. Iowa: Blackwell Publishing; 2005. pp. 105–119. [Google Scholar]
- 14.Fukai K, Takahashi T, Tajima K, Koike S, Iwane K, Inoue K. Molecular characterization of a novel bovine group A rotavirus. Vet Microbiol. 2007;20:217–224. doi: 10.1016/j.vetmic.2007.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Fukutomi T, Tsunemitsu H, Akashi H. Detection of bovine coronaviruses from adult cows with epizootic diarrhea and their antigenic and biological diversities. Arch Virol. 1999;144:997–1006. doi: 10.1007/s007050050562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF, Forrester B, Fang ZY. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J Clin Microbiol. 1990;28:276–282. doi: 10.1128/jcm.28.2.276-282.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gouvea V, Allen JR, Glass RI, Fang ZY, Bremont M, Cohen J, McCrae MA, Saif LJ, Sinarachatanant P, Caul EO. Detection of group B and C rotaviruses by polymerase chain reaction. J Clin Microbiol. 1991;29:519–523. doi: 10.1128/jcm.29.3.519-523.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hayashi M, Nagai M, Hayakawa Y, Takeuchi K, Tsunemitsu H. Outbreak of diarrhoea and milk drop in cows infected with bovine group B rotavirus. Vet Rec. 2001;15:331–332. doi: 10.1136/vr.149.11.331. [DOI] [PubMed] [Google Scholar]
- 19.Hoet AE, Nielsen PR, Hasoksuz M, Thomas C, Wittum TE, Saif LJ. Detection of bovine torovirus and other enteric pathogens in feces from diarrhea cases in cattle. J Vet Diagn Invest. 2003;15:205–212. doi: 10.1177/104063870301500301. [DOI] [PubMed] [Google Scholar]
- 20.Inaba Y, Omori T, Kono M, Matumoto M. Parainfluenza 3 virus isolated from Japanese cattle. I. Isolation and identification. Jpn J Exp Med. 1963;33:313–329. [PubMed] [Google Scholar]
- 21.Inaba Y, Tanaka Y, Sato K, Omori T, Matumoto M. Bovine respiratory syncytial virus. Studies on an outbreak in Japan, 1968–1969. Jpn J Microbiol. 1972;16:373–383. [PubMed] [Google Scholar]
- 22.Ito T, Okada N, Fukuyama S. Epidemiological analysis of bovine torovirus in Japan. Virus Res. 2007;126:32–37. doi: 10.1016/j.virusres.2007.01.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kato T, Aizawa M, Takayoshi K, Kokuba T, Yanase T, Shirafuji H, Tsuda T, Yamakawa M. Phylogenetic relationships of the G gene sequence of bovine ephemeral fever virus isolated in Japan, Taiwan and Australia. Vet Microbiol. 2009;137:217–223. doi: 10.1016/j.vetmic.2009.01.021. [DOI] [PubMed] [Google Scholar]
- 24.Kodama K, Sasaki N, Fukuyama S, Izumida A, Ishii F. Studies on cytopathogenic bovine viral diarrhea virus recovery, identification, and properties of the isolates virus. Bull Nippon Vet Zootech Coll. 1974;23:51–60. [Google Scholar]
- 25.Kurogi H, Inaba Y, Goto Y, Takahashi A, Sato K. Isolation of rhinovirus from cattle in outbreaks of acute respiratory disease. Arch Gesamte Virusforsch. 1974;44:215–226. doi: 10.1007/BF01240609. [DOI] [PubMed] [Google Scholar]
- 26.Kuwabara M, Wada K, Maeda Y, Miyazaki A, Tsunemitsu H. First isolation of cytopathogenic bovine torovirus in cell culture from a calf with diarrhea. Clin Vaccine Immunol. 2007;14:998–1004. doi: 10.1128/CVI.00475-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Matthijnssens J, Rahman M, Van Ranst M. Two out of the 11 genes of an unusual human G6P[6] rotavirus isolate are of bovine origin. J Gen Virol. 2008;89:2630–2635. doi: 10.1099/vir.0.2008/003780-0. [DOI] [PubMed] [Google Scholar]
- 28.Mawatari T, Taneichi A, Kawagoe T, Hosokawa M, Togashi K, Tsunemitsu H. Detection of a bovine group C rotavirus from adult cows with diarrhea and reduced milk production. J Vet Med Sci. 2004;66:887–890. doi: 10.1292/jvms.66.887. [DOI] [PubMed] [Google Scholar]
- 29.Mebus CA, Stair EL, Rhodes MB, Twiehaus MJ. Neonatal calf diarrhea: propagation, attenuation, and characteristics of a coronavirus-like agent. Am J Vet Res. 1973;34:145–150. [PubMed] [Google Scholar]
- 30.Miura Y, Goto Y, Kubo M, Kono Y. Isolation of Chuzan virus, a new member of the Palyam subgroup of the genus Orbivirus, from cattle and Culicoides oxystoma in Japan. Am J Vet Res. 1988;49:2022–2025. [PubMed] [Google Scholar]
- 31.Nagai M, Sato M, Nagano H, Pang H, Kong X, Murakami T, Ozawa T, Akashi H. Nucleotide sequence homology to bovine viral diarrhea virus 2 (BVDV 2) in the 5′ untranslated region of BVDVs from cattle with mucosal disease or persistent infection in Japan. Vet Microbiol. 1998;60:271–276. doi: 10.1016/S0378-1135(98)00158-8. [DOI] [PubMed] [Google Scholar]
