Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Mar 24.
Published in final edited form as: Methods Mol Biol. 2019;1957:309–322. doi: 10.1007/978-1-4939-9158-7_19

Probing arrestin function using intramolecular FlAsH-BRET biosensors

Erik G Strungs 1, Louis M Luttrell 1, Mi-Hye Lee 1
PMCID: PMC7092779  NIHMSID: NIHMS1573894  PMID: 30919362

Summary:

Information contained in the structure of extracellular ligands is transmitted across the cell membrane through allosterically induced changes in G protein-coupled receptor (GPCR) conformation that occur upon ligand binding. These changes, in turn, are imprinted upon intracellular effectors like arrestins and help determine which of its many functions are performed. Intramolecular fluorescent arsenical hairpin (FlAsH) bioluminescence resonance energy transfer (BRET), in which both the fluorescence donor and acceptor are contained within the same protein, can be used to report on activation induced changes in protein conformation. Here, we describe a method using a series of Rluc-arrestin3-FlAsH-BRET biosensors to measure stimulus-induced changes in arrestin conformation in live cells. Each Rluc-arrestin3-FlAsH-BRET construct contains an N-terminal Renilla luciferase fluorescence donor that excites a fluorescent arsenical targeted to a different position within the protein by mutational insertion of a tetracysteine tag motif. Changes in net BRET upon GPCR stimulation can thus be viewed from multiple vantage points within the protein and used to develop an arrestin3 “conformational signature” that is receptor- and ligand-specific. This method can used to determine how differences in GPCR and ligand structure influence information transfer across the plasma membrane and to classify GPCRs and/or ligands based on their capacity to induce different arrestin3 activation modes.

Keywords: Arrestin, bioluminescence resonance energy transfer, fluorescent arsenical, G protein-coupled receptor, ligand efficacy, signal transduction

1. Introduction:

Despite their relatively simple architecture, arrestins perform remarkably diverse roles in cells [1]. The non-visual arrestins, arrestin2 and 3 (β-arrestin1 and 2), for example, are able to recognize and bind hundreds of different activated GPCRs and are integral to the control of GPCR desensitization, sequestration and intracellular trafficking. At the same time, they can interact with and localize dozens of cargo proteins, including signaling pathway intermediates that influence the tonic level of pathway activity and in some cases confer GPCR-dependent regulation. Importantly, these actions are influenced by multiple factors, among them cell background, the GPCR to which the arrestin has bound, and the structure of the ligand, suggesting that, like receptors, arrestins can adopt conformationally discrete activation modes that specify the functions(s) they will perform.

But how does it work? High-resolution x-ray crystallography has provided atomic level structural information on arrestins alone and in complex with rhodopsin [2-6]. While these “static” structures provide critical details about the conformational rearrangements that occur upon arrestin activation, they are unable to capture the kinetics of the process or explain how receptor and ligand structure impose their effects on arrestin function. A useful approach to addressing these questions involves fluorescence or bioluminescence resonance energy probes (FRET or BRET). BRET is a phenomenon that results from non-radiative energy transfer between an enzymatically-activated luminescent substrate donor and a fluorophore acceptor. BRET occurs only when the donor and acceptor are in extremely close proximity (typically <10 nM) and changes in observed BRET are generally interpreted as movement of the donor and acceptor relative to each other. BRET was initially employed to examine regulated protein-protein interactions, e.g. arrestin recruitment to a GPCR [7]. In this setting, the donor, e.g. Renilla luciferase (Rluc) and acceptor, e.g yellow fluorescent protein (YFP), are appended to distinct proteins. Due to the proximity requirement for energy transfer to occur, increases in intermolecular BRET can be interpreted as a protein-protein interaction. Alternatively, conformational shifts within a protein can be observed using an adaptation known as intramolecular BRET, in which both donor and acceptor are appended to a single protein, e.g. Rluc-arrestin-YFP [8]. In this case, changes in BRET may reflect a number of things including, but not limited to, conformational shifts within the protein of interest, steric interference of the donor and acceptor by recruitment of binding partners, or changes in the subcellular environment of the reporter.

