Morphological and molecular evidence for first records and range extension of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

Sushant V Sanaye; Rakhee Khandeparker; Rayadurga Anantha Sreepada; Mamatha S Shivaramu; Harshada Kankonkar; Jayu Narvekar; Mukund Gauthankar

doi:10.1371/journal.pone.0220420

. 2020 Mar 24;15(3):e0220420. doi: 10.1371/journal.pone.0220420

Morphological and molecular evidence for first records and range extension of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

Sushant V Sanaye ¹, Rakhee Khandeparker ¹, Rayadurga Anantha Sreepada ^1,^*, Mamatha S Shivaramu ^1,^¤, Harshada Kankonkar ¹, Jayu Narvekar ², Mukund Gauthankar ¹

Editor: Rui Rosa³

PMCID: PMC7092974 PMID: 32208467

Abstract

Accurate information of taxonomy and geographic range of seahorse species (genus Hippocampus) is the first step in preparing threat assessments and designing effective conservation measures. Here, we report first records and a range extension of the Japanese seahorse, Hippocampus mohnikei (Bleeker, 1853) from the Mandovi estuarine ecosystem of Goa, central west coast of India (CWCI) based on morphological and molecular analyses. The morphometric and meristic traits, particularly short snout (29–35% head length), double cheek spine, low coronet, long tail (51.2–57.9% of standard length), 11 trunk rings, 37–39 tail rings, 15–16 dorsal and 12–14 fin rays observed in four collected specimens matched with the reported key diagnostic morphological criteria of vouchered specimens of H. mohnikei. The seahorse mitochondrial cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b) genes were partially sequenced for conclusive genetic identification of the species under study. Molecular analysis showed that all four individuals clustered together suggesting a monophyletic lineage. Using the maximum similarity with GenBank database, maximum likelihood network and subsequent morphological analysis, the identity of the collected seahorse species was reconfirmed as H. mohnikei. With this new report, the geographic range of H. mohnikei extended significantly to the west from its previously known range. This new sighting of H. mohnikei could indicate a long-distance dispersal facilitated by the prevailing oceanic circulation in the Indo-Pacific region or increased habitat suitability in bay-estuarine systems of Goa, CWCI. Comparison of the pair-wise genetic distances (Kimura 2-parameter) based on COI and Cyt b sequences revealed that the specimens examined in this study are genetically closer to H. mohnikei populations from Vietnam and Thailand than they are to those in Japan and China. To test the hypothesis whether H. mohnikei are vagrants or previously unreported established population, long-term inter-annual sampling and analyses are warranted.

Introduction

Seahorses (Syngnathiformes; Syngnathidae) belonging to the single genus, Hippocampus (Rafinesque, 1810) are a fascinating and remarkable group of fishes with their unusual body shape and their biology, with males incubating the fertilized eggs in a brood pouch [1]. They are small, cryptic, and sedentary marine fishes that occur worldwide in shallow temperate to tropical waters in a wide variety of habitats, including seagrass beds, estuaries, coral and rocky reefs and mangroves [2–4]. Their remarkable ability to camouflage with structurally complex habitats further reduces the risk of predation [5], while providing stealth for prey capture [6]. However, these biological traits often also make them challenging for scientists to research and quantify.

The primary step in preparing threat assessments and designing effective conservation of seahorse populations is highly dependent on the precise identification of individual species in and beyond known geographic distributions [7]. Out of 44 recognized seahorse species (Genus Hippocampus) throughout the world [8], H. kelloggi, H. kuda, H. spinosissimus and H. trimaculatus are common in Indian coastal marine waters [9,10]. In addition, sightings based on morphological identification of single specimens of H. mohnikei from Palk Bay, southeastern India [11], H. borboniensis [12] and H. montebelloensis [13] from the Gulf of Mannar, southeast coast of India and H. camelopardalis from the Gulf of Kachchh, northwest coast of India [14] have been reported. Another seahorse species, H. histrix, is also suspected to occur in Indian coastal waters [15]. The validity of H. borboniensis and H. montebelloensis as separate species, however, is currently under revision due to their synonymity with H. kuda and H. zebra, respectively [16].

The utility of morphological traits commonly used in diagnosis of Hippocampus spp. is quite challenging as they lack certain key physical features (e.g. pelvic and caudal fins), and have high variability in body proportion, color (camouflage) and skin filaments, fin-ray and trunk-ring numbers; any of these traits might overlap between species [3,17]. On the other hand, molecular methods have proved helpful in resolving morphologically challenging seahorse taxonomy [16,18], phylogenetic relationships within the genus Hippocampus [19,20], natural species boundaries [21–23] and genetic variability [22,24] of many seahorse species. An integrated approach combining morphological and genetic analyses [25] would aid in the management of demographically separate populations as independent units and allow international legal mechanisms and international agreements such as the Convention on International Trade in Endangered Species (CITES) to work effectively [26].

Generally, seahorses are sedentary fishes with typically small home ranges and patchy distribution in sheltered areas such as seagrasses and seaweeds [2,27,28]. However, instances of limited migrations by seahorses in search of proper habitat, food or holdfasts have been reported [28,29]. Evidences of long-distance dispersal of seahorse species via rafting (floating debris and seaweeds) [2,12,30] and subsequent colonization [21] have also been documented. The role of oceanic currents facilitating long-distance dispersal and range expansion of many seahorse species has also been highlighted [31–36].

The Japanese or Lemur-tail seahorse, Hippocampus mohnikei (Bleeker, 1853) is a small coastal seahorse (5–8 cm) inhabiting seagrasses, mangroves, oyster beds and mussel farms [37]. Original records indicated that the distribution of H. mohnikei is restricted or native to the coastal waters around Japan and Vietnam [17, 38–40]. However, new records of H. mohnikei from Cambodia, Malaysia, China, Korea Thailand and Vietnam [37], along with recently published studies from southeastern India [11] and Singapore [41], have greatly expanded the known geographical range of H. mohnikei within Southeast Asia. As a consequence of suspected reduction in population size to the tune of >30% over the past 10 years due to fisheries exploitation [37, 42–44], the status of H. mohnikei in the IUCN Red List of Threatened Species has been listed as ‘Vulnerable’ [45].

A probable specimen of H. mohnikei along the central west coast of India (CWCI) was recorded in February 2017 when a fisherman posted a picture of seahorse incidentally caught as bycatch in gill net operated in the Chapora estuary, Goa (India) (15.6120° N, 73.7506° E) on social media [S1 Fig] which was suspected to be an adult male of H. mohnikei. Sustained follow-up surveys for its occurrence in the surrounding environs of the Chapora estuary did not yield in any further specimens. Subsequently, four sub-adult specimens of H. mohnikei—hitherto sighted only from southeast coast of India [11], caught incidentally as bycatch in bag net fisheries during July, 2018 in the Mandovi estuarine system, Goa, CWCI have been examined here.

This contribution describes the first records of H. mohnikei from the western coastal India. To test further the hypothesis that the morphologically identified seahorse species is H. mohnikei, two mitochondrial DNA gene regions (loci), cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b) were partially sequenced for reconfirmation. The potential role of ocean currents on the range expansion of H. mohnikei to north-western Asia has also been discussed. In the wake of the vulnerability of seahorse populations to threats such as habitat alteration/destruction and fishing pressure globally, the present sighting of H. mohnikei in a bay-estuarine system of CWCI is of considerable conservation and biogeographic significance.

Materials and methods

Collection site and seahorses

The locality (Brittona, Goa, India, 15.3059°N, 73.5073°E, Fig 1) at which the examined seahorse specimens were collected is a shallow water littoral environment in close proximity to the mangrove-dominated Chorao Island in the Mandovi estuary, CWCI. The currents are largely tide dominated, the tides being semi-diurnal with a mean amplitude of 1.3 m. Currents are also influenced by the large seasonal freshwater influx [46] during the summer monsoon season (June to September). Temporal variations in abiotic and biotic factors influenced by monsoonal precipitation and seasonal upwelling render the collection location as one of the most ecologically complex ecosystems [47,48]. Significant lowering of salinity occurs when the freshwater discharge is at its maximum during monsoon. During the post- and pre-monsoon periods, the salinity at the surface and bottom remains high (~25 ppt). The bottom topography at the collection site is muddy and comprises mainly silt and clay with rich organic matter content [49]. The collection site is reported to harbor rich and diverse fishery resources and its importance in supporting the life history stages of several marine teleosts has been well-documented [50].

The present report is based on four specimens of H. mohnikei (females, MK1 and MK2; males, MK3 and MK4; Figs 2 and 3) that were incidentally caught as bycatch in bag nets attached to fixed stakes (total length, 25 m; mouth length, 5 m; cod end mesh size, 10 mm) operated at a depth of ~6 m in the Mandovi estuary during July 2018. Dead seahorses landed as bycatch in bag nets attached to stakes operated by local fishermen in the estuarine system formed the study material. No live seahorses were specifically caught for the present study. Fin clips from these dead seahorses were used for molecular analysis. Since, the present study did not involve any experimentation with live specimens, the approval of the ethics committee for the usage of live animals for experiments is therefore inconsequential.

Fig 2 — Sub-adult specimens of *Hippocampus mohnikei* (Bleeker 1853) (females, MK1 and MK2; males, MK3 and MK4; NIO1015/19) from the Mandovi estuary, Goa, central west coast of India.

Fig 3 — *Hippocampus mohnikei* (Bleeker 1853) (A-male (MK3) B-female (MK2) from the Mandovi estuarine system, Goa, central west coast of India (NIO1015/19).

Morphological analysis

Before subjecting them to a detailed analysis of morphological characteristics, seahorse specimens were carefully photographed (Nikon D7200, Japan) and sexed via observation of presence or absence of brood pouch. Morphometric measurements and meristic counts were carried out following standardized protocols [15,17,51]. Morphometric characters such as height (Ht, linear distance from the top of the head to the tip of the stretched tail), head length (HL), trunk length (TrL), tail length (TaL) and standard length (SL = HL+TrL+TaL), were measured. Measurements of snout length (SnL), ratio of head/snout lengths (HL/SnL), snout depth (SnD), head depth (HD), pectoral fin base length (PL) and dorsal fin base length (DL) were also conducted. All measurements were taken with the help of digital caliper to 0.1 mm and repeated to ensure accuracy. Trunk depths on 4^th (TD4) and 9^th (TD9) trunk rings were measured. The presence/absence of spines and dermal appendages was also noted. Meristic characters such as the number of trunk rings (TrR), tail rings (TaR), dorsal fin rays (DF), pectoral fin rays (PF) and anal fin rays (AF) were counted under stereo zoom microscope (Olympus SZX7, Japan) and the values were confirmed by triplicate counting. Brood pouch dimensions were measured in all male specimens.

Morphological identification of the collected seahorse specimens from Goa was based on comparison of the salient morphometric and meristic characters with the reported diagnostic features for different seahorse species [15,17,25]. For further confirmation, the morphological data of Goa specimens was compared with all vouchered specimens of H. mohnikei [11,15,25,52,53]. The voucher specimen collected from Goa is deposited in the national marine biodiversity repository at CSIR-National Institute of Oceanography, Goa, India (deposition ID: NIO1015/19).

Statistical analysis

Morphological data of H. mohnikei and two other commonly occurring seahorse species (H. kuda and H. trimaculatus) in the coastal waters of India was evaluated by one-way analysis of variance (ANOVA) followed by the Duncan’s multiple-range test [54]. The level of significance was tested at 5.0%, represented as P < 0.05. A comparison of morphological characters and meristic features of H. mohnikei (n = 4) with H. kuda (n = 10) and H. trimaculatus (n = 10) was made through principal component analysis (PCA). PCA was employed in which factor loadings based on components were used to determine the morphometric factors using PRIMER software (version 6) after square-root transformation.

Molecular analysis: DNA extraction, PCR amplification and sequencing

For gene-based phylogenetic analysis, fragments of dorsal fin from freshly landed dead seahorses were dissected and preserved in 95% ethanol at –20°C until subjected to DNA extraction. DNA extraction was carried out as described by Kumar et al. with a few modifications [55]. In brief, lysis buffer and sodium dodecyl sulfate were added to the fin tissue and vortexed. Further, RNase and Proteinase K were added to the mixture and incubated for 15–20 minutes at room temperature. After the incubation period, the DNA was extracted using phenol:chloroform:isoamyl alcohol (25:24:1) mixture. Precipitated DNA was washed with 70% cold ethanol. The gel electrophoresis was performed to confirm the quality and integrity of DNA.

The seahorse mitochondrial cytochrome oxidase subunit I (COI) gene was amplified using primers, forward (5’TCAACTAATCACAAAGACATCGGCAC3′) and reverse (5’ACTTCGGGGTGCCCAAAGAATC3′) [56]. Similarly, the mitochondrial cytochrome b (Cyt b) gene fragment was also amplified using PCR with seahorse-specific primers, forward (5’AACYAGGACYAATGRCTTGA3’) and reverse (5′GCASWAGGGAGGRKTTTAAC3′) [43]. Reactions were carried out in a thermal cycler (Veriti^® 96-well Thermal Cycler, Applied Biosystems, CA, USA). The amplification of COI and Cyt b genes was carried out by following cycling conditions as described by Lourie et al. with few modifications; an initial denaturation step of 95°C for 2 minutes followed by 39 cycles of 94°C for 30s, 55°C for 30s 72°C for 1 minute and a final extension at 72°C for 2 minutes [57]. Amplified PCR products of both COI and Cyt b genes were verified on agarose gel (1.5%) and purified for sequencing using PCR purification kit (Sigma Aldrich, USA). Gene sequence of the PCR products was determined using a taq dye deoxy terminator cycle sequencing kit (PerkinElmer, CA, USA) following supplier’s protocols. Sequencing reaction products were analyzed on 373 automated DNA Sequencer (Model 313 xl; Applied Biosystems, CA, USA). Amplification of the mitochondrial COI and Cyt b genes resulted in fragments of 609 bp and 639 bp, respectively.

Phylogenetic analysis

Nucleotide sequences generated for four specimens collected from Goa (MK1, MK2, MK3 and MK4) were deposited in GenBank under accession numbers MN595216, MN595218, MN595217 and MK330041.1 for COI and MN595213, MN595214, MN595215 and MK112274.2 for Cyt b genes, respectively). Sequence integrity and genetic affinity with known species was compared using the basic local alignment search tool (BLAST) of NCBI [58] (http://www.ncbi.nih.gov/BLAST). To complete the analysis, sequences of Goa specimens were aligned with 47 and 85 sequences of COI and Cyt b genes, respectively of all vouchered specimens of H. mohnikei retrieved from the GenBank database (accession numbers shown in S1 Table). The mitochondrial COI and Cyt b gene sequences were aligned using the ClustalW algorithm implemented in MEGA 7 [59]. To ascertain stable and reliable relationships among the seahorse species, phylogenetic trees, separately for COI and Cyt b genes were constructed through maximum likelihood (ML) method using K2P distances. The analyses were performed in MEGA 7, and confidence levels were assessed using 1000 bootstrap replications. The alligator pipefish, Syngnathoides biaculeatus was used as an outgroup species. Genetic distance values are used to estimate intraspecies and interspecies kinships and also as a basis for phylogeny analysis. The degree of genetic divergence within H. mohnikei from different geographical locations (S1 Table) was assessed using Kimura 2-parameter (K2P) distance model [60] implemented in MEGA 7 [59]. Codon positions included were 1^st+2^nd+3^rd+noncoding. All ambiguous positions with alignment gaps and missing data were removed from the sequences (pair-wise deletion option).

