Pioglitazone activates paraoxonase-2 in the brain: a novel neuroprotective mechanism

Abstract

Paraoxonase-2 regulates reactive oxygen species production in mitochondria. Stimulating its expression has therapeutic potential for diseases where oxidative stress plays a significant role in the pathology. Evidence suggests that the anti-diabetic drug pioglitazone may provide neuroprotection in Parkinson’s disease, Alzheimer’s disease, brain trauma and ischemia, but the biochemical pathway(s) responsible has not been fully elucidated. Here we report that pioglitazone (10 mg/kg/day) for 5 days significantly increased paraoxonase-2 expression in mouse striatum. Thus, this result highlights paraoxonase-2 as a target for neuroprotective strategies and identifies pioglitazone as a tool to study the role of paraoxonase-2 in brain.

Introduction

Paraoxonase-2 (PON2) is an enzyme critical for normal mitochondrial function and regulation of oxidative stress. Located on the inner mitochondrial membrane, PON2 enhances the function of coenzyme Q in the electron transport chain and subsequently reduces the production of reactive oxygen species that can lead to oxidative stress¹. PON2 is the only isoform of the enzyme that is present in brain and it is most highly expressed in dopamine-rich regions of mouse brain². Interestingly, in rodents and primates PON2 expression peaks during development and has fallen by adulthood^2, which coincides with age-related susceptibility of dopamine neurons to the parkinsonian protoxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and to methamphetamine in primates³. In fact, PON2 deficiency hypersensitizes neurons to oxidative stress induced by 1-methyl-4-phenylpyridinium (MPP+), the toxin generated in vivo following MPTP delivery⁴. Therefore, PON2 has emerged as a new therapeutic target for Parkinson’s disease (PD) and other neurological disorders where oxidative stress plays a significant role in the etiology.

Pioglitazone is best known for its use to improve glycemic control in adults with type 2 diabetes mellitus, but there is now substantial evidence that is has neuroprotective properties in models of PD, Alzheimer’s disease, brain trauma, and in stroke (e.g.⁵). The etiologies of these conditions have some common components, such as mitochondrial dysfunction, oxidative stress, and inflammation. However, the precise mechanism(s) underlying pioglitazone’s mediation of neuroprotection is not yet known.

Pioglitazone is recognized as a peroxisome proliferator-activated receptor gamma (PPARγ) agonist, which has emerged as a new neuroprotective target, especially in PD6. PPARγ is a ligand activated nuclear receptor that is expressed throughout the brain and initiates transcription of genes containing a PPAR response element (PPRE) in their promoter region. A variety of specific neuroprotective and repair mechanisms have been attributed to PPARγ, including the induction of genes involved in oxidative stress defense, induction of anti-inflammatory responses, and stimulation of mitochondrial biogenesis. However, little is known about the precise molecular mechanisms of PPARγ that lead to these neuroprotective effects. Elevated PON2 expression has been linked with PPARγ,⁷ and may potentially mediate some of the beneficial effects attributed to pioglitazone and PPARγ due to its role in mitochondria function and regulation of oxidative stress.

We hypothesized that elevated PON2 expression contributes to the neuroprotective effects of pioglitazone and the first important step in testing this is presented here, namely that systemically administered pioglitazone elevates expression of PON2 in the brain. If this hypothesis is validated, then activation of PON2 would emerge as a viable mechanism for the neuroprotective properties of pioglitazone, justifying further studies with the drug and paving the way for development of more specific agents that target PON2 for use in patients to protect dopamine and other neurons from age or disease-related dysfunction.

Methods

Animals and treatment

Male C57BL/6 mice (Charles River Laboratories, Wilmington, MA), aged 10 weeks, served as subjects. Mice were housed three per cage in a climate-controlled colony room at Yale University with food and water available ad libitum. All studies were carried out in accordance with the Guide for Care and Use of Laboratory Animals, and experimental protocols were approved by the Yale University Institutional Animal Care and Use Committee. Mice received daily intraperitoneal injections of 10 mg/kg pioglitazone HCl (BOC Sciences, Shirley, NY) (n = 6) or pioglitazone vehicle for 5 days at a volume of 10 μl/g (n = 6). Pioglitazone was dissolved in an aqueous vehicle containing 30% polyethylene glycol, 0.5% methyl cellulose and 0.9% sodium chloride.