A limitation of intramolecular BRET or FRET using conventional donor-acceptor pairs is that relatively large donor and acceptor proteins must be either appended to the N- and C-terminus of the protein of interest or inserted within the protein itself, potentially interfering with its function [8,9]. A less disruptive approach is to employ a small membrane-permeant fluorescein derivative with two arsen-(III) substituents (fluorescein arsenical hairpin binder or FlAsH) as the acceptor along with either cyan fluorescent protein or Rluc as the FRET or BRET donor, respectively. The FlAsH acceptor can then be targeted to multiple sites within the protein by mutational insertion of a small tetracysteine tag motif [10]. Intramolecular FlAsH FRET or BRET has been used to report on activation-dependent conformational changes in arrestin3 [11,12], as well as to characterize the temporal relationships between GPCR-arrestin binding (measured by intermolecular FRET) and the conformational rearrangements that accompany arrestin activation (measured by intramolecular FlAsH-FRET) [12]. Here, we describe a method using a series of Rluc -arrestin3-FlAsH-BRET biosensors to measure stimulus-induced changes in arrestin conformation in live cells. The observed changes in BRET observed from multiple vantage points within the protein can be used to develop an arrestin3 “conformational signature” that is receptor- and ligand-specific and to classify GPCRs and/or ligands based on their capacity to induce different arrestin3 activation modes [11].

2. Materials

2.1. Design and validation of arrestin3 FlAsH-BRET biosensors

  1. The series of six Rluc-arrestin3-FlAsH expression plasmids employed here were constructed by inserting a cDNA sequence encoding the tetra-cysteine motif, C-C-P-G-C-C, immediately following amino acid residues 77, 140, 171, 225, 263, and 410 of arrestin3 (see Figure 1A) into the previously described pcDNA3.1-Rluc-arrestin3 plasmid [13]. Constructs were prepared using a modification of the precise gene fusion polymerase chain reaction (PCR) method of Yon and Fried [14]. For each construct, two PCR steps were performed using the primer sets shown in Table 1. The first step was to generate two PCR fragments using the primer pairs: RlucHindF/FlashR and FlashF/RlucApalR. One PCR product contained a HindIII restriction site at the 5’ end and the C-C-P-G-C-C FlAsH motif at the 3’ end, while the other contained the complementary FlAsH sequence at the 5’ end and an ApaI restriction site at the 3’end. A second PCR step was used to fuse the two fragments using three primers: RlucHindF, FlashR and RluApalR, and the two PCR fragments as template DNA. The resultant full-length arrestin3 PCR product containing the FlAsH motif insert was digested with HindIII and ApaI and cloned into the parent pcDNA3.1-Rluc-arrestin3 plasmid to generate the Rluc-arrestin3-FlAsH1-6 expression plasmids. All constructs were verified by dideoxynucleotde sequencing. As shown in Figure 1B, the resultant Rluc-arrestin3-FlAsH mutants enable monitoring BRET between the N-terminal Rluc donor and a fluorescent arsenical acceptor located at various positions within N- and C-terminal globular domains of arrestn3 (see Note 1).

  2. Confirmation that insertion of the tetra-cysteine motif does not compromise arrestin3 function was obtained by measuring inter-molecular BRET between each Rluc-arrestin3-FlAsH construct and the GPCR of interest bearing a C-terminal YFP tag (see Note 2). These assays are performed in the absence of the fluorescent arsenical to permit measurement of BRET between the FlAsH mutant Rluc-arrestin3 and GPCR-YFP, and change in net BRET (Δ Net BRET) is compared with that of the unmodified parent Rluc-arrestin3 construct. Figure 1C shows the comparison of the Δ Net BRET between Rluc-arrestin3 and each of six Rluc-arrestin3-FlAsH constructs upon recruitment to the type 1 human parathyroid hormone receptor (hPTH1R). Note that five of the FlAsH constructs (F1, F2, F4, F5 and F6) produce a BRET signal similar to the control, while one construct (F3) does not generate a significant signal (see Note 3).

Figure 1:

Figure 1:

Open in a new tab

Construction, validation and use of arrestin3 FlAsH-BRET biosensors. A. Linear representation of a panel of six Rluc-arrestin3-FlAsH BRET reporters (F1-F6) constructed by inserting the tetracysteine motif, C-C-P-G-C-C, following amino acid residues 77, 140, 171, 225, 263, and 410 of Rluc-arrestin3. The location of each FlAsH motif is shown in relation to the globular N and C domains of arrestin3, as well as the clathrin and adapter protein 2 (AP2) binding sites and reported phosphorylation sites (Ser361 and Thr383) in the arrestin3 C-terminal regulatory (R2) domain. B. Three-dimensional computational model of Rluc-arrestin3-FlAsH1-6 showing the spatial orientation of the six tetracysteine motifs as yellow space-filling molecules relative to the Rluc moiety. The FlAsH molecule is depicted as bound to the F1 site. The structure of the N-terminal Renilla luciferase is shown in blue. The position of the RLuc is highly flexible in this model and was manually placed for ease of representation. C. Typical intermolecular BRET results demonstrating the efficiency of ligand-dependent recruitment of Rluc-arrestin3 FlAsH1-6 to the hPTH1R. The bar graph depicts Mean ± SEM of independent biological replicates (n=3). D. Representative intramolecular Rluc-arrestin3 FlAsH1-6 BRET signature produced by interrogating the hPTH(1-34) stimulated hPTH1R with each of the six biosensors shown in panel A. The bar graph depicts Mean ± SEM of independent biological replicates (n=5). In panels C and D; * p<0.05, # p<0.005 greater or less than vehicle stimulated control.

TABLE 1:

Primer sequences used to generate Rluc-arrestin3-FlAsH1-6

Primer Sequence
RlucHindF ATCAAGCTTGCGTTACCGGATCCATGGGTGAA
RlucApaIR AACGGGCCCTCTAGACTAGCAGAACTGGTCA
FlAsH1F GGATCCTGTCGATGGTTGTTGTCCTGGTTGTTGTGTGGTGCTTGTGGATC
FlAsH1R GATCCACAAGCACCACACAACAACCAGGACAACAACCATCGACAGGATCC
FlAsH2F GAGGACACAGGGAAGTGTTGTCCTGGTTGTTGTGCCTGTGGAGTAGAC
FlAsH2R GTCTACTCCACAGGCACAACAACCAGGACAACACTTCCCTGTGTCCTC
FlAsH3F GCTTATCATCAGAAAGTGTTGTCCTGGTTGTTGTGTACAGTTTGCTCCTG
FlAsH3R CAGGAGCAAACTGTACACAACAACCAGGACAACACTTTCTGATGATAAGC
FlAsH4F CCACGTCACCAACAATTGTTGTCCTGGTTGTTGTTCTGCCAAGACCGTCA
FlAsH4R TGACGGTCTTGGCAGAACAACAACCAGGACAACAATTGTTGGTGACGTGG
FlAsH5F AGCTTGAACAAGATGACCAGTGTTGTCCTGGTTGTTGTGTGTCTCCCAGTTCCACATT
FlAsH5R AATGTGGAACTGGGAGACACACAACAACCAGGACAACACTGGTCATCTTGTTCAAGCT
FlAsH6R ACGGGCCCTCTAGACTAACAACAACCAGGACAACAGCAGAACTGGTCATC
Open in a new tab

2.2. Cell culture and transfection

  1. pcDNA3.1Rluc-arrestin3-FlAsH1-6 expression plasmids (Addgene; Plasmids #74129, #74130, #74131, #74132, #74133, #74134)

  2. cDNA expression plasmid encoding the GPCR of interest without a fluorescent tag

  3. HEK293 cells (ATCC; CRL1573)

  4. Minimum essential medium (MEM) without additives

  5. MEM supplemented with 10% fetal bovine serum and 1% antibiotic/antimycotic solution

  6. FuGENE® HD transfection reagent (Promega Corporation)

  7. 10 cm sterile tissue culture plates or 75 cm2 tissue culture flasks

  8. 6-well sterile tissue culture plates

  9. Sterile 1.5 mL clear polypropylene microfuge tubes with snap caps

2.3. Intramolecular FlAsH BRET

  1. Dulbecco’s Phosphate Buffered Saline (DPBS)

  2. DPBS containing 2 mM EDTA

  3. Hank’s Balanced Salt Solution (HBSS) with calcium and magnesium and without phenol red

  4. TC-FlAsH™ In-Cell Tetracysteine Tag Detection Kit (Life Technologies Corp.). Each kit contains sufficient reagents for approximately 360 96-well plate wells. The FlAsH-EDT2 Labeling Reagent is supplied as an 800X solution. To avoid repeated freeze-thaw cycles, store the FlAsH-EDT2 Labeling Reagent in 5-10 μL aliquots in microfuge tubes at −20 °C in the dark (see Note 4). BAL Wash Buffer is supplied as a 100X concentrate and is stored at 4 °C. BAL wash buffer should be diluted to 1X in HBSS at room temperature just before use.