Prevailing ocean circulation

The Indo-Pacific region (encompassing South China Sea, East China Sea, and southeastern Bay of Bengal including the Indian subcontinent) comes under the influence of strong seasonal monsoon wind reversal and associated reversals in the surface currents [61]. During the winter monsoon season (November to February), the surface circulation in the region indicates current pattern from east to west and the direction of the circulation reverses during the summer monsoon season (June to September). Considering the previous reported occurrences of H. mohnikei [37], the climatological currents in the region for the winter season which support a passive dispersal of marine fish species from east to west were considered for explaining the occurrence of H. mohnikei in Goa waters. Monthly mean climatology was prepared based on daily data on U (zonal) and V (meridional) components of geostrophic current velocities derived from Aviso merged product for the years, 2007–2017. Altimeter products by Ssalto/Duacs and distributed by Aviso+, with support from Cnes (https://www.aviso.altimetry.fr) were used. The climatological currents generated for the winter season (November to February) from 2007 to 2017 for the Indo-Pacific region are depicted in Fig 4.

Fig 4 — Climatological surface currents during winter season (November–February) for the Indo-Pacific region. Red dots indicate the geographic locations of distribution of *Hippocampus mohnikei*. (WICC = West Indian Coastal Current, EICC = East India Coastal Current, NEC = North Equatorial Current and SCSWC = South China Sea Warm Current).

Results

Specimens examined

Colour of the head and body of freshly collected seahorse specimens (females, MK1 and MK2; males, MK3 and MK4; NIO1015/19) was dark brown to dark black. The entire body was covered with low spines and the coronet was observed to be short with five tiny projections. Two prominent cheek spines and double rounded spines below the eye (each on the either side of the head) were discernible in all four specimens. (Figs 2 and 3).

Morphological taxonomy

Measured height (Ht) and standard length (SL) of specimens varied between 39.2 and 54.2 mm (48.2 ± 6.5 mm) and 47.3 and 60.1 mm (54.95 ± 5.48 mm), respectively. TaL was observed to be relatively long compared to the TrL of the body. The ratio of the head length (HL) to snout length (SnL) of all four specimens varied between 3.2 and 3.5 (Table 1). Number of trunk rings (TrR) in all specimens were 11 whereas, the number of tail rings (TaR) varied narrowly between 37 and 39. The number of TrR supporting dorsal fin was two and the number of TaR supporting dorsal fin was counted to be one in all specimens. Number of dorsal fin pectoral fin and anal fin rays recorded were 15–16, 12–14 and 4, respectively. Slight enlargements, respectively at 1^st, 4^th, 7^th and 10/11^thTrR and 4^th, 7/8^th, 9/10^th, 13/14^thTaR were prominently discernible (Table 1).

Table 1. Detailed morphology of H. mohnikei.

Morphological characteristics of four specimens of Hippocampus mohnikei collected from the Mandovi estuary, Goa, central west coast of India (MK1 and MK2 = Female; MK3 and MK4 = Male).

	MK1	MK2	MK3	MK4
Morphometric characters (mm)
Height (Ht)	39.2	54.2	48.1	51.3
Standard length (SL)	47.3	60.1	55.2	57.2
Trunk length (TrL)	16.1	19.4	15.2	15.1
Tail length (TaL)	24.2	32.1	31.2	33.1
Head length (HL)	8.5	9.1	9.2	8.7
Snout length (SnL)	2.5	3.1	3.3	2.5
HL/SnL ratio	3.4	3.2	3.3	3.5
Snout depth (SnD)	1.5	2.1	2.1	2.1
Head depth (HD)	5.5	7.1	6.9	7.2
Eye orbit	1.5	2.1	2.2	2.1
Trunk depth between 4^th and 5^th trunk ring (TD4)	3.1	4.2	3.9	4.1
Trunk depth between 9^th and 10^th trunk ring (TD9)	4.7	6.1	5.8	5.9
Pectoral fin base length	2.1	2.1	2.1	2.2
Dorsal fin base length	3.5	4.1	4.1	3.9
Anal fin base length	0.5	0.5	0.5	0.5
Pouch length	-	-	6.2	6.6
Pouch depth	-	-	3.1	2.5
Pouch width	-	-	3.2	3.3
Meristic features (numbers)
Trunk Rings (TrR)	11	11	11	11
Tail Rings (TaR)	37	38	37	39
TrR supporting dorsal fin	2	2	2	2
TaR supporting dorsal fin	1	1	1	1
Cheek spines	2	2	2	2
Eye spines	2	2	2	2
Enlargement of trunk Rings	1, 4, 7, 11	1, 7, 10	1, 4, 7, 11	1, 4, 7, 10
Enlargement of tail Rings	4, 7, 10, 13	4, 8, 10, 13	4, 7, 9, 13	4, 7, 10, 14
Dorsal fin rays	15	16	16	16
Pectoral fin rays	12	14	14	14
Anal fin rays	4	4	4	4

Open in a new tab

Comparative morphology

We compared the morphological features of H. mohnikei with other two commonly occurring seahorse species, H. kuda and H. trimaculatus occurring in coastal waters of India (Table 2). Fresh specimens of H. kuda was orange to dark brown with reddish spots over the body with single eye and cheek spine, rounded and backward curled coronet and deeper head and rounded or less developed body spines [15,16]. H. trimaculatus has three prominent black spots on the dorso-lateral surface of the first, fourth and seventh trunk rings [15,16] which are clearly absent in H. mohnikei. Single eye and hooked like cheek spine also observed in H. trimaculatus. Snout length (SnL) of H. mohnikei was shorter compared to the H. kuda and H. trimaculatus. These morphological characters clearly distinguish H. mohnikei from H. kuda and H. trimaculatus (Table 2).

Table 2. Morphological comparison of seahorses.

Comparison of morphological characteristics of H. mohnikei with other two seahorse species, (H. trimaculatus and H. kuda). Sample size for each species shown in parentheses. Mean±SD denoted with different superscripts significantly differ from each other (P < 0.05).

Morphometrics (mm)	H. mohnikei (n = 4)	H. kuda (n = 10)	H. trimaculatus (n = 10)
Height (Ht)	48.2 ± 6.50^a	157.73 ± 19.24^b	93.06 ± 14.71^c
Standard Length (SL)	54.95 ± 5.48^a	182.65 ± 11.64^b	109.87 ± 6.45^c
Trunk Length (TrL)	16.45 ± 2.02^a	47.83 ± 2.54^b	26.40 ± 2.12^c
Tail Length (TaL)	30.15 ± 4.04^a	104.43 ± 9.07^b	61.70 ± 3.40^c
Head Length (HL)	8.83 ± 0.41^a	30.39 ± 1.88^b	21.70 ± 1.77^c
Snout Length (SnL)	2.67 ± 0.21^a	12.06 ± 1.04^b	8.90 ± 0.99^c
HL/SnL ratio	3.33 ± 0.14^a	2.54 ± 0.16^b	2.45 ± 0.19^bc
Snout Depth	1.95 ± 0.30^a	4.25 ± 0.41^b	3.45 ± 0.16^c
Head Depth	6.68 ± 0.79^a	14.80 ± 1.84^b	9.50 ± 0.53^c
TD4	3.83 ± 0.50^a	12.16 ± 1.19^b	6.75± 0.86^c
TD9	5.63 ± 0.63^a	18.68 ± 1.51^b	9.55 ± 0.90^c
Pectoral fin base length	2.03 ± 0.1^a	7.07 ± 1.2^b	4.75 ± 0.6^c
Dorsal fin base length	3.88 ± 0.3^a	15.73 ± 1.8^b	9.80 ± 0.8^c
Meristic counts
Trunk Rings (TrR)	11 ± 0.00	11 ± 0.00	11 ± 0.00
Tail Rings (TaR)	38 ± 1.00^a	36 ± 1.00^b	41 ± 1.00^c
TrR supporting Dorsal Fin	2 ± 0.00	2 ± 0.00	2 ± 0.00
TaR supporting Dorsal Fin	1 ± 0.00	1 ± 0.00	1 ± 0.00
Cheek Spines	2 ± 0.00^a	1 ± 0.00^b	1 ± 0.00^c
Eye spines	2 ± 0.00^a	1 ± 0.00^b	1 ± 0.00^c
Dorsal fin rays	16 ± 1.00^a	18 ± 1.00^b	20 ± 1.00^c
Pectoral fin rays	14 ± 1.00^a	16 ± 1.00^b	17 ± 1.00^c

Open in a new tab

PCA used to elucidate the factors contributing to morphological differences in H. mohnikei, H. kuda and H. trimaculatus showed that many morphometric and meristic characters play an important role in differentiating these species. Results of PCA analysis revealed that 11 morphometric and meristic characters integrated into two principal components (PC1 and PC2) which cumulatively contributed to 97% of total variance (S2 Table). The PC1 which explained 81% of total variation consisted of morphometric characters such as SL, TaL, TD4, HL, TD9, TrL, HD, SnL and SnD while, the PC2 which explained 16% of total variation consisted of the TaR and DF. The derived ordination diagram after plugging standardized morphological data of all individuals of three seahorse species into PCA is depicted in Fig 5. PCA ordination diagram showed that three seahorse species were clustered out distinctly in orientation space. Therefore, based on comparison of morphological traits [15,16,25] and the results of PCA, the identity of seahorse specimens collected from Goa was confirmed as H. mohnikei.

Fig 5 — Scores of factor loadings plot of principal component analysis of three species, H. *mohnikei*, H. *kuda* and H. *trimaculatus* based on morphological data.

Morphological measurements revealed that all the four Goa specimens are consistent and congruent with the salient morphological descriptions for type specimens of H. mohnikei reported by Lourie et al. [15,17,25] for specimens collected from Vietnam and Japan. Furthermore, meristic, morphometric, and key diagnostic morphological character comparisons from vouchered specimens of H. mohnikei [11,15,25,52,53], reconfirmed the identity of seahorse specimens collected from Goa as H. mohnikei (Table 3).

Table 3. Comparison of morphological characters.

Comparison of diagnostic morphological characters (range and mean) of vouchered specimens of Hippocampus mohnikei. Values in parentheses are mean.

Data source	Present Study	Lourie et al. [15,25]	Thangaraj and Lipton [11]	Zhang et al. [52]	Wibowo et al. [53]
Voucher/field Number	NIO1015/19	RMNH7259	CMFRI No. 146	SCSMBC007418–19	KAUM-1. 17724
Locality	Goa, west coast of India	Vietnam	Southeast coast of India	Yellow Sea, China	Kagoshima, Southern Japan
No. of samples (N)	04	04	01	16	01
Morphometrics (mm)
Standard Length (SL)	47.3–60.1 (54.95)	54.0–57.0	70.0	52.5–83.0 (66.4)	-
Trunk Length (TrL)	15.1–19.4 (16.45)		22.0	15.0–23.0 (19.2)	-
Tail Length (TaL)	24.2–33.1 (30.15)		38.0	28.5–46.0 (36.7)	-
Head Length (HL)	8.5–9.2 (8.83)		10.0	9.0–14.0 (10.5)	-
Snout Length (SnL)	2.5–3.3 (2.67)		3.0	1.8–3.9 (2.4)
HL/SnL ratio	3.2–3.5 (3.35)	2.8–3.9 (3.0)	3.33	3.59–5.75 (4.5)	3.1
Snout Depth	1.5–2.1 (1.95)	-	2.5	-	-
Head Depth	5.5–7.2 (6.68)	-	7.0	-	-
TD4	3.1–4.2 (3.83)	-	5.5	-	-
TD9	4.7–6.1 (5.63)	-	8.0	-	-
Meristic counts
Trunk Rings (TrR)	11	11	11	11	11
Tail Rings (TaR)	3737–39 (38)	37–40 (38)	38	37–40 (38)	38
TrR supporting dorsal fin	2	2	-	-	-
TaR supporting dorsal fin	1	1	-	-	-
Cheek Spines	2	2	2		2
Rounded spines below eye	Double	Double	Single	-	-
Dorsal fin rays (DF)	15–16	15–16	14	16	15
Pectoral fin rays	12–14	12–14 (13)	12	12–14 (13)	12
Anal fin rays (AF)	4	-	-	4	-

Open in a new tab

Phylogenetic analysis and genetic distance

PCR for the mitochondrial COI and Cyt b genes of Goa seahorse specimens resulted in 609 bp and 639 bp amplicons, respectively. Maximum likelihood (ML) phylogenetic analysis were performed using K2P distances with sequences of COI and Cyt b genes of seahorse specimens from Goa (MK1, MK2, MK3 and MK4) with all downloaded sequences of vouchered H. mohnikei from GenBank (S2 Table). ML trees of Goa seahorse specimens (GenBank accession numbers, MK330041.1, MN595216.1, MN595217.1 and MN595218.1 for COI gene; GenBank accession numbers, MK112274.2, MN595213.1, MN595214.1 and MN595215.1 for Cyt b gene) showed that all four individuals clustered together suggesting a monophyletic lineage (Figs 6 and 7). Furthermore, sequences of COI and Cyt b genes of Goa specimens, respectively showed maximum phylogenetic similarities with H. mohnikei (GenBank accession numbers GQ502157.1) (GenBank accession numbers: EU179923.1 and EU179924.1) strongly supported by high bootstrap values of >95% (Figs 6 and 7).

Fig 6 — ML phylogenetic tree of Goa specimens and all vouchered *Hippocampus mohnikei* based on mitochondrial cytochrome oxidase subunit I gene (COI) sequences using K2P distances with 1000 bootstrap iterations. Numbers at nodes indicate bootstrap support values and nodes with >50% bootstrap support values are shown. The alligator pipefish, *Syngnathoides biaculeatus* (KY066152.1) served as an out-group species. Scale bar = genetic distance of 0.05. ML = Maximum likelihood.

Fig 7 — ML phylogenetic tree of Goa specimens and all vouchered *Hippocampus mohnikei* based on mitochondrial cytochrome b gene (Cyt b) sequences using K2P distances with 1000 bootstrap iterations. Numbers at nodes indicate bootstrap support values and nodes with >50% bootstrap support values are shown. The alligator pipefish, *Syngnathoides biaculeatus* (EF189167.1) served as an out-group species. Scale bar = genetic distance of 0.05. ML = Maximum likelihood.