Western Blot

Mice were euthanized by cervical dislocation four hours following their final injections. Brains were removed and striatum and hippocampus were rapidly dissected and frozen for subsequent analysis by Western blot. Tissue was sonication in lysis buffer (Cell Signaling Technology, Danvers, MA) with a Roche cOmplete protease inhibitor cocktail then centrifuged for 10 minutes at 28,000 × g. Total protein content was determined with a BCA assay (Pierce Biotechnology, Waltham, MA). The Western blot protocol was carried out using BioRad (Hercules, CA) equipment and consumables for stain-free protein quantification, following the manufacturer’s instructions. Samples were diluted in Laemmli loading buffer, heated, and separated on stain-free mini-Protean TGX gels. Proteins were then transferred to PVDF membranes and imaged with a ChemiDoc XRS+ (Bio-Rad Laboratories, Hercules, CA) so that blots could be normalized to the total protein per lane. Membranes were blocked for 1 hour at room temperature with 5% nonfat dry milk in a Tris buffered saline (TBS) wash buffer containing 0.1% Tween 20. Membranes were incubated overnight in blocking buffer at 4°C with a PON2 antibody (1:5000; ab192038, Abcam, Cambridge, MA). Membranes were washed and then incubated for 1 hour at room temperature with an HRP-conjugated secondary antibody (1:30000; 111-035-003, Jackson Immuno, West Grove, PA) in blocking buffer. After washing, the antibody complex was visualized by Clarity chemiluminescence (Bio-Rad Laboratories) and imaged with the ChemiDoc. PON2 expression was normalized to total lane protein using ImageLab software (Bio-Rad Laboratories) within ChemiDoc and is presented as the percent relative to vehicle-treated controls. Samples were run as 2 batches each comprising samples from 3 mice in each group. During tissue processing, one hippocampal sample was lost from a mouse in the vehicle-treated group.

RT-PCR

Tissue was homogenized with an RNase-free disposable pellet pestle (Kimble® Kontes) and by passage through 19-gauge needle. Total RNA was isolated using RNeasy® Lipid Tissue kit according to manufacturer’s protocol (Qiagen). RNA concentration and purity was assessed with a Nanodrop 2000 (Thermo Scientific). cDNA was synthesized using QuantiTect® Reverse Transcription Kit (Qiagen) according to manufacturer’s protocol, which included a genomic DNA elimination step prior to reverse transcription. During tissue processing, one hippocampal sample was lost from a mouse in the pioglitazone-treated group. cDNA was diluted by a factor of ten with H₂O. Diluted cDNA (0.5 μL) was added to each 10 μL real-time (RT)-PCR reaction. RT-PCR was performed using iTaq™ Universal SYBR^R Green Supermix (Bio-Rad). Primers (Table 1) were added to a final concentration of 300 nM. Primers were designed using NCBI primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast, NCBI, Bethesda, MD, USA) and synthesized at the W.M. Keck Foundation Oligo Synthesis Resource (Yale University). Primer specificity was assessed empirically by electrophoresis.

Table 1:

Primer sequences for RT-PCR

Target	Sequence	Annealing temp (°C)	Amplicon size (bp)
β-actin	Fwd: CACTGTCGAGTCGCGTCC	60.5	89
	Rev: TCATCCATGGCGAACTGGTG	60.39
Alu-Seq	Fwd: CATGGTGAAACCCCGTCTCTA	59.45	99
	Rev: GCCTCAGCCTCCCGAGTAG	62.49
Eef1e1	Fwd: GCCTCCACCGCTTTATAGTTG	59.06	172
	Rev: CACAGCGAGGGCTTCTAGTG	60.46
H3f3a	Fwd: CCTCGGTGTCAGCCATCTTT	60.04	140
	Rev: GCCATGGTAAGGACACCTCC	60.11
Hprt	Fwd: CCAGCGTCGTGATTAGCGAT	60.6	163
	Rev: TGGCCTCCCATCTCCTTCAT	60.33
Nrf2	Fwd: AACAGAACGGCCCTAAAGCA	59.89	100
	Rev: TGGGATTCACGCATAGGAGC	59.89
Ppia	Fwd: TCAACCCCACCGTGTTCTTC	60.18	199
	Rev: GTAAAGTCACCACCCTGGCA	59.89
Ppid	Fwd: GGGGCAGTAGAGTTTGCTCC	60.39	172
	Rev: AAAACAATTCGGCCAACTCGC	60.6
Rpl13	Fwd: TTCCACAAGGATTGGCAGCA	60.18	174
	Rev: CCGGACCTTGGTGTGGTATC	60.11
Sdha	Fwd: CCTGGTCTGTATGCCTGTGG	60.11	265
	Rev: TCTGCATCGACTTCTGCATGT	60.07
Tbp	Fwd: GCGGCACTGCCCATTTATTT	59.82	236
	Rev: GGCGGAATGTATCTGGCACA	60.46
Tubb	Fwd: GATCGGTGCTAAGTTCTGGG	58.06	104
	Rev: ACACAGAGATTCGGTCCAGC	59.75

RT-PCR was performed on a Light Cycler 480 (Roche) with the following cycling conditiòns: Reactions began with 2 min at 95 °C (pre-incubation), followed by 45 cycles of 15 s at 95 °C, 60 s at 60 °C (anneal and extension). Fluorescence was measured at one point during each cycle (at 60 °C). A ‘melting curve’ was performed from 65 to 97 °C (2.5 °C/s) with continuous detection. Each reaction was performed in duplicate and cDNA-free ‘no template’ controls were included for each amplicon. Correct target amplification was confirmed by melting-temperature analysis (T_m) and agarose gel electrophoresis. Raw fluorescent data was analyzed by LinRegPCR, to obtain an initial amount (N₀) of target cDNA in terms of arbitrary fluorescence units (AFU), while accounting for differences in amplification efficiencies between amplicons. Amplification efficiencies estimated by linear regression analysis were in the range 1.8 – 2.1.

Eleven ‘house-keeping’ genes were analyzed as candidate reference genes using the software packages Normfinder, BestKeeper, and geNorm. The genes were chosen from different functional groups: β-actin, Tubb (structure); Hprt, Sdha (metabolism); Tbp, H3f3a (transcription); Eef1e1, Rpl13 (translation); Ppia, Ppid (protein chaperone); Alu-Seq (repetitive sequence). A ‘normalization factor’ was determined as the geometric mean of the four most stably-expressed genes: β-actin, Tubb, PPID, and Alu-Seq.

Statistical Analysis

Data are expressed as the mean ± SEM. The effect of treatment was assessed with a two-tailed unpaired Student’s t test (α = 0.05), using Prism 8 (Graphpad, La Jolla, CA). Bonferonni-Šidák method was used to correct for multiple comparisons (α = 0.025).

Results

Mice treated with pioglitazone (n = 6) had significantly higher expression of striatal PON2 (2-tailed t(10) = 3.9, p = 0.003) compared to an equal number of vehicle treated subjects (Figure 1A). Mean PON2 expression was 36.5% higher in pioglitazone treated mice. PON2 expression was not significantly changed in the hippocampus of pioglitazone-treated mice compared with respective vehicle-treated controls (2-tailed t(9)=1.8, p = 0.099).

Figure 1:

PON2 protein expression in the striatum and hippocampus of mice treated with pioglitazone (PIO). (A) PON2 expression in PIO-treated mice relative to vehicle (VEH) in striatum and hippocampus. Optical density of PON2 bands were first normalized to total protein per lane and then to vehicle group. (B) Representative blot showing PON2 expression in striatum in vehicle (VEH) and PIO-treated mice, and corresponding image of total protein. (C) Nfe2l2 mRNA expression in striatum and hippocampus. mRNA levels were normalized to β-actin, Tubb, Ppid, and Alu-Seq. Results are presented as mean ± SEM, *p<0.025, **p<0.005.