  5. BRET buffer: 1mM CaCl2, 140mM NaCl, 2.7mM KCl, 900μM MgCl2, 370μM NaH2PO4, 5.5mM d-glucose, 12mM NaHCO3, 25mM HEPES, pH 7.4

  6. Coelenterazine (NanoLight Technology): Prepare 2.2 mM stock solution by dissolving 10 mg coelentrazine in a solution of 10 mL absolute ethanol and 200 μL 5N HCl. Store 1.0 mL aliquots in black microfuge tubes at −80 °C.

  7. GPCR ligand stocks as appropriate for the experiment

  8. TempAssure PCR 8-tube strips or clear round bottom 96-well plates for dispensing ligands and coelentrazine

  9. Opaque white 96-well plates for BRET assay

  10. 8-Channel multi-channel pipettes (1-20 μL)

  11. Berthold Technologies Tristar 3 LB 941, Molecular Devices i3x Multi-Mode Detection Platform, or similar instrument with 485nm excitation and 525-585 emission filters (see Note 5)

  12. Microsoft Excel®, GraphPad Prism® or similar spreadsheet software for data calculation, graphing, and statistical analysis

3. Methods

3.1. Cell culture and transfection

  1. Maintain HEK293 cells in 10 cm tissue culture plates or 75 cm2 flasks using MEM supplemented with 10% fetal bovine serum and 1% antibiotic/antimycotic solution (see Note 6).

  2. On Day 1, passage 90% confluent HEK293 cells into 6-well tissue culture plates at a seeding density that will attain approximately 50% confluence within 24 hours. Each individual well of a 6-well plate will yield sufficient cells for six wells of a 96-well plate. For small experiments, one or two wells of 6-well plate can be transfected with each reporter. Transfecting two wells with each reporter allows identically transfected cells to be labeled with FlAsH-EDT2 Labeling Reagent for intramolecular FlAsH BRET or left unlabeled for determining background BRET (see Step 3.2.8).

  3. On Day 2, transfect 50% confluent cells with one Rluc-arrestin3-FlAsH expression plasmid along with the GPCR of interest.

  4. For each transfection, combine 94 μL of plain MEM with 6 μL of FuGENE® HD transfection reagent in a sterile plastic 1.5 mL microfuge tube. Vortex to mix and pulse in a microfuge. Allow to stand for 5 min at room temperature.

  5. Add 1.0-1.5 μg of cDNA expression plasmid encoding the untagged GPCR of interest, e.g. pCMV6-hPTH1R, and 100-300 ng of one Rluc-arrestin3-FlAsH expression plasmid to each tube (see Note 7). Flick tubes to mix and pulse in a microfuge. Allow to stand at room temperature for 15 min.

  6. Add the transfection mixtures to each well of a 6-well plate and return cells to the tissue culture incubator. Allow cells to incubate at 37 °C overnight.

  7. On Day 3, aspirate and discard medium from cells. Replace with 2 mL/well of MEM containing 10% FBS and antibiotic/antimycotic and return cells to incubator. Allow cells to incubate at 37 °C overnight. Cells will be labeled on Day 4 after attaining 90% confluence.

3.2. FlAsH labeling the tetracysteine tag

  1. On Day 4, aspirate and discard growth medium from cells. Wash monolayers 1X with DPBS to remove serum.

  2. Detach cells by adding 1 mL of DPBS containing 2 mM EDTA to each well. Gently pipette cells and transfer to 1.5 mL microfuge tubes.

  3. Centrifuge at 3,000 x g for 3 minutes to pellet cells. Aspirate and discard the supernatant. Resuspend the cell pellet in 500 μL of HBSS. Gently triturate several times to disperse cells.

  4. Add 0.67 μL (2.5 μM final concentration) of FlAsH-EDT2 Labeling Reagent from the TC-FlAsH™ In-Cell Tetracysteine Tag Detection Kit to each microfuge tube. Gently invert tubes 4-5 times to mix. Incubate at room temperature in the dark for 30 min (see Note 8).

  5. Centrifuge at 3,000 x g for 3 minutes to pellet cells. Aspirate and discard the labeling medium. Resuspend cells by gentle trituration in 1 mL of room temperature 1X BAL Wash Buffer diluted from the 100X stock with HBSS.

  6. Centrifuge at 3,000 x g for 3 minutes to pellet cells. Aspirate and discard the wash buffer. Resuspend cells in 650 μL of BRET buffer, gently triturating several times to ensure cells are evenly dispersed.