Genetic distance describes the kinship distance within and between species. Calculated pair-wise genetic distance (K2P) values based on COI and Cyt b sequences of H. mohnikei from Goa and other localities (Japan, Korea, China, Vietnam and Thailand) revealed that H. mohnikei from Goa the show least genetic distances of 0.7% for both COI and Cyt b genes with populations of H. mohnikei from Vietnam (COI) and Thailand (Cyt b), respectively (Tables 4 and 5). In contrast, Goa specimens showed highest genetic distances of 1% for COI and 7% for Cyt b genes with populations of H. mohnikei from China and Japan, respectively.

Table 4. Pair-wise genetic distance based on COI gene sequences.

Pair-wise genetic distances (Kimura 2-parameter model) between Hippocampus mohnikei populations of Goa and the Indo-Pacific region based on COI gene sequences. Values in parentheses indicate percentage.

Localities of H. mohnikei with GenBank accession numbers	Goa	Japan	Vietnam	China
Goa Specimens (MN595216‒MN595218; MK330041.1)	0.00
Japan (GQ502158.1‒GQ502159)	0.008 (0.8)	0.00
Vietnam (GQ502157.1)	0.007 (0.7)	0.009 (0.9)	0.00
China (KP140138‒KP140181)	0.010 (1.0)	0.003 (0.3)	0.010 (1.0)	0.00

Open in a new tab

Table 5. Pair-wise genetic distance based on Cyt b gene sequences.

Pair-wise genetic distances (Kimura 2-parameter model) between Hippocampus mohnikei populations of Goa and the Indo-Pacific region based on Cyt b gene sequences. Genetic divergence of > 2% within same locality separated out. Values in parentheses indicate percentage.

Localities of H. mohnikei with GenBank Accession numbers	Goa	Japan1	Japan2	Korea1	Korea2	China	Thailand
Goa Specimens (MN595213.1, MN595214.1, MN595215.1 and MK112274.2)	0.00
Japan1 (AF192688.1‒AF192689.1; KT731898.1‒KT731909.1)	0.067 (6.7)	0.00
Japan2 (KX017612.1‒KX017625.1)	0.070 (7.0)	0.071 (7.1)	0.00
Korea1 (KT731897.1‒KT731920.1; KT731924.1‒KT731926.1; KT731929.1; KT731932.1‒KT731935.1; KT731940.1‒KT731941.1; KT731944.1–KT731952.1 and KT731955.1)	0.066 (6.6)	0.040 (4.0)	0.044 (4.4)	0.00
Korea2 (KT731921.1–KT731923.1; KT731928.1; KT731930.1–KT731931.1; KT731936.1–KT731937.1, KT731943.1 and KT731955.1)	0.067 (6.7)	0.004 (0.4)	0.012 (1.2)	0.066 (6.6)	0.00
China (KT946929.1‒KT946937.1; KC527556.1 and KC527584.1)	0.066 (6.6)	0.037 (3.7)	0.042 (4.2)	0.057 (5.7)	0.004 (0.4)	0.00
Thailand (EU179923.1‒EU179924.1)	0.007 (0.7)	0.001 (0.1)	0.001 (0.1)	0.001 (0.1)	0.001 (0.1)	0.001 (0.1)	0.00

Open in a new tab

Ocean circulation

As seen from Fig 4 that the circulation in the Indo-Pacific region shows a large-scale flow moving from the East China Sea to the South China Sea. From the South China Sea, the major part of the flow turns southeastward entering into the Java Sea and a small part turns northwestward to eastern Bay of Bengal (BoB) and the Andaman Sea through Malacca Strait. From eastern BoB, the surface waters flow westward as a part of the north equatorial current (NEC). On encountering the coast of Sri Lanka, a part of the NEC move northward into the northern BoB, while the rest moves westward and into the southern Arabian Sea, south of Sri Lanka. The NEC feeds into the wintertime west India coastal current (WICC) and moves waters from NEC towards north into the Arabian Sea along its eastern boundary.

Discussion

The geographic range of Hippocampus mohnikei is still unresolved as Lourie et al [15,16] confirmed the nativity of this species to Japan and Vietnam and likely extending throughout the South China Sea and the Gulf of Thailand [16,17,25]. New records on the occurrence of H. mohnikei from many other locations beyond on its native range in north- and south-eastern coastal waters of Asia [11,37,41,44,56,62] suggest its significant extended distribution in the Indo-Pacific region (Fig 8). Records of H. mohnikei in the Palk Bay, southeast coast of India [11] is to date the known range limit towards the west. In southeastern Asian coastal waters, H. mohnikei has been reported from Singapore [41] as well as from Cambodia, Malaysia, Thailand and Vietnam [37]. In northeast Asia, H. mohnikei is reported from China [44,56] and South Korea [62,63].

Fig 8 — Map showing native range, recent sightings and all reported sightings for *Hippocampus mohnikei* in the Indo-Pacific region. Sightings are classified as new (this study, ⋆), recently published (2004–2016, (▲) and original records [15] (*). Map was modified from Aylesworth et al. [37] and re-created in the World Geodetic System (WGS) 84 datum.

The present report on the occurrence of H. mohnikei in a bay-estuarine system of Goa, CWCI as confirmed by both morphological and molecular analysis represents a significant westward expansion compared to the previously known geographic range of this species [37]. Since the reporting of H. mohnikei solely based on morphological characters from the Palk Bay, southeast coast of India [11], no further sightings of this species have been reported from coastal marine waters of India. Therefore, a comparison of genetically distinct populations of H. mohnikei inhabiting native (Japan and Vietnam) and extended ranges in the Indo-Pacific region (Fig 8) with Goa specimens gains significance. Lourie et al. reported that a Vietnamese specimen of H. mohnikei was genetically distinct from H. mohnikei from Japan [16,25].

A maximum likelihood (ML) tree constructed of Goa specimens with all vouchered specimens of H. mohnikei based on COI gene using K2P distances showed maximum phylogenetic proximity with a specimen from Vietnam (GenBank accession number, GQ502157.1) (Fig 6). On the other hand, ML tree constructed with sequences of Cyt b gene of Goa specimens showed maximum genetic similarities with H. mohnikei from Thailand (GenBank accession numbers, EU179923.1 and EU179924.1) (Fig 7). In both ML trees of COI and Cyt b genes, phylogenetic proximity of all four Goa individuals with >95% bootstrap support thus confirming the taxonomic identity of Goa specimens as H. mohnikei. Furthermore, a comparison of pair-wise genetic distance values (K2P) based on sequence COI (Table 4) and Cyt b (Table 5) genes showed that Goa specimens showed least genetic distance with populations of H. mohnikei from Vietnam (K2P value, 0.7%) and Thailand (K2P value, 0.7%), respectively. In contrast, Goa specimens showed highest genetic distances of 1% for COI and 7% for Cyt b genes with populations of H. mohnikei from China and Japan, respectively. Similar high pair-wise K2P values of sequences of Cyt b between H. mohnikei populations from the Gulf of Thailand and those from China (13.54–14.46%) and Japan (14.42–14.79%) have been recently reported [64].

A comparative assessment of K2P values of the present study with those from Vietnam [65] and Gulf of Thailand [64], respectively for COI and Cyt b suggest that H. mohnikei populations from Goa, Vietnam and the Gulf of Thailand might share a similar genetic identity and genetically distinct from those from China and Japan. Also, a possible genetic differentiation in populations of H. mohnikei inhabiting coastal marine waters of northeastern Asia (Japan, Korea and China) and southeastern Asia (Vietnam, Thailand, Cambodia, Malaysia, Singapore and India) may not be ruled out. Furthermore, least genetic divergence recorded between different populations of H. mohnikei (Goa vs Vietnam, COI gene) and (Goa vs. Thailand, Cyt b gene), the possibility of crypticity within H. mohnikei populations from these localities is ruled out by applying 2% threshold genetic divergence for assessing intra-specific differences [16]. In contrast, recent study by Panithanarak et al observed high genetic variance between the populations of H. mohnikei from the Gulf of Thailand and China (13.54–14.46%) and Japan (14.42–14.79%) suggested the possibility of cryptic species within the known range of H. mohnikei [64]. Further studies, however, are necessary to assess the genetic variation within H. mohnikei populations in the entire Indo-Pacific region.

Recent studies have advanced our understanding of habitat associations of H. mohnikei compared to what has been described in the IUCN Red List Assessment [45]. Previously, H. mohnikei was reported only in association with seagrass beds in Japan and in an estuary in Vietnam [16,25]. Association of H. mohnikei populations with seagrass beds (Zostera spp.) in Korea [62,63], Japan [66] and China [44] has been reported. Whereas the specimen reported from Palk Bay, southeastern India [11] was associated with two other additional genera of seagrass species (Halophila and Thalassia). Recently, published data on the habitat preferences of H. mohnikei from Southeast Asia [37] indicate its association with seagrass beds of Cymodocea spp., Enhalus spp., Halodule spp., Halophila spp., Syringodium spp. and Thalassia spp. Furthermore, these authors also report the association of H. mohnikei with mangroves, oyster beds, mussel farms and sandy beaches, whereas, Lim reported its occurrence in association with seaweeds in Singapore [41]. From these studies, it is evident that H. mohnikei occupies a wide variety of habitats.

All previous reports on the habitat descriptions of H. mohnikei were located in the coastal waters and bay-estuarine systems in the depth range of 0–10 m [11,17,25,37,44,62]. Interestingly, the occurrence of small juveniles of H. mohnikei in association with highly dense live prey organisms in the offshore waters of Japan has also been reported [39]. The present report of H. mohnikei is based on specimens caught as an incidental catch in bag nets fixed to the stakes operated in the Mandovi estuary, Goa. Although precise information on the habitat of H. mohnikei, could not be ascertained, it is worth describing the surrounding environs at the site of collection. Predominantly, the estuarine stretches of the River Mandovi have dense mangrove coverage and extensive oyster beds [67] and patches of seagrass, Halophila ovalis and H. beccarii [68]. The channel network of Mandovi estuary is characterized by islands (Chorao, Divar and Vanxim) and many sheltered areas interspersed with dense mangrove ecosystem. The present occurrence of H. mohnikei in a bay-estuarine system of Goa is not quite surprising as these are the typical habitats where this species has been previously reported. For ascertaining habitat shift by geographically disconnected populations of H. mohnikei, further intense studies on habitat specificities of different life stages therefore, are warranted.

Food availability has been considered as one of the factors influencing the abundance and distribution of seahorses [20]. Zooplankton such as Oithona davisae, Calanoida and Penilia avirostris have been identified as the main prey organisms for juvenile and young H. mohnikei in Tokyo Bay [39], whereas the adults have been reported to prey upon mainly larger organisms such as gammarid and caprellid amphipods [63]. Nutrient-rich waters of the Mandovi estuarine system sustain high primary productivity and abundance of zooplanktonic prey organisms such as copepods [69–71] which are essential for the survival and establishment of seahorse populations. Considering the prevailing environmental conditions, mangrove shelter and abundance of prey organisms, the likelihood of establishment and colonization of seahorse populations in these sheltered areas appears high.

Factors such as habitat, diet, and even anthropogenic activities are the main reasons cited for the migration of seahorses [72]. Furthermore, instances of seahorses for long distance dispersal by means of rafting along with seaweeds or any other suitable holdfast under the influence of ocean currents during juvenile stages have been documented [2,22]. A southward dispersal of H. histrix ~1800 km under the influence of East Australian Current in the Great Barrier Reef has been reported [33]. Furthermore, ~1100 km dispersal from the south to the northeast coast of India by H. fuscus under the influence of East India Coastal Current has been also reported [35]. A Direct evidence for passive long-distance dispersal of H. trimaculatus at Malacca Strait has been documented recently [36].

Newborn juveniles of many seahorse species undergo a pelagic phase (planktonic) ranging between two and six weeks depending on the species before they settle down into sessile habitats (benthos) [2,73]. Consequently, planktonic phase juveniles are likely to facilitate in widespread gene flow across geographically disconnected populations and resulting in genetic homogeneity [74]. The occurrence of small juveniles of H. mohnikei (15.1–45.5 mm) in association with highly dense live prey organisms in offshore waters of Japan [39] suggests that food availability is essential for sustaining survivorship of planktonic phase juveniles. Furthermore, a seasonal (warm and cold season) inshore-offshore migration by H. mohnikei populations inhabiting Chinese coast has been confirmed [56]. Higher passive dispersal capabilities of seahorse juveniles with floating debris, prey swirls and with seaweed rafts than adults has been reported [2,30,36]. It has been postulated that marine species with greater longevity, free swimming and feeding (planktotrophic) larval phases have relatively high dispersal abilities and thus permit genetic exchange between populations [75]. It has been hypothesized that owing to lack of suitable settlement habitat (holdfasts) and or scarcity of larger food items may render larger non-settled juveniles of H. mohnikei to prolong their planktonic phase [39]. Therefore, an extension planktonic phase as observed in case of H. mohnikei juveniles in offshore waters of Tokyo Bay [39] may entail higher degree of passive dispersal under the influence of oceanic circulation, especially when they are attached to floating debris and algae.

The confirmed occurrence of four sub-adult specimens (Mandovi estuary) and suspected occurrence of an adult specimen of H. mohnikei in the proximately adjacent bay-estuarine ecosystem (Chapora estuary) of Goa, CWCI could be a consequence of either long-distance dispersal from Southeast Asian countries or stepping-stone mediated dispersal as revealed by oceanic currents circulation in the Indo-Pacific region. It is clearly seen from Fig 4 that water mass from southeastern Asian coasts and east coast of India enters into the Arabian Sea as a result of winter circulation [61]. In the absence of geographical barriers between H. mohnikei populations of Goa and Southeast Asian countries, ocean currents flowing from regions where sightings of H. mohnikei may contribute to wide-spread dispersal. Therefore, it is plausible that oceanic currents may be aiding long-distance or stepping stone dispersal of H. mohnikei populations from different geographical locations such as Cambodia, Malaysia, Vietnam and Thailand [15,16,37,64], Singapore [41] and the Palk Bay, southeast coast of India [11] to the west coast of India.

Conversation with local fishermen who operate stake nets at the collection site revealed that sightings of seahorses are relatively more common during summer monsoon season than in non-monsoonal months. During the summer monsoon period, a number of rivulets and rivers connected to the Mandovi estuarine network discharge large amounts of freshwater [76]. Consequently, it is possible that the rainwater discharge from sheltered areas—the preferred seahorse habitats, may force seahorses flow downstream along with currents due to their poor swimming abilities.