To further confirm pioglitazone’s activity, we determined changes in expression of the transcription factor Nuclear factor erythroid 2-related factor 2 (Nfe2l2; also known as Nrf2), a known pioglitazoneinducible gene that regulates the expression of antioxidant proteins. Nfe2l2 mRNA was significantly up-regulated in the striatum (2-tailed t(10)=3.1, p = 0.011) and approached significance in the hippocampus (2-tailed t(9)=2.5, p = 0.036; not significant with Bonferonni-Šidák correction) of pioglitazone treated mice (Figure 1C).

Discussion

Our results reveal that pioglitazone up-regulates striatal PON2 expression in vivo. This outcome provides an intriguing mechanism to explain the neuroprotective properties of pioglitazone. Unexpectedly, we found regional variation in pioglitazone-induced PON2 expression, despite ubiquitous expression of PON2². This region-specific effect of pioglitazone resonates with the preferential expression of PON2 in striatum², but it also could be related to regional differences in mitochondrial bioenergetics. However, it is possible that pioglitazone would induce an increase in PON2 expression in hippocampus under different experimental conditions.

Despite promising preclinical results⁵ pioglitazone has had mixed outcomes in clinical studies of its neuroprotective properties. In a retrospective study of a Norwegian population of diabetic patients, glitazone use was associated with lower risk of developing PD⁸. However, a retrospective study of a Taiwanese population did not find an association between pioglitazone and reduced risk of developing PD, but compared to the Norwegian study, the sample size was much smaller (^~16,000 compared to 100,000 patients) and had a shorter follow-up period (5 years versus 10 years)⁹. A recent prospective clinical trial with PD patients (a ‘Neuroprotection Exploratory Trials of Parkinson’s Disease’ (NET-PD) study), found that pioglitazone treatment for up to 44 weeks in 210 patients (including placebo group), did not significantly alter Unified Parkinson Disease Rating Scale (UPDRS) scores¹⁰ and this study concluded that pioglitazone at the doses studied is unlikely to modify progression of PD. However, it is worth noting that the lack of a detectable effect in this study could be due to the relatively short duration of pioglitazone treatment, or that the extensive loss of nigrostriatal DA neurons in these patients was too great for a protective effect to be discerned. Another factor that should be considered in interpretation of this prospective trial is that patients were taking type-B monoamine oxidase (MAOB) inhibitors in addition to pioglitazone, which conceivably could mask a neuroprotective effect of pioglitazone as there is evidence that MAO-B inhibitors have symptomatic and possibly protective effects in PD. In the NET-PD study, 2 doses of pioglitazone were employed, 15 or 45 mg per day, which while relevant to treatment of type 2 diabetes mellitus, are lower than the equivalent animal doses used here in mice or in a nonhuman primate PD model that demonstrated neuroprotective properties of pioglitazone⁵. We feel that further studies are warranted to investigate the link between pioglitazone-induced PON2 expression and protection against DA neuron loss.

In summary, we found that systemically administered pioglitazone increases the expression of PON2 in striatum, and this likely contributes to the neuroprotective effects of pioglitazone observed in preclinical models of PD, ischemia and stroke. We hope that these data stimulate research into other pharmacological tools to activate PON2 expression in brain. Pharmacological activation of PON2 might be especially useful in patients with identified genetic variants that are linked to mitochondrial dysfunction. Stimulation of central PON2 expression in adults promises to be successful and welltolerated as it relies on reinstating the relatively high levels that occurred during development².

Highlights.

• Paraoxonase-2 enhances mitochondria function and mitigates oxidative stress (OS)

• OS contributes to a variety of disorders including Parkinson’s Diseases and stroke

• Pioglitazone is neuroprotective in a variety of neurological disorders

• Pioglitazone stimulates PPARγ and increases paraoxonase-2 expression

Abbreviations

MPTP

1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine

NET-PD

Neuroprotection Exploratory Trials of Parkinson’s Disease

Nfe2l2

Nuclear factor erythroid 2-related factor 2

PON2

Paraoxonase-2

PPARγ

peroxisome proliferator-activated receptor gamma

PPRE

PPAR response element

UPDRS

Unified Parkinson Disease Rating Scale