  7. Transfer 100 μL of cells suspended in BRET buffer per well of an opaque white 96-well plate (approximately 1.5 x 105 cells/well) as needed for the experiment (see Notes 9 and 10). After preparing the experimental plate, wrap it in aluminum foil and maintain it in the dark at room temperature until ready to perform the experiment.

  8. To determine background BRET, it is necessary to prepare cells from identically transfected wells following steps 3.2.1-7, except for omitting the FlAsH-EDT2 Labeling Reagent from step 3.2.4. The background BRET ratio is that measured in the absence of the fluorescence acceptor, which in this case is achieved by omitting the fluorescent bi-arsenical (see Step 3.5.2).

3.3. Preparing the drug plate

  1. Prepare vehicle and ligand solutions during the 30 min FlAsH labeling period.

  2. Dilute ligand stocks to 12X desired final concentration in BRET buffer (see Note 11). Prepare nonstimulated controls using the same dilution of ligand vehicle in BRET buffer.

  3. Aliquot ~15 μL of 12X ligand per experimental well into PCR tube strips or round bottom 96-well drug plates, whichever is more convenient. Stimulations will be carried out using a multi-channel pipettor to transfer ligand one row at a time so the drug plate must be laid out in a grid corresponding to the layout of the experimental plate (see Note 12).

3.4. Intramolecular FlAsH BRET assay

  1. Just before use, dilute the 2.2 mM stock coelentrazine solution coelentrazine to 12X desired final concentration (60 μM) in BRET buffer. Once added to the cell plate the final coelentrazine concentration will be 5 μM. Transfer the 12X solution into PCR tube strips or round bottom 96-well drug plates for dispensing with a multi-channel pipettor.

  2. Using an appropriate multi-mode plate reader, verify Rluc-arrestin3-FlAsH expression and tetracysteine tag labeling by measuring TC-FlAsH fluorescence with an excitation wavelength of 485 nm and emission wavelength of 535 nm.

  3. Using a multi-channel pipettor transfer 10 μL of 12X ligand from the PCR tube strips or round bottom 96-well drug plate to the corresponding wells in the experimental plate. Pipette up and down several times to ensure mixing. Change pipette tips between rows to avoid mixing ligands or cells expressing different reporters.

  4. Allow cells to pre-incubate with ligand for 0-10 min at room temperature before adding coelentrazine (see Notes 13 and 14).

  5. Using a multi-channel pipettor transfer 10 μL of coelentrazine solution from the PCR tube strips or round bottom 96-well drug plate to the corresponding wells in the experimental plate. Pipette up and down several times to ensure mixing. Change pipette tips between rows to avoid mixing ligands or cells expressing different reporters.

  6. Return the experimental plate to the plate reader and allow 2 min for the Rluc emission to stabilize, then record 6 consecutive 1 sec readings of Rluc (485 nm) luminescence and TC FlAsH fluorescence (530 nm; YFP setting) at 1 min intervals. Total read time in 5 min, beginning 2 min after the addition of coelentrazine.

3.5. Data analysis and interpretation

  1. The BRET ratio is the TC FlAsH fluorescence signal (530 nm) over the Rluc signal (485 nm) measured simultaneously. This ratio is automatically calculated by the software of multi-mode plate readers and exported as a Microsoft Excel spreadsheet.

  2. Determine the Δ Net BRET for each ligand-stimulated condition relative to vehicle-stimulated in the same experiment. For each well, the mean of the 6 consecutive reads is calculated to obtain the average BRET ratio. The Net BRET ratio for each well is then calculated by subtracting the background BRET ratio measured in cells in the same experiment that lack the BRET acceptor, i.e. were not labeled with FlAsH-EDT2, from the mean BRET ratio observed in FlAsH-EDT2 labeled cells. The Δ Net BRET is then obtained by dividing the Net BRET ratio obtained in stimulated cells by the Net BRET ratio measured in cells exposed to vehicle only. This ratio represents the fractional change in BRET occurring upon ligand stimulation, and is typically +/− 0.01-0.05 using our Rluc-arrestin3-FlAsH reporters. If duplicate or triplicate wells are used, a coefficient of variance (CV) can be determined and the mean Δ Net BRET technical replicates on the plate can be used as a datum for determining the mean Δ Net BRET across multiple biological replicates of the experiment (see Note 15).

  3. The GPCR-specific “conformational signature” of activated arrestin3 can be displayed graphically plotting the Δ Net BRET observed upon ligand stimulation for each of the six Rluc-arrestin3-FlAsH reporters as in Figure 1D (see Note 16).