It is well known that the west coast of India comes under the influence of substantial coastal cold-water upwelling event during the summer monsoon season [47,76]. It has been reported that the survival and dispersal of tropical marine species are known to be impacted by a drastic decrease in water temperature associated with upwelling [77–79]. Consequently, seahorse populations in western coastal India might undergo seasonal fluctuations [22]. A significant decrease in abundance and diversity of demersal fishes during the summer monsoon in a bay-estuarine system of the Mandovi river has been documented [50]. As a consequence of the reduction in salinity and drop in temperature associated with monsoonal precipitation and upwelling, respectively the seahorse populations might face limitations in growth and recruitment along the west coast of India. Interestingly, unlike most subtropical seahorse species, the greater tolerance by native populations of H. mohnikei to cold water in the Western Pacific has been reported [31]. However, further temperature stress simulation studies are required to ascertain whether geographically disconnected populations of H. mohnikei also possess a similar trait or not.

Conclusions

Based on the new information presented in this paper, there is clear evidence that H. mohniei has expanded its natural and reported geographic range. Recognizing the potential of seahorses as a popular flagship species in estuarine conservation and sustainable management [1,80,81], significant westward range expansion of H. mohnikei is of considerable biogeographic and conservation importance. Intriguingly, the possibility of H. mohnikei originating in India and subsequent dispersal to the east cannot be ruled out. Although there is no published evidence to show that H. mohnikei originated in Japan/China, the original type specimens studied were however, from Japan and Vietnam. At the same time, it may be plausible that H. mohnikei might be present in other localities, but has not been reported. Further intense sampling and rigorous molecular analysis of H. mohnikei populations along the Indian coast and throughout its range would be therefore required to confirm whether these are vagrants or a previously unreported, established population.

Supporting information

S1 Fig. Picture of H. mohnikei posted on social media.

Male specimen of Hippocampus mohnikei caught by gill net in the Chapora estuary, Goa, India.

(TIF)

Click here for additional data file.^{(1.2MB, tif)}

S1 Table. The COI and Cyt b gene sequences.

GenBank accession numbers and sources of the mitochondrial gene sequences (COI and Cyt b) of seahorse species used for construction of phylogenetic trees.

(DOC)

Click here for additional data file.^{(238.5KB, doc)}

S2 Table. The COI and Cyt b gene sequences.

GenBank accession numbers and sources of the mitochondrial gene sequences (COI and Cyt b) of seahorse species used for construction of phylogenetic trees.

(DOCX)

Click here for additional data file.^{(11.6KB, docx)}

Acknowledgments

The authors are grateful to Prof. Sunil Kumar Singh, Director, CSIR-National Institute of Oceanography, Goa (India) for encouragement and facilities. Thanks are due to local fisherman Mr. Harish Halarnkar for providing seahorse specimens. Thanks are also due to Dr. Mani Murali and Mr. Devanand Kavlekar for their help in preparing the maps. We would like to deeply thank Dr. Qiang Lin for sharing the morphometric data of Hippocampus mohnikei for comparison. The authors are thankful to Riley Pollom and Dr. Graham Short and two anonymous reviewers for their critical and constructive comments for improving the quality and presentation of the manuscript. This represents contribution No. 6515 of the CSIR-National Institute of Oceanography, Goa (India).

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

1.Sreepada RA, Desai UM, Naik S. The plight of Indian seahorses: Need for conservation and management. Curr Sci 2002; 82: 377–378. [Google Scholar]
2.Foster SJ, Vincent ACJ. Life history and ecology of seahorses: implications for conservation and management. J Fish Biol 2004; 65: 1–61. [Google Scholar]
3.Kuiter RH. Seahorses and Their Relatives. Aquatic Photographics, Seaford, Australia; 2009.
4.Froese R, Pauly D. FishBase.www.fishbase.org. Downloaded on 10/2018.
5.Harasti D, Martin-Smith K, Gladstone W. Ontogenetic and sex-based differences in habitat preferences and site fidelity of White’s seahorse Hippocampus whitei. J Fish Biol 2014; 85: 1413–1428. 10.1111/jfb.12492 [DOI] [PubMed] [Google Scholar]
6.Hellyer C, Harasti D, Poore A. Manipulating artificial habitats to benefit seahorses in Sydney Harbour, Australia. Aquat Conserv Mar Fresh Ecosyst 2011; 21: 582–589. [Google Scholar]
7.Short G, Harasti D, Hamilton H. Hippocampus whitei Bleeker, 1855, a senior synonym of the southern Queensland seahorse H. procerus Kuiter, 2001: molecular and morphological evidence (Teleostei, Syngnathidae). ZooKeys 2019; 824: 109–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.IUCN Seahorse, Pipefish and Stickleback Specialist Group (2019). https://www.iucn-seahorse.org (downloaded on 01/11/2019).
9.Salin KR, Mohankumaran NC. Resources and biodiversity of seahorses and the need for their conservation in India. Aquacult Asia 2006; 10: 3–8. [Google Scholar]
10.Murugan A, Dhanya S, Rajagopal S, Balasubramanian T. Seahorses and pipefishes of the Tamil Nadu coast. Curr Sci 2008; 95: 253–260. [Google Scholar]
11.Thangaraj M, Lipton AP. Occurrence of the Japanese seahorse Hippocampus mohnikei Bleeker 1854 from the Palk Bay coast of southeastern India. J Fish Biol 2007; 70: 310–312. [Google Scholar]
12.Krishnan TS, Kuiter RH, Patterson J. Occurrence of western Indian Ocean seahorse, Hippocampus borboniensis Dumeril, 1870, in the Gulf of Mannar, Southeastern India. Ind J Geo-Mar Sci 2011; 40: 642–644. [Google Scholar]
13.Yogeshkumar JS, Geetha S. A new species of Hippocampus montebelloensis (Family: Syngnathidae) from the southeast coast of India. Int J Plant Anim Env Sci 2012; 2: 56–58. [Google Scholar]
14.Subburaman S, Murugan A, Goutham S, Kaul R, Prem Jyothi PVR, Balasubramanian T. First distributional record of giraffe seahorse, Hippocampus camelopardalis Bianconi 1854 (Family Syngnathidae) from Gulf of Kachchh waters, north west coast of India. Indian J Geo-Mar Sci 2014; 43: 408–411. [Google Scholar]
15.Lourie SA, Foster SJ, Cooper EWT, Vincent ACJ. A Guide to the Identification of Seahorses. Project Seahorse and TRAFFIC North America; 2004.
16.Lourie SA, Pollam RA, Foster SJ. A global revision of the seahorses Hippocampus Rafinesque 1810 (Actinopterygii: Syngnathiformes): taxonomy and biogeography with recommendations for further research. Zootaxa 2016; 4146: 1–66. 10.11646/zootaxa.4146.1.1 [DOI] [PubMed] [Google Scholar]
17.Lourie SA, Vincent ACJ, Hall HJ. Seahorses: an identification guide to the world’s species and their conservation. Project seahorse, London, UK; 1999. [Google Scholar]
18.Silveira RB, Siccha-Ramirez R, Silva JRS, Oliveira C. Morphological and molecular evidence for the occurrence of three Hippocampus species (Teleostei: Syngnathidae) in Brazil. Zootaxa 2014; 3861: 317–332. 10.11646/zootaxa.3861.4.2 [DOI] [PubMed] [Google Scholar]
19.Casey SP, Hall HJ, Stanley HF, Vincent ACJ. The origin and evolution of seahorses (genus Hippocampus): a phylogenetic study using the cytochrome b gene of mitochondrial DNA. Mol Phylogenet Evol 2004; 30: 261–272. 10.1016/j.ympev.2003.08.018 [DOI] [PubMed] [Google Scholar]
20.Wang X, Han X, Zhang Y, Liu S, Lin Q. Phylogenetic analysis and genetic structure of the seahorse, Hippocampus fuscus from the Arabian and Red Sea based on mitochondrial DNA sequences. Mitochondrial DNA A 2019; 30: 165–171. [DOI] [PubMed] [Google Scholar]
21.Lourie SA, Green DM, Vincent ACJ. Dispersal, habitat differences and comparative phylogeography of South East Asian seahorses (Syngnathidae: Hippocampus). Mol Ecol 2005; 14: 1073–1094. 10.1111/j.1365-294X.2005.02464.x [DOI] [PubMed] [Google Scholar]
22.Teske PR, Hamilton H, Palsboll PJ, Choo CK, Gabr H, Lourie SA. et al. Molecular evidence for long-distance colonization in an Indo-Pacific seahorse lineage. Mar Ecol Prog Ser 2005; 286: 249–260. [Google Scholar]
23.Boehm JT, Waldman J, Robinson JD, Hickerson MJ. Population genomics reveals seahorses (Hippocampus erectus) of the western mid-Atlantic coast to be residents rather than vagrants. PloS One 2015; 10: e0116219 10.1371/journal.pone.0116219. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Saarman NP, Louie KD, Hamilton H. Genetic differentiation across eastern Pacific oceanographic barriers in the threatened seahorse Hippocampus ingens. Conserv Genet 2010; 11: 1989–2000. [Google Scholar]
25.Lourie SA, Pritchard JC, Casey SP, Ky TS, Hall HJ. et al. The taxonomy of Vietnam’s exploited seahorses (family Syngnathidae). Biol J Linn Soc 1999; 66: 231–256. [Google Scholar]
26.Woodall LC, Otero-Ferrer F, Correia M, Curtis JMR, Garrick Maidment N. et al. A synthesis of European seahorse taxonomy, population structure, and habitat use as a basis for assessment, monitoring and conservation. Mar Biol 2018; 165: 1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Curtis JMR, Vincent ACJ. Life history of an unusual marine fish: survival, growth and movement patterns of Hippocampus guttulatus Cuvier 1829. J Fish Biol 2006; 68: 707–733. [Google Scholar]
28.Caldwell I, Vincent ACJ. A sedentary fish on the move: effects of displacement on long-snouted seahorse (Hippocampus guttulatus Cuvier) movement and habitat use. Environ Biol Fish 2013; 96: 67–75. [Google Scholar]
29.Correia M, Caldwell IR, Koldewey HJ, Andrade JP, Palma J. Seahorse (Hippocampinae) population fluctuations in the Ria Formosa Lagoon, south Portugal. J Fish Biol 2015; 87: 679–690. 10.1111/jfb.12748 [DOI] [PubMed] [Google Scholar]
30.Luzzatto DC, Estalles ML, Diaz De Astarloa JM. Rafting seahorses: the presence of juvenile Hippocampus patagonicus in floating debris. J Fish Biol 2013; 83: 677–681. 10.1111/jfb.12196 [DOI] [PubMed] [Google Scholar]
31.Han SY, Kim JK, Tashiro F, Kai Y, Yoo JT. Relative importance of ocean currents and fronts in population structures of marine fish: a lesson from the cryptic lineages of the Hippocampus mohnikei complex. Mar Biodiv 2019; 49: 263–275. [Google Scholar]
32.Luzzatto DC, Pujol MG, Figueroa D, Diaz De Astarloa JM. The presence of the seahorse Hippocampus patagonicus in the deep waters: additional evidence of the dispersive capacity of the species. Mar Biodivers Rec 2014; 7: e71. [Google Scholar]
33.Harasti D. Range extension and first occurrence of the thorny seahorse Hippocampus histrix in New South Wales, Australia. Mar. Biodivers Rec 2015; 8: 10.1017/S1755267215000263. [DOI] [Google Scholar]
34.Harasti D. Southward range extension of the great seahorse (Hippocampus kelloggi Jordan and Snyder, 1901) in Australia. J Appl Ichthyol 2017; 1–3 10.1111/jai.13414. [DOI] [Google Scholar]
35.Mahapatro D, Mishra RK, Panda S. Range extension of a vulnerable Sea horse Hippocampus fuscus (Actinopterygii: Syngnathidae) on the north-eastern Bay of Bengal coast. Mar Biodivers Rec 2017; 10:6 10.1186/s41200-017-0108-z [DOI] [Google Scholar]
36.Wong NLWS The JC. Direct observation of drifting juvenile seahorse Hippocampus trimaculatus (Leach, 1814) beneath the offshore surface at Malacca Strait. Check List 2017; 13: 993–996. [Google Scholar]
37.Aylesworth L, Lawson LM, Laksanawimol P, Ferber P, Loh TL. New records of the Japanese seahorse Hippocampus mohnikei in Southeast Asia lead to updates in range, habitat and threats. J Fish Biol 2016; 88: 1620–1630. 10.1111/jfb.12908 [DOI] [PubMed] [Google Scholar]
38.Masuda H, Amaoka K, Araga C, Uyeno T, Yoshino T. The Fishes of the Japanese Archipelago. Tokyo: Tokai University Press; 1984. [Google Scholar]
39.Kanou K, Kohno H. Early life history of a seahorse, Hippocampus mohnikei, in Tokyo Bay Japan. Ichthyol Res 2001; 48: 361–368. [Google Scholar]
40.Suda Y, Inoue T, Nakamura M, Masuda N, Doi H, Murai T. Nearshore ichthyofauna in the intermediate sandy beach, Doigahama Beach, Yamaguchi Prefecture, Japan. J Nat Fish Univ 2004; 52: 11–29. [Google Scholar]
41.Lim K. New Singapore record of the seahorse, Hippocampus mohnikei. Singapore Biodiver Rec 2013; 2013: 68–69. [Google Scholar]
42.Laksanawimol P, Petpiroon S, Damrongphol P. Trade of seahorses, Hippocampus spp. (Actinopertygii: Syngnathiformes: Syngnathidae), on the East Coast of the Gulf of Thailand. Acta Ichthyol Piscata 2013; 3: 229–235. [Google Scholar]
43.Chang CH, Jang-Liaw NH, Lin YS, Fang YC, Shao KT. Authenticating the use of dried seahorses in the traditional Chinese medicine market in Taiwan using molecular forensics. J Food Drug Analy 2013; 21: 310–316. [Google Scholar]
44.Zhang Y, Pham NK, Zhang H, Lin J, Lin Q. Genetic variations in two seahorse species (Hippocampus mohnikei and Hippocampus trimaculatus): evidence for Middle Pleistocene population expansion. PloS One 2014; 9: e105494 10.1371/journal.pone.0105494 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Pollom R. Hippocampus mohnikei. The IUCN Red List of Threatened Species 2017: 10.2305/IUCN.UK.20173.RLTS.T41005A54907304.en43. Downloaded on 10 November 2018. [DOI]
46.Shetye SR, Gouveia AD, Singbal SY, Naik CG, Sundar D. et al. Propagation of tides in the Mandovi–Zuari estuarine network. Proc Indian Acad Sci (Earth Planet Sci) 1995; 104: 667–682. [Google Scholar]
47.Qasim SZ, Sen Gupta R. Environmental characteristics of the Mandovi-Zuari estuarine system. Estuar Coast Shelf Sci 1981; 13: 557–578. [Google Scholar]
48.Madhupratap M, Nair KNV, Gopalkrishnan TC, Haridas P, Nair KKC. et al. Arabian sea oceanography and fisheries of the west coast of India. Curr Sci 2001; 81: 355–361. [Google Scholar]
49.Ansari ZA, Sreepada RA, Dalal SG, Ingole BS, Chatterji A. Environmental influences on the trawl catches in a bay-estuarine system of Goa, west coast of India. Estuar Coast Shelf Sci 2003; 56: 503–515. [Google Scholar]
50.Ansari ZA, Chatterji A, Ingole BS, Sreepada RA, Rivonker CU. et al. Structure of inshore demersal fish community at Goa. Estuar Coast Shelf Sci 1995; 41: 593–610. [Google Scholar]
51.Lourie S. Measuring seahorses. Project Seahorse Technical Report No.4, Version 1.0. Project Seahorse, Fisheries Centre, University of British Columbia; 2003.
52.Zhang Y, Qin G, Wang X, Qiang L. A new species of seahorse (Teleostei: Syngnathidae) from the South China Sea. Zootaxa 2016; 4170: 384–392. 10.11646/zootaxa.4170.2.11 [DOI] [PubMed] [Google Scholar]
53.Wibowo K, Tashiro S, Motomura H. Seahorses of the genus Hippocampus (Syngnathidae) from Kagoshima Prefecture, southern Japan, with a new record of H. mohnikei Bleeker, 1853. Nature of Kagoshima 2017; 43:71–76. [Google Scholar]
54.Underwood AJ. Experiments in Ecology: their logical and interpretation using Analysis of Variance. Cambridge University Press; Cambridge, UK; 1997. [Google Scholar]
55.Kumar R Singh PJ, Nagpure NS, Kushwaha B, Srivastava SK. et al. A non-invasive technique for rapid extraction of DNA from fish scales. Ind J Exp Biol 2007; 45: 992–997. [PubMed] [Google Scholar]
56.Qin G, Zhang Y, Ho ALFC, Zhang Y, Lin Q. Seasonal distribution and reproductive strategy of seahorse. ICES J Mar Sci 2017; 74: 2170–2179. [Google Scholar]
57.Lourie SA, Vincent ACJ. A marine fish follows Wallace’s line: the phylogeography of the three-spot seahorse (Hippocampus trimaculatus, Syngnathidae, Teleostei) in Southeast Asia. J Biogeogr 2004; 31: 1975–1985. [Google Scholar]
58.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215: 403–410. 10.1016/S0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]
59.Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis, version 7.0 for bigger datasets. Mol Biol Evol 2016; 33: 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980; 16: 111–120. 10.1007/bf01731581 [DOI] [PubMed] [Google Scholar]
61.Wyrtki K. Physical oceanography of the southeast Asian waters. Scientific results of maritime investigations of the South China Sea and the Gulf of Thailand 1959–1961. Naga Report, 2. Scripps Institution of Oceanography, La Jolla, CA; 1961.
62.Choi Y, Rho S, Park H, Kang D. Population characteristics of two seahorses, Hippocampus coronatus and Hippocampus mohnikei, around seagrass beds in the southern coastal waters of Korea. Ichthyol Res 2012; 59: 235–241. [Google Scholar]
63.Kwak S, Huh S, Kim H. Feeding habits of Hippocampus mohnikei in an eelgrass (Zostera marina) bed. Korean J Ichthyol 2008; 20: 112–116. [Google Scholar]
64.Panithanarak T, Karuwanjaroen R. A preliminary study of genetic differentiation in the Japanese seahorse (Hippocampus mohnikei) populations: a possibility of cryptic species. Burapha Sci J 2019; 24: 124–137. [Google Scholar]
65.Hou F., Wen L, Peng C, Guo J. Identification of marine traditional Chinese medicine dried seahorses in the traditional Chinese medicine market using DNA barcoding. Mitochondrial DNA A 2018; 29(1):107–112. [DOI] [PubMed] [Google Scholar]
66.Otsuka Y, Suzuki H, Akagawa I. Occurrence, gonad morphology and maturity of Japanese seahorse Hippocampus mohnikei in Matsushima Bay, Japan. J School Mar Sci Tech Tokai Univ 2009; 7: 11–22. [Google Scholar]
67.Wafar S. Ecology of mangroves along the estuaries of Goa; Ph. D. Thesis, Karnataka University, Dharward, India; 1987.
68.Jagtap TG. Distribution of seagrasses along Indian coast. Aquac Bot 1991; 40: 379–386. [Google Scholar]
69.Padmavati G, Goswami SC. Zooplankton ecology in the Mandovi-Zuari estuarine system of Goa, west coast of India. Ind J Mar Sci 1996; 25: 268–273. [Google Scholar]
70.Dalal SG, Goswami SC. Temporal and ephemeral variations in copepod community in the estuaries of Mandovi and Zuari–west coast of India. J Plankton Res 2001; 23: 19–26. [Google Scholar]
71.Das PB. Zooplankton assemblages in spatial stretches of a tropical estuary. Int J Res Appl Sci Engg Technol 2017; 5: 1789–1799. [Google Scholar]
72.Qin G, Johnson C, Zhang Y, Zhang H, Yin J, Miller G. et al. Temperature-induced physiological stress and reproductive characteristics of the migratory seahorse Hippocampus erectus during a thermal stress simulation. Biol Open 2018; 25: 7(6).bio032888. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Scales H. Advances in the ecology, biogeography and conservation of seahorses (genus Hippocampus). Prog Phys Geog 2010; 34: 443–458. [Google Scholar]
74.Bohonak AJ. Dispersal, gene flow, and population structure. Q Rev Biol 1999; 74: 21–45. 10.1086/392950 [DOI] [PubMed] [Google Scholar]
75.Palumbi SR. Genetic divergence, reproductive isolation, and marine speciation. Annu. Rev Ecol Evol S 1994; 25: 547–572. [Google Scholar]
76.Shetye SR, Gouveia AD, Shenoi SSC, Michael GS, Sundar D, Almedia AM. et al. The coastal current off western India during the northeast monsoon. Deep-Sea Res 1991; 38: 1517–1529. [Google Scholar]
77.Fleminger A. The Pleistocene equatorial barrier between the Indian and Pacific oceans and a likely cause for Wallace’s Line. In Pierrot-Bults AC, van der Spoel S, Zahuranec BJ, Johnson RK editors, Pelagic marine science. UNESCO Tech Pap Mar Sci 1986; 49: 84–97. [Google Scholar]
78.Maree RC, Whitfield AK, Booth AJ. Effect of water temperature on the biogeography of South African estuarine fishes associated with the subtropical/warm temperate subtraction. S Afr J Sci 2000; 96: 184–188. [Google Scholar]
79.Bowen BW, Bass AL, Rocha LA, Grant WS, Robertson DR. Phylogeography of the trumpetfishes (Aulostomus): ring species complex on a global scale. Evolution 2001; 55: 1029–1039. 10.1554/0014-3820(2001)055[1029:pottar]2.0.co;2 [DOI] [PubMed] [Google Scholar]
80.Martin-Smith KM, Vincent ACJ. Seahorse declines in the Derwent estuary, Tasmania, in the absence of fishing pressure. Biol Conserv 2005; 123: 533–545. [Google Scholar]
81.Shokri MR, Gladstone W, Jelbart J. The effectiveness of seahorses and pipefish (Pisces: Syngnathidae) as a flagship group to evaluate the conservation value of estuarine seagrass beds. Aquat Conserv 2009; 19: 588–595. [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0220420.r001