- 32.Natsuaki S, Goto K, Nakamura K, Yamada M, Ueo H, Komori T, Shirakawa H, Utinuno Y. Fatal winter dysentery with severe anemia in an adult cow. J Vet Med Sci. 2007;69:957–960. doi: 10.1292/jvms.69.957. [DOI] [PubMed] [Google Scholar]
- 33.Ohashi S, Yoshida K, Yanase T, Tsuda T. Analysis of intratypic variation evident in an Ibaraki virus strain and its epizootic hemorrhagic disease virus serogroup. J Clin Microbiol. 2002;40:3684–3688. doi: 10.1128/JCM.40.10.3684-3688.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Oya A, Okuno T, Ogata T, Kobayashi I, Matsuyama T. Akabane, a new arbor virus isolated in Japan. Jpn J Med Sci Biol. 1961;14:101–108. doi: 10.7883/yoken1952.14.101. [DOI] [PubMed] [Google Scholar]
- 35.Phan TG, Nguyen TA, Yan H, Okitsu S, Ushijima H. A novel RT-multiplex PCR for enteroviruses, hepatitis A and E viruses and influenza A virus among infants and children with diarrhea in Vietnam. Arch Virol. 2005;150:1175–1185. doi: 10.1007/s00705-004-0465-x. [DOI] [PubMed] [Google Scholar]
- 36.Saif LJ, Brock KV, Redman DR, Kohler EM. Winter dysentery in dairy herds: electron microscopic and serological evidence for an association with coronavirus infection. Vet Rec. 1991;128:447–449. doi: 10.1136/vr.128.19.447. [DOI] [PubMed] [Google Scholar]
- 37.Sato K, Inaba Y, Takahashi E, Ito Y, Kurogi H, Akashi H, Satoda K, Omori T, Matumoto M. Isolation of a reovirus-like agent (rotavirus) from neonatal calf diarrhea in Japan. Microbiol Immunol. 1978;22:499–503. doi: 10.1111/j.1348-0421.1978.tb00396.x. [DOI] [PubMed] [Google Scholar]
- 38.Sato M, Nakagomi T, Tajima K, Ezura K, Akashi H, Nakagomi O. Isolation of serotype G8, P6[1] bovine rotavirus from adult cattle with diarrhea. J Clin Microbiol. 1997;35:1266–1268. doi: 10.1128/jcm.35.5.1266-1268.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Smits SL, Lavazza A, Matiz K, Horzinek MC, Koopmans MP, de Groot RJ. Phylogenetic and evolutionary relationships among torovirus field variants: evidence for multiple intertypic recombination events. J Virol. 2003;77:9567–9577. doi: 10.1128/JVI.77.17.9567-9577.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Song DS, Kang BK, Oh JS, Ha GW, Yang JS, Moon HJ, Jang YS, Park BK. Multiplex reverse transcription-PCR for rapid differential detection of porcine epidemic diarrhea virus, transmissible gastroenteritis virus, and porcine group A rotavirus. J Vet Diagn Invest. 2006;18:278–281. doi: 10.1177/104063870601800309. [DOI] [PubMed] [Google Scholar]
- 41.Takahashi K, Oya A, Okada T, Matsuo R, Kuma M, Noguchi H. Aino virus, a new member of Simbu group of arboviruses from mosquitoes in Japan. Jpn J Med Sci Biol. 1968;21:95–101. doi: 10.7883/yoken1952.21.95. [DOI] [PubMed] [Google Scholar]
- 42.Tsunemitsu H, Saif LJ, Jiang BM, Shimizu M, Hiro M, Yamaguchi H, Ishiyama T, Hirai T. Isolation, characterization, and serial propagation of a bovine group C rotavirus in a monkey kidney cell line (MA104) J Clin Microbiol. 1991;29:2609–2613. doi: 10.1128/jcm.29.11.2609-2613.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Tsunemitsu H, Jiang B, Saif LJ. Sequence comparison of the VP7 gene encoding the outer capsid glycoprotein among animal and human group C rotaviruses. Arch Virol. 1996;141:705–713. doi: 10.1007/BF01718328. [DOI] [PubMed] [Google Scholar]
- 44.Tsunemitsu H, Smith DR, Saif LJ. Experimental inoculation of adult dairy cows with bovine coronavirus and detection of coronavirus in feces by RT-PCR. Arch Virol. 1999;144:167–175. doi: 10.1007/s007050050493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Tsunemitsu H, Morita D, Takaku H, Nishimori T, Imai K, Saif LJ. First detection of bovine group B rotavirus in Japan and sequence of its VP7 gene. Arch Virol. 1999;144:805–815. doi: 10.1007/s007050050546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Wakuda M, Ide T, Sasaki J, Komoto S, Ishii J, Sanekata T, Taniguchi K. Porcine rotavirus closely related to novel group of human rotaviruses. Emerg Infect Dis. 2011;17:1491–1493. doi: 10.3201/eid1708.101466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Woode GN, Reed DE, Runnels PL, Herrig MA, Hill HT. Studies with an unclassified virus isolated from diarrheic calves. Vet Microviol. 1982;7:221–240. doi: 10.1016/0378-1135(82)90036-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