Acknowledgements:

This work was supported by National Institutes of Health Grants R01 DK055524 (LML), R01 GM095497 (LML), Department of Veterans Affairs Merit Review Grant I01 BX003188 (LML), and the Research Service of the Charleston, SC Veterans Affairs Medical Center. The contents of this article do not represent the views of the Department of Veterans Affairs or the United States Government.

Footnotes

1.

This technique is adaptable to other allosterically regulated proteins, e.g. GPCRs themselves [15]. In selecting the site for insertion of the tetra-cysteine motif it is helpful to take advantage of x-ray crystallographic structures if available (Figure 1B). Optimal sites would be in flexible regions of the protein that might be expected to move upon activation and away from key structural elements necessary for protein folding and stability. Since arrestin activation is associated with displacement of the C-terminus and an approximately 20° rotation of the N and C domains relative to one another [4,6], we chose to place tetra-cysteine motifs near the C-terminus and at sites predicted to be on the surface of the N and C domains away from known sites of GPCR interaction.

2.

Rluc luminescence cannot be visualized with sufficient resolution using microscopy equipment available to most laboratories, and cells loaded with FlAsH-EDT2 may fluoresce diffusely upon direct excitation, making direct visualization of their recruitment to an activated GPCR difficult. We chose to validate that FlAsH mutant arrestins are functional by quantifying the efficiency of intermolecular BRET between each Rluc-arrestin3-FlAsH construct and a YFP-tagged GPCR.

3.

In our experiments, we chose to include the F3 construct, which is poorly recruited to GPCRs, as an internal negative control on the experimental plate.

4.

The FlAsH-EDT2 Labeling Reagent is a bi-arsenical compound and toxic. Wear appropriate personal protective equipment when handling and discard used solutions as specified by your Institutional guidelines for toxic waste.

5.

The method described here is for BRET measurements performed using a Berthold Technologies Tristar 3 LB 941, but is readily adaptable to other instruments. Note that intramolecular Δ Net BRET signals are often small, on the order of 1-5%, so the plate reader must have sufficient sensitivity and stability to perform reliable measurements.

6.

Any readily transfectable cell line and transient transfection protocol can be used once optimized. The method described here has been optimized for HEK293 cells transfected using FuGENE® HD.

7.

The optimal ratio of GPCR and Rluc-arrestin3-FlAsH expression plasmids needs to be determined empirically. Since the Δ Net BRET observed upon stimulation reflects the “population average” change in arrestin conformation, the most consistent results are obtained when experiments are performed in relative receptor excess, such that at steady state the maximum attainable fraction of Rluc-arrestin3-FlAsH reporter is receptor-bound. We recommend performing two test transfections: 1) transfect a fixed amount of Rluc-arrestin3-FlAsH reporter plasmid (200 ng) and increasing amounts of GPCR plasmid (0.1-1.5 μg) to determine the quantity of GPCR cDNA at which the Δ Net BRET signal plateaus; 2) transfect a fixed amount GPCR plasmid (1.0-1.5 μg) and increasing amounts of Rluc-arrestin3-FlAsH reporter plasmid (10-500 ng) to determine the quantity of reporter plasmid that gives the most reproducible Δ Net BRET signal. In the latter case, as quantity of Rluc-arrestin3-FlAsH reporter plasmid is decreased the Δ Net BRET will become greater but BRET signal intensity will decrease leading to more variability. In our hands, 100-300 ng of Rluc-arrestin3-FlAsH reporter plasmid per well produces the most consistent and robust Δ Net BRET signals.

8.

The optimum final concentration of FlAsH-EDT2 Labeling Reagent may vary from 1-10 μM and labeling time from 30-60 min. For labeling Rluc-arrestin3-FlAsH proteins in detached HEK293 cells we find that using 2.5 μM final concentration FlAsH-EDT2 Labeling Reagent and labeling for 30 min gives consistent results.

9.

The optimal cell number per well will vary somewhat between different plate readers and should be determined empirically in pilot assays.

10.