Decision Letter 0

Rui Rosa

24 Sep 2019

PONE-D-19-19415

Morphological and molecular evidence for range extension and first occurrence of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

PLOS ONE

Dear Mr Rayadurga,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Nov 08 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Rui Rosa

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript
A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)
A clean copy of the edited manuscript (uploaded as the new *manuscript* file

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Morphological and molecular evidence for range extension and first occurrence of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

The authors report of a seahorse, Hippocampus mohnikei usually found in the east Indian - and Pacific ocean, recorded for the first time on the west coast of India.

Overall, the study is interesting in its findings of range expansion of a small seahorse.

General comments:

I think the Authors did not read the Guidelines for submission?

Some sections are messy with Table captions missing or wrongly placed, Fig captions interrupting main text of MS … It was hard to follow and I put it away many times and nearly did not review!

Someone needs to check if all uploaded files are correct before sending to Reviewers!

Regarding the manuscript I would urge the authors to separate Tables and Figures with their captions from the main text of the MS. Figure legends/captions occurred within the text and disrupted the flow. Example: Table 2 starts on page 13 without Table legend/caption followed by text (new results). The actual table was (I assume) on page 14 without a header and table legend was below the table!

Another point for the morphological measurements; how about indicating the different measurements on one of the images of the seahorse with abbreviations (explained in Fig caption) e.g. see Forsgren & Lowe 2006 (seadragon morphology). Table2 would be more compact.

For the molecular work did you extract and sequence mitochondrial DNA (mtDNA) from all 4 individuals found or just from 2 individuals? I thought you caught 4? If you have 4 samples sequenced (COI and cytb) you should show all 4 in the tree not just the one. Where do the other 3 individuals occur in each tree (COI and cytb)? If all or some of the other 3 do not cluster with the voucher H. mohnikei then you have to consider other possibilities.

Some sections need to be deleted especially in Results! Result section is littered with sentences that end in eg ‘…. presented in Table x’ = not in published papers (more like student assignment)

Please explain your results and refer to your table/Fig in brackets!

Eg. Morphological measurements revealed ….. – state your results (Table 1).

Check grammar, punctuation in main text.

Specific comments:

Introduction

Line 57: Sentence; Often overlooked by most fishermen, due to their cryptic nature, their ability to camouflage and the sparse distribution restrict biologists to identify their presence in thick coastal marine habitats.

Line 100: Sentence about using gene markers re-write … sequenced 2 mtDNA gene regions (loci) COI & cyt b ..

Materials & Methods

Line126: incidental catch = is that bycatch - if so use correct term

Lines 132-141: Figure captions! Should be on separate sheet!

Line 175: ‘.. fin from fresh seahorse ..’ I thought they were dead seahorses from bycatch? Did I miss something?

Line 203: Seq of Goa specimens GB MK330041.1 and MK112274.2 = 2 seq’s submitted - did you not seq 4 individuals? If the other 2 did not provide DNA- seq (wwere they degraded?) you need to say this in your M&M!

add a table S1 (suppl) of the sequences (species name, GB accession # Ref) you downloaded for your phylogenetic tree from GB and cite their work.

Results

Line 236-237: delete senetence! Start explaining your main result and refer to your (Table/Fig) in brackets. ‘Morphological measurements revealed …Goa specimens are consistent with … (Table1).

I would move Table 1 into Suppl material (raw data).

Then describe some of the more important measurements that support your work.

Please don’t repeat results in your text if they are already in Table 1! People can read tables. So explain the measurements eg. on average size of … (mean #) comparable to size of mohnikei samples … from eg. east India or Thailand/Vietnam?

Line 258-259: re-write sentence … we compared … commonly occurring seahorses, H. kuda … (Table 2).

Pages 11-12, and 13-14 totally messy with tables throughout text making it difficult to follow should have been on separate sheet.

Page 13-14 = messy table is split I assume? No captions above table header - I assume Table 2? AND Table caption go ABOVE a table not below please read PlosOne Author Guidelines!

Table 3 - PCA – move to Suppl material it is already represented in Fig 4 – don’t repeat results.

Phylogenetic analysis – needs overhaul

Both trees (Fig5 & 6) only have 1 goa individual in tree. Where are the other 3 sequences?

You need to add all 4 indiv seq to each gene region (COI, cyt b) tree. If by chance other individuals did not fall into same clade as H mohnikei – this needs to be discussed! There are probably other reasons for it … (eg. hybrids?)

When you aligned the seq to the other GB downloaded seq in MEGA it should be obvious especially COI (Barcode of Life – check out H mohnikei on BOLD systems http://www.boldsystems.org/index.php/TaxBrowser_TaxonPage?taxid=66243)

Line 317 – delete ‘depicted in Fig5 and Fig6… see above comments

Line 325 – delete presented in Table …

Lines 330-338 = remove Fig captions from main MS text – refer to guidelines

Table 4 (don’t just copy table from program) = Table Header replace 1 2 3 4 with actual locations: Goa Japan …

Same with Table 5.

Line 317-372 Fig caption see guidelines

Discussion

Line 390-394 Fig caption – see guidelines

There are repeated results in the discussion – delete them – you already have these in your Result section. Discuss your results.

Line 405-415 remove results repeated – already in Result section

Figure 2 and Fig 3 = combine or place one in suppl material

Figure 1 & 8 combine = Fig 1 could be inset to the bigger Map Fig 8

Reviewer #2: Really nice description of morphological and molecular characters for the range expansion of H. mohnikei in India. This is a really interesting seahorse that requires more studies on its distributional range within the Indo-Pacific region.

Reviewer #3: General Comments:

This paper represents a significant contribution to the global knowledge of seahorse diversity in the Arabian Sea, and represents novel information that is interesting from both evolutionary and conservation perspectives. I suggest that the authors revise the manuscript to have more of a focus on the biogeography of seahorses in Southeast Asia, which is outlined nicely by Lourie and Vincent (2004). The manuscript is important and should be published, but requires a thorough re-write to correct the grammar (see specific comments below). The discussion needs to more clearly outline that this is likely to be an established population, but with the possibility that these specimens are vagrants.

The information regarding ocean circulation should be provided in the methods section, and figures should be added to display other seasons as well. This should then be linked in the discussion to how the species got to Goa. An effort should be made to determine where this species originates biogeographically and to clarify in which direction it dispersed over time.

Overall, this manuscript requires a substantial amount of work to be made publishable, but I do not consider this a 'major revision', as the overall structure and content need to change very little. I suggest publishing this manuscript in PLOS ONE after these extensive minor revisions have been made.

Lourie, S.A. and Vincent, A.C., 2004. A marine fish follows Wallace's Line: the phylogeography of the three‐spot seahorse (Hippocampus trimaculatus, Syngnathidae, Teleostei) in Southeast Asia. Journal of Biogeography, 31(12), pp.1975-1985.

Specific comments:

Line 27: use 'geographic range' rather than 'distribution range'; do this throughout the manuscript

Line 40: "hitherto known range of Japan and Vietnam" is incorrect. Aylesworth et al (2016) have already reported this species from the Gulf of Thailand and western Thailand.

Line 43: 'conspecificity' refers to individuals within the same species; it appears here that the authors are suggesting that the specimens from Japan are of a different species. I suggest rewording to state that the specimens examined in this study are closer genetically to those in Vietnam and Thailand than they are to those in Japan. Unless there is evidence to the contrary, they are all conspecifics.

Lines 56-57: 'unnoticeable from coastal habitat' is unwieldy. I suggest deleting this sentence.

Lines 57-59: This is an incomplete sentence that lacks a subject; 'thick coastal marine habitats' is ambiguous. I suggest deleting this sentence as well.

Line 60: at least three species have been described since Lourie et al. (2016): Hippocampus casscio, H. haema, and H. japapigu

Lines 63-64: the validity of H. montebelloensis and H. borboniensis is disptued by Lourie et al. (2016). Although it is not necessary to agree with this, it is necessary to make note in the manuscript.

Lines 69-70: "(e.g. pelvic and caudal fins), high variability and overlapping of body proportions, colour (camouflage) and skin filaments" should read "(e.g. pelvic and caudal fins), and have high variability of and overlapping body proportions, colour (camouflage) and skin filaments"

Line 73: 'relationships' rather than 'relationship'

Lins 80-81: currently reads "However, instances of small migration of seahorses in search of proper habitat", should read "However, instances of limited migrations by seahorses in search of proper habitat,"

Lines 83-84: I would not consider oceanic current to be 'stepping stones'. Although currents facilitate dispersal, the real 'stepping stones' would be patches of habitat along the way.

Lines 88-89: reference [35] (Aylesworth et al. 2016) report this species from western Thailand, not "from southeastern India to Korea and Japan"

Lines 89-91: 'Previous reports' should include the Aylesworth et al (2016) observations from western Thailand. As stated currently, it appears the authors of this manuscript have extended the range from Vietnam to western India, when in fact the manuscript is only extending it from eastern India to western India. (see Figure 27 in Lourie et al. 2016).

Lines 90-92: this species is not listed as Vulnerable because of 'recent exploitations'; it is listed as Vulnerable because of a suspected reduction in population size of >30% over the past 10 years due to fisheries exploitation.

Line 92: the word 'vulnerable' should be capitalized, as it is a formal IUCN Red List Category.

Line 98: there needs to be a bridge sentence: the current text indicates that surveys found no new specimens and then goes straight into the fact that mroe specimens were found. The fact that the specimens examined were caught as bycatch in bag fisheries needs to be explained here, prior to stating the expansion.

Lines 101-102: how do we know that this is a recent expansion of the range? Presumably this species could have been present here all along without being detected.

Line 109: "The collection site of seahorses" - suggest rewording is "The locality at which the examined seahorse specimens were collected from"

Line 119: suggest deleting 'characterized by'

Line 157: replace 'three time counting' with 'triplicate counting'

Line 158: change 'were also taken in case of male specimens' to 'were measured in all male specimens'.

Line 230: remove 'almost'

Lines 232-233: Are there two cheek spines and two eye spines in total, or on each side of the head (so four)?

Table 1: header needs to be repeated at top of second page

Line 258: replace 'A comparative' with 'A comparison of'

Line 260: change 'was' to 'were'

Line 265: delete 'the'

Line 266: it appears the heading for Table 2 became separated from the rest of the table.

Line 266: replace 'distinguishes' with 'distinguish'

Line 337: replace 'seahorses' with 'seahorse'

Lines 359-370: Unless the authors actually collected field data regarding ocean circulation, this section should remain entirely in the methods section where the study site is described.

Lines 386-388: should read "In northeast Asia, H. mohnikei is reported from China and South Korea".

Line 397: change 'morpho-molecular' to 'morphological and moleculat'; delete 'is the most recent'

Line 398: delete 'distributional'

Line 405: delete 'of' after 'constructed'

Line 410: replace 'sequences' with 'sequence'

Line 421: the term 'disjunct' is misused here. I don't believe there is any evidence to suggest any disjunctions in the population.

Lines 421-423: this statement needs some nuance. Genetic differences within a species do not necessarily mean that cryptic species exist. These difference can mean that there are cryptic species, but the authors should state what a defensible threshold for species delineation might be (i.e. at what % difference would we likely consider them separate species?).

Line 425: replace 'on' with 'of'

Line 431: replace 'report' with 'data'

Line 451: again I am not aware of any evidence to say that the population is disjunct

Lines 474-475: replace 'attain a settlement phase (benthic)' with 'settle on the benthos'

Line 476: the authors need to provide evidence that the population is disjunct

Line 484: delete 'a'; replace 'promoting' with 'permit'

Line 490: delete 'as'

Lines 488-500: Is there evidence that this species originated in China/Japan? This section reads as though the species dispersed here recently. How can we be sure it didn't originate in India and disperse to the east? The prevailing currents are only shown for one season.

Line 506: change 'entail seahorses to flow downstream' to 'force seahorses downstream'

Line 518: delete 'inhabiting'

Line 520: it's not clear what the authors mean by 'translocated populations'.

Line 528: Translocation suggests that humans collected the seahorses elsewhere and relocated them to Goa. I don't think that is what this paper suggests - the evidence is clear that this is probably an extension of their natural range based on new information. I suggest deleting point (i). This sentence should state that these are either vagrants or a previously unreported established population.

Reviewer #4: Mr. Rayadurga and colleagues are to be commended for their efforts to understand the taxonomic identity and biogeography of a rare and previously poorly documented seahorse species occurring on the central west coast of India. As the authors state, seahorses globally are in decline, driven by their demand as an ingredient in traditional Chinese medicine as well as by degradation of their coastal marine habitat by human activities. The taxonomy and distribution of seahorses must be further clarified if seahorse populations are to persist in the face of these pressures.

While indeed it is intriguing to find and identify several specimens of H. mohnikei in the Goa region, unfortunately the methods presented in this manuscript do not support the conclusions the authors draw, as explained below. In addition to the disconnect between the analyses and their conclusions, the findings of this paper are more appropriate for a more specialized journal, such as Marine Biodiversity Records or Zootaxa, than for PLoS ONE. The manuscript also needs a thorough editing by a native English speaker for grammar and clarity of prose. For all of these reasons, as explained in more detail, I cannot recommend this manuscript be published in PLoS ONE.

While indeed it is likely that the 4 analyzed seahorse specimens are H. mohnikei, neither the morphological or the genetic analyses have been conducted in a way that support the authors conclusions.

For the morphometric analysis, it is essential to include one or preferably more vouchered specimens of H. mohnikei in the analysis to conclusively determine that the morphometric cluster analysis supports the identification of the specimens in question. By examining only the 4 specimens in question against specimens from two other distinct seahorse species, the authors have only demonstrated that the unidentified seahorse specimens are NOT H. kuda or H. trimaculatus. But this analysis cannot be used to conclude these unidentified specimens ARE H. mohnikei. For that, you would need to also measure one or more vouchered specimens of H. mohnikei and show that the Goa specimens cluster together with known H. mohnikei morphometric data.

The case with the genetic data is the same. The correct analysis would be to download ALL VOUCHERED H. mohnikei COI and cytb sequences, align them, conduct an analysis of the correct model of molecular evolution for this dataset (there is no justification for why the authors used K2P - how was it determined that this was indeed the correct evolutionary model for these data?), and conduct a rigorous phylogenetic analysis that assesses the position of the 4 Goa specimens among all other known H. mohnikei sequences for both genes.

By choosing only a few sequences from other H. mohnikei specimens to compare to, the authors are depriving this analysis of the dataset required to more fully understand the identity and phylogeographic relationships of the Goa specimens.

The results of the genetic analysis do not support the conclusions the authors make, but potentially there is something quite interesting to be investigated here. The authors claim that the taxonomic identity of the Goa specimens in confirmed because the sequences of the putative H. mohnikei from Goa are nearly identical to just 3 other H. mohnikei sequences from southeast Asia. And here is where it gets even more interesting, while also pointing to the lack of support for the authors conclusions. The pairwise genetic distances reported between the Goa specimens and the 3 SE Asia sequences for both Cytb and COI are ENORMOUS, and absolutely cannot reflect intraspecific genetic variation. The authors are reporting 3-10% distance in COI, where most valid species can be separated at the 3% level. The cytb differences are so large as to reflect saturation in mutations - you basically cannot get larger genetic distances than 18% or so, and levels that high almost always reflect completely different species. These results only validate the need to include all known vouchered specimens of H. mohnikei in the analysis, to better understand the clustering among the 100 or so available specimens in GenBank and the Barcode of Life databases.

There are several possible reasons for these findings: an inaccurate sequence alignment, the need for a more sophisticated model of molecular evolution that can account for the possibility of multiple mutations at a given site, or that the specimens from Goa really are so genetically distinct they have diverged significantly on their evolutionary pathway. A more rigorous genetic analysis is the only way to understand what these 4 mystery specimens really represent.

I recommend the authors shorten their paper to a scientific note format and publish this work in a more specialized journal such as those listed above. By publishing the sequences and placing them in the public record, they will have done a great service to adding important information regarding the continuing mystery of seahorse taxonomy and distributions, for which they will be acknowledged.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Graham Short

Reviewer #3: Yes: Riley Pollom

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Mar 24;15(3):e0220420. doi: 10.1371/journal.pone.0220420.r002

Author response to Decision Letter 0

9 Jan 2020

Response to Comments/suggestions made by the Reviewers

Manuscript ID number: PONE-D-19-19415

Manuscript title: Morphological and molecular evidence for range extension and first occurrence of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

Authors: Sushant Sanaye, Rakhee Khandeparker, Rayadurga Anantha Sreepada, Mamatha Singanahalli Shivaramu, Harshada Kankonkar, Jayu Narvekar, Mukund Gauthankar

We are thankful for the reviewers for their constructive criticisms/suggestions and their input has substantially improved the quality of the manuscript.

Below, we provide a point-by-point response as to how the feedback received from the Reviewers has been incorporated in the revised manuscript.

This manuscript is a resubmission of manuscript PONE-D-19-19415 with our response to the questions made by the reviewers. The Academic Editor handling this manuscript is Dr. Rui Rosa

Reviewer #1:

The authors report of a seahorse, Hippocampus mohnikei usually found in the east Indian and Pacific ocean, recorded for the first time on the west coast of India. Overall, the study is interesting in its findings of range expansion of a small seahorse.

Response: We thank the Reviewer for the excellent review and the positive comments on the manuscript. Constructive suggestions provided by the Reviewer are appreciated.

General comments:

Comment: I think the Authors did not read the Guidelines for submission?. Some sections are messy with Table captions missing or wrongly placed, Fig captions interrupting main text of MS. It was hard to follow and I put it away many times and nearly did not review!. Someone needs to check if all uploaded files are correct before sending to Reviewers. Regarding the manuscript I would urge the authors to separate Tables and Figures with their captions from the main text of the MS. Figure legends/captions occurred within the text and disrupted the flow. Example: Table 2 starts on page 13 without Table legend/caption followed by text (new results). The actual table was (I assume) on page 14 without a header and table legend was below the table!

Response: At the outset, we apologise for the inconvenience caused due to the formatting issues. Here we state that the all the guidelines/instructions for online submission of the manuscript were meticulously adhered to. According to journal requirement, we have again checked our revised manuscript to meet PLOS ONE’s style requirements. We hope that the revised version will be the error-free readable format.

Comment: Another point for the morphological measurements; how about indicating the different measurements on one of the images of the seahorse with abbreviations (explained in Fig caption) e.g. see Forsgren & Lowe 2006 (seadragon morphology). Table2 would be more compact.

Response: Highly appreciate constructive suggestion of the Reviewer. The measurement of morphological characters and meristic counts of seahorse specimens were carried out as per the standard protocols/procedures of measuring seahorses as outlined in Lourie et al. (1999); Lourie et al (2003) and Lourie et al (2004). These are standard protocols that have been used widely for the purpose. measurement of morphological and meristic characters of seahorse species by many authors. These references have been cited in sub-section, morphological analysis under Section, ‘Materials & Methods' which we consider serve the purpose.

Comment: For the molecular work did you extract and sequence mitochondrial DNA (mtDNA) from all 4 individuals found or just from 2 individuals? I thought you caught 4? If you have 4 samples sequenced (COI and cytb) you should show all 4 in the tree not just the one. Where do the other 3 individuals occur in each tree (COI and cytb)? If all or some of the other 3 do not cluster with the voucher H. mohnikei then you have to consider other possibilities.

Response: We strongly appreciate the criticism provided by the Reviewer. As suggested by the reviewer, remaining 3 seahorse specimens (MK1, MK2 and MK3) were also sequenced in addition to originally sequenced seahorse specimen (MK4) for both COI and Cyt b genes. Sequences generated from 04 seahorse specimens with GenBank accession numbers, MN595216, MN595218, MN595217 and MK330041.1 for COI gene and MN595213, MN595214, MN595215 and MK112274.2 for Cyt b genes, respectively corresponding to 4 seahorse specimens (MK1, MK2, MK3 and MK4) were included in phylogenetic analysis (Fig. 6 and Fig. 7). Phylogenetic analysis revealed that all 4 seahorse individuals from Goa clustered together confirming a monophyletic lineage. Sequences generated of COI and Cyt b gene from 4 seahorse individuals have been used for phylogenetic analysis in the revised manuscript.

Comment: Some sections need to be deleted especially in Results! Result section is littered with sentences that end in eg ‘…. presented in Table x’ = not in published papers (more like student assignment). Please explain your results and refer to your table/Fig in brackets! Eg. Morphological measurements revealed ….. state your results (Table 1). Check grammar, punctuation in main text.

Response: We have greatly modified the Results section as suggested by the Reviewer. The section of Results has been modified in the revised manuscript. We incorporated all grammatical and typographical edits into the revised text. The English language has been polished after incorporating the suggested grammatical and typographical edits into the text. Now, the English language of the manuscript has been checked by Grammarly software.

Specific comments:

Introduction

Query: Line 57: Sentence; Often overlooked by most fishermen, due to their cryptic nature, their ability to camouflage and the sparse distribution restrict biologists to identify their presence in thick coastal marine habitats.

Response: As suggested by the reviewer, the sentence has been corrected.

Query: Line 100: Sentence about using gene markers re-write … sequenced 2 mtDNA gene regions (loci) COI & cyt b ..

Response: The sentence corrected as suggested by the Reviewer.

Materials & Methods

Query: Line126: incidental catch = is that by catch - if so use correct term

Response: Correct terms used. In the revised manuscript, the sentence corrected as Dead seahorses landed as incidental catch in bag nets attached to the stakes operated by local fishermen ..............

Query: Lines 132-141: Figure captions! Should be on separate sheet!

Response: The MS has been prepared as per journal’s prescribed format. Accordingly, the tentative probable positioning of the Figures with captions has been shown in the manuscript

Query: Line 175: ‘.fin from fresh seahorse ..’ I thought they were dead seahorses from by catch? Did I miss something?

Response: Actually, we wanted to infer freshly dead seahorses here. In the revised manuscript, this has been corrected as freshly landed dead seahorses' to bring clarity.

Query: Line 203: Seq of Goa specimens GB MK330041.1 and MK112274.2 = 2 seq’s submitted - did you not seq 4 individuals? If the other 2 did not provide DNA- seq (were, they degraded?) you need to say this in your M&M! add a Table S1 (suppl) of the sequences (species name, GB accession # Ref) you downloaded for your phylogenetic tree from GB and cite their work.