For a simple experiment, e.g. generating an Rluc-arrestin3-FlAsH BRET signature in response to agonist exposure, we might transfect two wells of a 6-well plate with each pcDNA3.1Rluc-arrestin3-FlAsH1-6 expression plasmid along with the receptor of interest. Following the protocol above each transfected well provides enough transfected cells for six wells of a 96-well plate. Transfecting two wells with each reporter permits cells isolated from one well to be labeled with FlAsH-EDT2 Labeling Reagent to measure intramolecular FlAsH-BRET, while cells from the second well are processed identically except for omitting the labeling reagent to measure background BRET. Cells expressing the reporters would be arrayed in a 6 row X 8 column grid on a single 96-well plate, with each row representating a different Rluc-arrestin3-FlAsH construct and each column representing a ligand or vehicle treatment. The first two columns are for unlabeled vehicle-treated cells (background BRET), and the next six columns are for labeled vehicle- and agonist-treated cells (FlAsH-BRET). We recommend using at least two adjacent wells for each ligand-reporter condition (technical replicates) per plate so that CV can be determined for quality control.

11.

Since the most consistent Rluc-arrestin3-FlAsH BRET profiles are obtained when the maximum fraction of reporter is GPCR-bound, stimulations are usually carried out at saturating ligand concentration. It may be helpful to perform an initial ligand concentration-response curve to determine the ligand concentration that gives the maximum Δ Net BRET signal. In the example shown here, hPTH(1-34) stock (0.1 mM in sterile distilled water) was diluted to 1.2 μM in BRET Buffer (12X final concentration) to yield a final ligand concentration of 0.1 μM in the assay well.

12.

Depending on the experiment, e.g. performing concentration response curves, it may be more practical to prepare ligands in a 96-well drug plate. If using a microplate reader equipped with auto-injectors, it will be necessary to prepare both ligands and coelentrazine in 96-well plates.

13.

Both the time and temperature of ligand stimulation are relevant variables and should be determined empirically. Since coelentrazine should be added just prior to reading, when performing a time course experiment, stagger the addition of drug to the wells and add coelenterazine to all wells simultaneously. In our hands, the Net BRET ratios produced by Rluc-arrestin3-FlAsH reporters are stable from 2 and 10 min after ligand stimulation and we routinely pre-incubate for 3 min with ligand before adding coelantrazine (5 min ligand exposure before reading).

14.

We have also performed ligand stimulations at 37 °C to determine whether incubation temperature affected the Rluc-arrestin3-FlAsH BRET profile. For stable arrestin-binding GPCRs [16], e.g. the PTH1R, temperature has no significant effect on the profile, even though incubation at 37 °C allows the GPCR-arrestin complexes to exit the plasma membrane and transit to early endosomes.

15.

In our hands the observed Δ Net BRET for GPCR-stimulated change in Rluc-arrestin3-FlAsH BRET is reproducible enough that five to six biological replicates are sufficient to discern effects of +/− 0.01 with p<0.05.

16.

It should be evident that an Rluc-arrestin3-FlAsH1-6 BRET profile is not a “conformational signature” per se in that changes in intramolecular BRET reflect both changes in the distance/orientation of the donor and acceptor fluorophores due to conformational rearrangement, and steric effects generated by arrestin interaction with its receptor and non-receptor binding partners. Thus, it is not possible to ascribe the Rluc-arrestin3-FlAsH BRET signal at a given position to specific conformational shifts or engagement of binding partners. The utility of the method is in comparing/classifying the effects of different ligand/GPCR complexes on the arrestin3 signature. For example, we have found that features of the signature are conserved between receptors with similar arrestin binding/signaling characteristics, and that the Δ Net BRET at selected positions correlates with downstream arrestin function, e.g. ‘class A’ versus ‘class B’ trafficking [16] and arrestin-dependent ERK1/2 activation, suggesting that Rluc-arrestin3-FlAsH BRET probes can predict arrestin function based on the ligand-induced conformational signature [11].