Response: We are extremely grateful to the Reviewer for pointing out this mistake. As explained above, remaining 3 individual seahorses (MK1, MK2, MK3) were sequenced subsequently following the same protocols as that was followed for initially sequenced seahorse individual i.e. MK4. Sequences generated from all 4 seahorse individuals, MK1, MK2, MK3 and M were submitted at NCBI vide GenBank accession numbers, MN595216, MN595218, MN595217 and MK330041.1 for COI gene and MN595213, MN595214, MN595215 and MK112274.2 for Cyt b genes, respectively were included in phylogenetic analysis (Fig. 6 and Fig. 7).

As advised by the reviewer, all the downloaded sequences of H. mohnikei for COI and Cyt b genes available at GenBank along with their voucher Number and references used for constructing phylogenetic trees has been provided Supplementary S1 Table.

Results

Query: Line 236-237: delete sentence! Start explaining your main result and refer to your (Table/Fig) in brackets. ‘Morphological measurements revealed …Goa specimens are consistent with … (Table1). I would move Table 1 into Suppl material (raw data). Then describe some of the more important measurements that support your work. Please don’t repeat results in your text if they are already in Table 1! People can read tables. So explain the measurements eg. on average size of … (mean #) comparable to size of mohnikei samples from eg. east India or Thailand/Vietnam? Line 258-259: re-write sentence … we compared … commonly occurring seahorses, H. kuda … (Table 2).

Response: As advised by the reviewer, Line, 236-237 has been deleted. Now, the sub section on 'morphological analysis' under Results section has been modified to include only the salient findings. We have modified the Results section to a great extent and hope to have improved it by doing so.

Firstly, we have re-arranged the few paragraphs to better mirror the presentation sequence of the results. Additionally, we have introduced Table 3 "Comparison of diagnostic morphological characters of all vouchered specimens of Hippocampus mohnikei” for comprehensiveness of the morphological data. Since, Table 1 describes all the morphological characters of four seahorse specimens collected from Goa coast. Considering its significance to the manuscript, Table 1 has retained and not moved to Supplementary material. All other typos and corrections suggested by the Reviewer have been incorporated in the revised manuscript.

Query: Pages 11-12, and 13-14 totally messy with tables throughout text making it difficult to follow should have been on separate sheet.

Response: We apologise for the inconvenience caused due to formatting issues. The revised manuscript has been checked to meet PLOS ONE’s style requirements.

Query : Page 13-14 = messy table is split I assume? No captions above table header - I assume Table 2? AND Table caption go ABOVE a table not below please read Plos One Author Guidelines!

Response: We apologise for the inconvenience caused due to formatting issues. Now, the revised manuscript has been checked to meet PLOS ONE’s style requirements and hope the formatting issue is resolved.

Query : Table 3 - PCA – move to Suppl material it is already represented in Fig 4 – don’t repeat results.

Response: As suggested by the Reviewer, Table 3 on PCA output has moved to Supplementary material (S2 Table)

Query: Phylogenetic analysis – needs overhaul. Both trees (Fig. 5 & 6) only have 1 goa individual in tree. Where are the other 3 sequences? You need to add all 4 indiv seq to each gene region (COI, cyt b) tree. If by chance other individuals did not fall into same clade as H mohnikei – this needs to be discussed! There are probably other reasons for it …(eg. hybrids?). When you aligned the seq to the other GB downloaded seq in MEGA it should be obvious especially COI (Barcode of Life – check out H mohnikei on BOLD systems http://www.boldsystems.org/index.php/TaxBrowser_TaxonPage? taxid =66243)

Response: The subsection of 'Phylogenetic analysis' has been modified to a great extent by incorporating the sequence data of all 4 individual seahorses from Goa. Maximum likelihood (ML) trees for both COI and Cyt b genes have been constructed by aligning them with the downloaded sequences for all vouchered H. mohnikei downloaded from the GenBank in the revised manuscript. Phylogenetic analysis revealed that all 4 seahorse individuals from Goa clustered together and formed a single clade thus confirming a monophyletic lineage. This has been now mentioned in the revised manuscript. As advised by the reviewer, availability of sequences of COI gene for H. mohnikei were also checked in Barcode of Life (BOLD Systems).

Query: Line 317 – delete ‘depicted in Fig. 5 and Fig. 6… see above comments

Response: Deleted

Query: Line 325 – delete presented in Table

Response: Deleted

Query: Lines 330-338 = remove Fig captions from main MS text – refer to guidelines.

Response: Figure captions removed from the main MS text.

Query: Table 4 (don’t just copy table from program) = Table Header replace 1 2 3 4 with actual locations: Goa Japan Same with Table 5.

Response: As suggested by the reviewer, the Tables of genetic distance (Tables 4 & 5) have been reformatted in the revised manuscript.

Query: Line 317-372 Fig caption see guidelines.

Response: Done

Discussion

Query: Line 390-394 Fig caption – see guidelines

Response: Done

Query: There are repeated results in the discussion – delete them – you already have these in your Result section. Discuss your results.

Response: As suggested by the Reviewer, results have been deleted from the Discussion Section.

Query: Line 405-415 remove results repeated – already in Result section Fig. 2 and Fig 3 = combine or place one in suppl material Figure 1 & 8 combine = Fig 1 could be inset to the bigger Map Fig 8.

Response: Following the comments made by the Reviewer, we have modified the discussion comprehensively. in the revised manuscript. Now, it is hoped the Discussion has improved by removing the repetition of Results. We tried to combine the Fig. 2 and Fig. 3, the quality of the Figure was lost. Similarly, we tried to integrate Fig. 1 to bigger map of Figure 8, but it did not work properly in terms of picture quality and alignment.

Reviewer #2:

Comment: Really nice description of morphological and molecular characters for the range expansion of H. mohnikei in India. This is a really interesting seahorse that requires more studies on its distributional range within the Indo-Pacific region.

Response: We thank the Reviewer for the excellent review with positive comments and appreciation of our work. We agree with the Reviewer that further studies on the distributional range of H. mohnikei within Indo-Pacific region in collaboration with other researchers in Southeast Asia would help in better understanding its evolutionary and biogeography.

Reviewer #3:

General Comments

Comment: This paper represents a significant contribution to the global knowledge of seahorse diversity in the Arabian Sea, and represents novel information that is interesting from both evolutionary and conservation perspectives. I suggest that the authors revise the manuscript to have more of a focus on the biogeography of seahorses in Southeast Asia, which is outlined nicely by Lourie and Vincent (2004). [Lourie, S.A. and Vincent, A.C., 2004]. A marine fish follows Wallace's Line: the phylogeography of the three‐spot seahorse (Hippocampus trimaculatus, Syngnathidae, Teleostei) in Southeast Asia. Journal of Biogeography, 31(12), pp.1975-1985]. The manuscript is important and should be published, but requires a thorough re-write to correct the grammar (see specific comments below). The discussion needs to more clearly outline that this is likely to be an established population, but with the possibility that these specimens are vagrants.

Response: We gratefully thank the Reviewer for excellent review with positive comments/suggestions on the manuscript. As suggested by the Reviewer, the biogeography of seahorse populations in southeast Asia has been focussed in the revised manuscript. The paper by Lourie & Vincent (2004) dealing with the phylogeography of three-spotted seahorse, H. trimaculatus has been referred in the manuscript. Accordingly, the discussion on biogeography of seahorse populations has now been included in the discussion. Additional minor modifications have been made to improve overall readability and to clarify certain statements. The grammatical errors have also been fixed as per the specific comments/edits provided by the Reviewer.

The reviewer may agree that more samples of H. mohnikei would be needed to arrive at a definite conclusion for ascertaining whether the present sighting is a previously unreported established populations or vagrants. Based on this present reporting, our efforts for more specimens of H. mohnikei are still being pursued. With more number of specimens from Goa waters, the biogeography of this small seahorse species in southeast Asia could be addressed comprehensively. Of course this would help in better understanding from both evolutionary and conservation view points.

Comment: The information regarding ocean circulation should be provided in the methods section, and figures should be added to display other seasons as well. This should then be linked in the discussion to how the species got to Goa. An effort should be made to determine where this species originates biogeographically and to clarify in which direction it dispersed over time.

Response: As suggested by the reviewer, now the Figure describing the ocean circulation has been moved to Materials & Methods section (Fig. 4). The role of the ocean circulation in the Indo-Pacific region in facilitating the dispersal of H. mohnikei from its previously reported geographical range into the coastal waters of Goa has been now discussed in the revised manuscript.

Comment: Overall, this manuscript requires a substantial amount of work to be made publishable, but I do not consider this a 'major revision', as the overall structure and content need to change very little. I suggest publishing this manuscript in PLoS ONE after these extensive minor revisions have been made.

Response: The authors are thankful to the Reviewer for positive feedback on the manuscript. Constructive suggestions provided by the Reviewer are appreciated. Now the manuscript has been revised following the minor revisions suggested by the Reviewer.

Specific comments

Query: Line 27: use 'geographic range' rather than 'distribution range'; do this throughout the manuscript

Response: As suggested, ‘distributional range’ changed to ‘geographical range’ in the revised manuscript.

Query: Line 40: "hitherto known range of Japan and Vietnam" is incorrect. Aylesworth et al (2016) have already reported this species from the Gulf of Thailand and western Thailand.

Response: We honestly agree with the Reviewer’s comment. Now, the statement has been modified to accurately represent the fact in the revised manuscript.

Query: Line 43: 'conspecificity' refers to individuals within the same species; it appears here that the authors are suggesting that the specimens from Japan are of a different species. I suggest rewording to state that the specimens examined in this study are closer genetically to those in Vietnam and Thailand than they are to those in Japan. Unless there is evidence to the contrary, they are all conspecifics.

Response: Yes, Agreed. As suggested by the Reviewer, the statement has been reworded to genetically closer in the revised manuscript.

Query: Lines 56-57: 'unnoticeable from coastal habitat' is unwieldy. I suggest deleting this sentence.

Response: Sentence deleted as suggested.

Query: Lines 57-59: This is an incomplete sentence that lacks a subject; 'thick coastal marine habitats' is ambiguous. I suggest deleting this sentence as well.

Response: As suggested by the Reviewer, the sentence as been modified to convey the intended meaning.

Query: Line 60: at least three species have been described since Lourie et al. (2016): Hippocampus casscio, H. haema, and H. japapigu

Response: We totally agree with the Reviewer and we are sorry for missing out this. With the reporting of additional 3 seahorse species since Lourie et al (2016), the statement has been modified to include this. i.e. 44 instead of 41. Appropriate reference (IUCN Seahorse, Pipefish and Stickleback Specialist Group (2019). https://www.iucn-seahorse.org (downloaded on 01/11/2019) has also been cited.

Query: Lines 63-64: the validity of H. montebelloensis and H. borboniensis is disputued by Lourie et al. (2016). Although it is not necessary to agree with this, it is necessary to make note in the manuscript.

Response: We have noted the point raised by the Reviewer. Accordingly, the sentence has been modified by including a caveat. Added a sentence ‘The validity of H. bornoinensis and H. montebelloensis as separate species however, is currently under revision due to their synonymity with H. kuda and H. zebra, respectively’ (Lourie et al., 2016).

Query: Lines 69-70: "(e.g. pelvic and caudal fins), high variability and overlapping of body proportions, colour (camouflage) and skin filaments" should read "(e.g. pelvic and caudal fins), and have high variability of and overlapping body proportions, colour (camouflage) and skin filaments.

Response: As suggested by the Reviewer, the sentence has been modified.

Query: Line 73: 'relationships' rather than 'relationship'

Response: As suggested, ‘relationship’ changed to ‘relationships

Query: Lines 80-81: currently reads "However, instances of small migration of seahorses in search of proper habitat", should read "However, instances of limited migrations by seahorses in search of proper habitat

Response: As suggested, the statement has been modified.

Query: Lines 83-84: I would not consider oceanic current to be 'stepping stones'. Although currents facilitate dispersal, the real 'stepping stones' would be patches of habitat along the way.

Response: We agree with the Reviewer to a certain extent. Oceanic currents may facilitate long distance dispersal but indirectly facilitate stepping stone mode for short distance dispersal. Accordingly, the sentence has been altered.

Query: Lines 88-89: reference [35] (Aylesworth et al. 2016) report this species from western Thailand, not "from southeastern India to Korea and Japan"

Response: We are thankful to the Reviewer for pointing out this mistake. The statement has been now corrected in the revised manuscript.

Query: Lines 89-91: 'Previous reports' should include the Aylesworth et al (2016) observations from western Thailand. As stated currently, it appears the authors of this manuscript have extended the range from Vietnam to western India, when in fact the manuscript is only extending it from eastern India to western India. (see Figure 27 in Lourie et al. 2016).

Response: Agreed. As suggested by the Reviewer, the sentence has been corrected in the revised manuscript. Yes it is true that the reported new range in the study is from eastern India to western India.

Query: Lines 90-92: this species is not listed as Vulnerable because of 'recent exploitations'; it is listed as Vulnerable because of a suspected reduction in population size of >30% over the past 10 years due to fisheries exploitation.

Response: We totally agree with the Reviewer’s comment. As suggested, now the statement has been modified to convey the correct rationale for listing H. mohnikei as ‘VULNERABLE’

Query: Line 92: the word 'vulnerable' should be capitalized, as it is a formal IUCN Red List Category.

Response: In order to comply with the format of IUCN, the word ‘Vulnerable’ changed to ‘VULNERABLE’

Query: Line 98: there needs to be a bridge sentence: the current text indicates that surveys found no new specimens and then goes straight into the fact that more specimens were found. The fact that the specimens examined were caught as bycatch in bag fisheries needs to be explained here, prior to stating the expansion.

Response: We thank the Reviewer in pointing out this error. In order to have a smooth flow, a bridge sentence indicating the specimens examined were based on the incidental catch has been inserted in the revised manuscript (Lines, 111-114).

Query: Lines 101-102: how do we know that this is a recent expansion of the range? Presumably this species could have been present here all along without being detected.

Response: While it is true that this species could have been here without being detected all these years, but we are the first ones to report its occurrence along the west coast of India evidenced with both morphological and molecular data. Previous report of its occurrence from Indian waters by Thangaraj and Lipton (2007) is from southeastern coast of India and is solely based on the morphological data of a single specimen. As mentioned in the manuscript, intense sampling from coastal waters of west coast of India and comparison of H. mohnikei populations from Southeast Asian regions are required for comprehensive biogeography of this small seahorse species in the Indo-Pacific Region.

Query: Line 109: "The collection site of seahorses" - suggest rewording is "The locality at which the examined seahorse specimens were collected from"

Response: Corrected as suggested.

Query: Line 119: suggest deleting 'characterized by'

Response: Deleted

Query: Line 157: replace 'three time counting' with 'triplicate counting'

Response: As suggested, 'three time counting' changed to 'triplicate counting'

Query: Line 158: change 'were also taken in case of male specimens' to 'were measured in all male specimens'.

Response: Corrected as suggested by the Reviewer.