References

  • 1.Peterson YK, Luttrell LM (2017) The Diverse Roles of Arrestin Scaffolds in G Protein-Coupled Receptor Signaling. Pharmacol Rev 69: 256–297 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Han M, Gurevich VV, Vishnivetskiy SA, Sigler PB, Schubert C (2001) Crystal structure of beta-arrestin at 1.9 A: possible mechanism of receptor binding and membrane translocation. Structure 9: 869–880 [DOI] [PubMed] [Google Scholar]
  • 3.Zhan X, Gimenez LE, Gurevich VV, Spiller BW (2011) Crystal structure of arrestin-3 reveals the basis of the difference in receptor binding between two non-visual subtypes. J Mol Biol 406: 467–478 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Shukla AK, Manglik A, Kruse AC, Xiao K, Reis RI, Tseng WC, Staus DP, Hilger D, Uysal S, Huang LY, Paduch M, Tripathi-Shukla P, Koide A, Koide S, Weis WI, Kossiakoff AA, Kobilka BK, Lefkowitz RJ (2013) Structure of active β-arrestin-1 bound to a G-protein-coupled receptor phosphopeptide. Nature 497: 137–141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kim YJ, Hofmann KP, Ernst OP, Scheerer P, Choe HW, Sommer ME (2013) Crystal structure of pre-activated arrestin p44. Nature 497:142–146 [DOI] [PubMed] [Google Scholar]
  • 6.Kang Y, Zhou XE, Gao X, He Y, Liu W, Ishchenko A, Barty A, White TA, Yefanov O, Han GW, Xu Q, de Waal PW, Ke J, Tan MH, Zhang C, Moeller A, West GM, Pascal BD, Van Eps N, Caro LN, Vishnivetskiy SA, Lee RJ, Suino-Powell KM, Gu X, Pal K, Ma J, Zhi X, Boutet S, Williams GJ, Messerschmidt M, Gati C, Zatsepin NA, Wang D, James D, Basu S, Roy-Chowdhury S, Conrad CE, Coe J, Liu H, Lisova S, Kupitz C, Grotjohann I, Fromme R, Jiang Y, Tan M, Yang H, Li J, Wang M, Zheng Z, Li D, Howe N, Zhao Y, Standfuss J, Diederichs K, Dong Y, Potter CS, Carragher B, Caffrey M, Jiang H, Chapman HN, Spence JC, Fromme P, Weierstall U, Ernst OP, Katritch V, Gurevich VV, Griffin PR, Hubbell WL, Stevens RC, Cherezov V, Melcher K, Xu HE (2015) Crystal structure of rhodopsin bound to arrestin by femtosecond X-ray laser. Nature 523: 561–567 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Charest PG, Bouvier M (2003) Palmitoylation of the V2 vasopressin receptor carboxyl tail enhances beta-arrestin recruitment leading to efficient receptor endocytosis and ERK1/2 activation. J Biol Chem 278: 41541–41551 [DOI] [PubMed] [Google Scholar]
  • 8.Charest PG, Terrillon S, Bouvier M (2005) Monitoring agonist-promoted conformational changes of beta-arrestin in living cells by intramolecular BRET. EMBO Rep 6: 334–340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Vilardaga JP, Bünemann M, Krasel C, Castro M, Lohse MJ (2003) Measurement of the millisecond activation switch of G protein-coupled receptors in living cells. Nat Biotechnol 21: 807–812 [DOI] [PubMed] [Google Scholar]
  • 10.Hoffmann C, Gaietta G, Bünemann M, Adams SR, Oberdorff-Maass S, Behr B, Vilardaga JP, Tsien RY, Ellisman MH, Lohse MJ (2005) A FlAsH-based FRET approach to determine G protein-coupled receptor activation in living cells. Nat Methods 2: 171–176 [DOI] [PubMed] [Google Scholar]
  • 11.Lee M-H, Appleton KM, Strungs EG, Kwon JY, Morinelli TA, Peterson YK, Laporte SA, Luttrell LM (2016) The conformational signature of activated arrestin3 predicts its trafficking and signaling functions. Nature 531: 665–668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Nuber S, Zabel U, Lorenz K, Nuber A, Milligan G, Tobin AB, Lohse MJ, Hoffmann C (2016) FRET-based β-arrestin biosensors reveal a rapid, receptor-dependent activation/deactivation cycle in living cells. Nature 531: 661–664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Perroy J, Adam L, Qanbar R, Chenier S, Bouvier M (2003) Phosphorylation-independent desensitization of GABA(B) receptor by GRK4. EMBO J 22: 3816–3824 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yon J, Fried M (1989) Precise gene fusion by PCR. Nucleic Acids Res 17: 4895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Devost D, Sleno R, Pétrin D, Zhang A, Shinjo Y, Okde R, Aoki J, Inoue A, Hébert TE (2017) Conformational profiling of the AT1 angiotensin II receptor reflects biased agonism, G protein coupling, and cellular context. J Biol Chem 292: 5443–5456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Oakley RH, Laporte SA, Holt JA, Caron MG, Barak LS (2000) Differential affinities of visual arrestin, beta arrestin1, and beta arrestin2 for G protein-coupled receptors delineate two major classes of receptors. J Biol Chem 275: 17201–17210 [DOI] [PubMed] [Google Scholar]

RESOURCES