Query: Line 230: remove 'almost'

Response: Removed

Query: Lines 232-233: Are there two cheek spines and two eye spines in total, or on each side of the head (so four)?

Response: Two prominent cheek spines and double rounded spines below the eye (each on the either side of the head) were observed

Query: Table 1: header needs to be repeated at top of second page

Response: We are sorry for the formatting issue. The size of the Table 1 has now been adjusted so that all the data of the Table to appear on the singe page.

Query: Line 258: replace 'A comparative' with 'A comparison of' Line 260: change 'was' to 'were'

Query: Line 265: delete 'the'

Reply: Deleted.

Query: Line 266: it appears the heading for Table 2 became separated from the rest of the table.

Response: We are sorry for this. Table 2 has been reformatted and positioned to so that the heading and the data to appear on the single page.

Query: Line 266: replace 'distinguishes' with 'distinguish'

Query: Line 337: replace 'seahorses' with 'seahorse'

Response: ‘seahorses’ replaced with ‘seahorse

Query: Lines 359-370: Unless the authors actually collected field data regarding ocean circulation, this section should remain entirely in the methods section where the study site is described.

Response: As suggested by the Reviewer, the Figure (Fig. 8) describing the ocean circulation has been moved to Materials & Methods section (now, Fig. 4). As mentioned in the manuscript, the basin-wide prevailing winter circulation (December–February) in the Indo-Pacific region based on the daily data for the 10 years (2007 to 2017) has been prepared and presented.

Query: Lines 386-388: should read "In northeast Asia, H. mohnikei is reported from China and South Korea".

Response: As suggested, the sentence has been corrected.

Query: Line 397: change 'morpho-molecular' to 'morphological and molecular'; delete 'is the most recent'

Response: As suggested, ‘morpho-molecular’ changed to ‘molecular and molecular’. Deleted ‘is the most recent’ in the revised manuscript.

Query: Line 398: delete 'distributional'

Response: Deleted as suggested

Query: Line 405: delete 'of' after 'constructed'

Query: Line 410: replace 'sequences' with 'sequence'

Response: Replaced ‘sequence’ with ‘sequences’

Query: Line 421: the term 'disjunct' is misused here. I don't believe there is any evidence to suggest any disjunctions in the population.

Response: We totally agree to the Reviewer’s view. In the revised manuscript, the term ‘disjunct’ has been removed.

Query: Lines 421-423: this statement needs some nuance. Genetic differences within a species do not necessarily mean that cryptic species exist. These difference can mean that there are cryptic species, but the authors should state what a defensible threshold for species delineation might be (i.e. at what % difference would we likely consider them separate species?).

Response:

Query: Line 425: replace 'on' with 'of' Line 431: replace 'report' with 'data'

Response: As suggested by the Reviewer, necessary edits have been incorporated in the revised manuscript

Query: Line 451: again I am not aware of any evidence to say that the population is disjunct

Response: We agree with the Reviewer and thank for pointing out this mistake. Now, the term ‘disjunct’ replaced with ‘geographically disconnected’

Query: Lines 474-475: replace 'attain a settlement phase (benthic)' with 'settle on the benthos'

Query: Line 476: the authors need to provide evidence that the population is disjunct

Response: Now, the term ‘disjunct’ replaced with ‘geographically disconnected’

Query: Line 484: delete 'a'; replace 'promoting' with 'permit'

Response: Necessary edits have been done.

Query: Line 490: delete 'as'

Response: Deleted

Query: Lines 488-500: Is there evidence that this species originated in China/Japan? This section reads as though the species dispersed here recently. How can we be sure it didn't originate in India and disperse to the east? The prevailing currents are only shown for one season.

Response: We thank the Reviewer for this interesting suggestion. There are no published evidence that this species originated in China/Japan but initial reported type specimens were from Japan/Vietnam and in recent years sighted/reported from other locations, as well. According to Teske et al possibility of originating H. mohnikei in India and dispersal to east is cannot be overruled but required supportive genetic data which we planning with more specimens and control region sequencing. We can also mention about this feature studies in conclusion

Query: Line 506: change 'entail seahorses to flow downstream' to 'force seahorses downstream'

Response: As suggested, necessary corrections have been incorporated in the revised manuscript

Query: Line 518: delete 'inhabiting'

Response: Deleted ‘ínhabiting'

Query: Line 520: it's not clear what the authors mean by 'translocated populations'.

Response: We are sorry for the usage of incorrect term here. Now, 'translocated' replaced with ‘geographically disconnected’

Query: Line 528: Translocation suggests that humans collected the seahorses elsewhere and relocated them to Goa. I don't think that is what this paper suggests - the evidence is clear that this is probably an extension of their natural range based on new information. I suggest deleting point (i). This sentence should state that these are either vagrants or a previously unreported established population.

Response: We are grateful to the Reviewer for pointing out this mistake and incorrect usage of the term, ‘translocation’ here. Concurring to the Reviewer’s suggestion, the point (i) has been deleted in the revised manuscript.

Reviewer #4:

General Comments

Comment: Mr. Rayadurga and colleagues are to be commended for their efforts to understand the taxonomic identity and biogeography of a rare and previously poorly documented seahorse species occurring on the central west coast of India. As the authors state, seahorses globally are in decline, driven by their demand as an ingredient in traditional Chinese medicine as well as by degradation of their coastal marine habitat by human activities. The taxonomy and distribution of seahorses must be further clarified if seahorse populations are to persist in the face of these pressures.

Response: We thank the Reviewer for positive feedback on the manuscript.

Comment: While indeed it is intriguing to find and identify several specimens of H. mohnikei in the Goa region, unfortunately the methods presented in this manuscript do not support the conclusions the authors draw, as explained below. In addition to the disconnect between the analyses and their conclusions, the findings of this paper are more appropriate for a more specialized journal, such as Marine Biodiversity Records or Zootaxa, than for PLoS ONE. The manuscript also needs a thorough editing by a native English speaker for grammar and clarity of prose. For all of these reasons, as explained in more detail, I cannot recommend this manuscript be published in PLoS ONE.

Response: We appreciate the Reviewer for providing the constructive criticisms. Here, we provide the point by point rebuttal/clarifications sought by the reviewer. While we agree that one of the shortcomings could be small sample size, nevertheless, the limited dataset was robust enough to provide interesting insights into H. mohnikei—small and highly migratory seahorse species. As the Reviewer agree that it is quite hard to obtain sufficient number of seahorse specimens for the study due to their cryptic nature and low population density. The revised version of the manuscript is more organised and focussed after incorporating the suggestions and corrections made by all four reviewers and performing additional analysis. We chose PLoS ONE as a medium of publishing our results, firstly because of the multidisciplinary nature of the journal and secondly the 'Open Access Policy' of the journal—which would allow wider dissemination of the results, quickly. In addition, we have seen few similar papers of this nature published

Comment: While indeed it is likely that the 4 analyzed seahorse specimens are H. mohnikei, neither the morphological or the genetic analyses have been conducted in a way that support the authors conclusions.

Response: We thank the reviewer for constructive feedback. Following the Reviewer's comment, we have made two major changes to the manuscript which are explained point by point below.

Comment: For the morphometric analysis, it is essential to include one or preferably more vouchered specimens of H. mohnikei in the analysis to conclusively determine that the morphometric cluster analysis supports the identification of the specimens in question. By examining only the 4 specimens in question against specimens from two other distinct seahorse species, the authors have only demonstrated that the unidentified seahorse specimens are NOT H. kuda or H. trimaculatus. But this analysis cannot be used to conclude these unidentified specimens ARE H. mohnikei. For that, you would need to also measure one or more vouchered specimens of H. mohnikei and show that the Goa specimens cluster together with known H. mohnikei morphometric data.

Response: As suggested by the Reviewer, now a rigorous morphological and morphometric analysis has been conducted A comparative assessment of diagnostic morphological features and morphometric characters of Goa specimens with all vouchered specimens of Hippocampus mohnikei has been conducted. Results of comparative analysis has been tabulated under Table 3. This comparison demonstrated that the unidentified specimens from Goa are H. mohnikei as the most of the diagnostic morphological characters of Goa specimens matched with those of vouchered specimens.

Comment: The case with the genetic data is the same. The correct analysis would be to download ALL VOUCHERED H. mohnikei COI and cytb sequences, align them, conduct an analysis of the correct model of molecular evolution for this dataset (there is no justification for why the authors used K2P - how was it determined that this was indeed the correct evolutionary model for these data?), and conduct a rigorous phylogenetic analysis that assesses the position of the 4 Goa specimens among all other known H. mohnikei sequences for both genes.

Response: We thank the Reviewer for pointing out this mistake. As suggested by the Reviewer, we have downloaded all vouchered H. mohnikei COI and Cyt b sequences from GenBank (S1 Table), aligned them and conducted a rigorous phylogenetic analysis. This rigorous analysis allowed to assess the phylogeographic analysis of 4 specimens for Goa among all other known H. mohnikei sequences for both COI and Cyt b genes.

Comment: The results of the genetic analysis do not support the conclusions the authors make, but potentially there is something quite interesting to be investigated here. The authors claim that the taxonomic identity of the Goa specimens in confirmed because the sequences of the putative H. mohnikei from Goa are nearly identical to just 3 other H. mohnikei sequences from southeast Asia. And here is where it gets even more interesting, while also pointing to the lack of support for the authors conclusions. The pairwise genetic distances reported between the Goa specimens and the 3 SE Asia sequences for both Cytb and COI are ENORMOUS, and absolutely cannot reflect intraspecific genetic variation. The authors are reporting 3-10% distance in COI, where most valid species can be separated at the 3% level. The cytb differences are so large as to reflect saturation in mutations - you basically cannot get larger genetic distances than 18% or so, and levels that high almost always reflect completely different species. These results only validate the need to include all known vouchered specimens of H. mohnikei in the analysis, to better understand the clustering among the 100 or so available specimens in GenBank and the Barcode of Life databases.

Response: Post-sequencing of remaining 3 Goa specimens for COI and Cyt b genes (now, total four) and aligning them with all vouchered downloaded H. mohnikei COI and Cyt b sequences from GenBank, the results of phylogenetic analysis has improved greatly. The revised manuscript has addressed most of the the apprehensions, particularly on the genetic distance raised by the Reviewer. The manuscript has been now checked and verified by Grammarly software for English language.

Comment: I recommend the authors shorten their paper to a scientific note format and publish this work in a more specialized journal such as those listed above. By publishing the sequences and placing them in the public record, they will have done a great service to adding important information regarding the continuing mystery of seahorse taxonomy and distributions, for which they will be acknowledged.

Response: We thank the Reviewer for this suggestion. Considering the sighting of H. mohnikei along the west coast of India has biogeographic and conservation significance, the manuscript attempts to address the probable reasons for its occurrence and range expansion. We wanted the manuscript to be quite different from routine Scientific Notes merely reporting the occurrence of this highly migratory small seahorse species. We hope this manuscript would provide new information and deeper insights which may be helpful in addressing the continuing mystery of seahorse taxonomy and distributions.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(54.7KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0220420.r003

Decision Letter 1

Rui Rosa

27 Feb 2020

PONE-D-19-19415R1

PLOS ONE

Dear Mr Rayadurga,

We would appreciate receiving your revised manuscript by Apr 12 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Rui Rosa

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #1: My previous comments have all been answered. I still have 2 minor edits, please see attached word file.

Reviewer #2: (No Response)

Reviewer #3: The authors have substantially improved the manuscript based on my previous suggestions. However, there is still a substantial amount of wordsmithing that is needed to make this manuscript publishable.

In particular, there is some confusion around active and passive dispersal (a one-time event) vs migration (which usually happens seasonally). I suggest the authors have a thorough read-through to ensure these terms are differentiated appropriately throughout the text, and particularly in the discussion and conclusions.

Please see the attached pdf with my edits and comments for suggested changes.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes: Riley A. Pollom

Attachment

Submitted filename: 2nd review.docx

Click here for additional data file.^{(12.3KB, docx)}

Attachment

Submitted filename: PONE-D-19-19415_Review2Reviewer3.pdf

Click here for additional data file.^{(3.8MB, pdf)}

PLoS One. 2020 Mar 24;15(3):e0220420. doi: 10.1371/journal.pone.0220420.r004

Author response to Decision Letter 1

2 Mar 2020

Response to Comments/suggestions made by the Reviewers

Manuscript ID number: PONE-D-19-19415R1

Authors: Sushant Sanaye, Rakhee Khandeparker, Rayadurga Anantha Sreepada, Mamatha Singanahalli Shivaramu, Harshada Kankonkar, Jayu Narvekar, Mukund Gauthankar

We are thankful for the reviewers for their constructive criticisms/suggestions on the revised version of the manuscript and their inputs have substantially improved the quality of the manuscript.

Below, we provide a point-by-point response as to how the feedback received from the Reviewers (#1 and #3) has been incorporated in the revised manuscript.

This manuscript is a resubmission of manuscript PONE-D-19-19415R1 with our response to the questions made by the reviewers. The Academic Editor handling this manuscript is Dr. Rui Rosa

Reviewer #1:

Reviewer #1: My previous comments have all been answered. I still have 2 minor edits. Please see attached word file.

Great improvement! So much easier to read and follow!. Only 2 minor edits:

Response: We thank the Reviewer for the excellent review and the positive comments on the manuscript. Constructive suggestions provided by the Reviewer are appreciated.

Minor Edit # 1

Lines 61-64 please see reviewers (#1 & #3) comments: delete sentence line 61-62

Lines 62-64 either delete sentence or change sentence it is still awkward.

What you’re trying to say is that they are well camouflaged and rare and thus easily missed (not seen) by biologists/divers etc.

Response: As suggested by the Reviewer #1 and also by the Reviewer #3, the sentences, 61-64 have been modified in the revised manuscript as below:

However, these biological traits often also make them challenging for scientists to research and quantify. Due to their cryptic nature, their ability to camouflage and the sparse distribution, seahorses become almost unnoticeable and thus restricting the biologists for their identification in dense coastal marine habitats

Minor Edit # 2

Line 150= incidental catch = … landed as bycatch … is the correct word (eg. fish caught in nets/bags that was not intended)

Line 147 use the word bycatch throughout … incidentally caught as bycatch in bags …

Line 150 dead seahorses landed as bycatch …

Response: As suggested by the reviewer, the sentences under line numbers, 147-150 have been corrected as bycatch. However, there is a significant differences between countries between with regard to the interpretation of terms, bycatch’’ and ‘incidental catch’ exists. FAO’s explanatory notes on these terms can be found at the below link:

http://www.fao.org/3/y5936e/y5936e08.htm

Reviewer #3:

The authors have substantially improved the manuscript based on my previous suggestions. However, there is still a substantial amount of wordsmithing that is needed to make this manuscript publishable.

Please see the attached pdf with my edits and comments for suggested changes.

Comments: Corrections to the Title of the manuscript

Response: As suggested by the Reviewer, the title has been modified to 'Morphological and molecular evidence for first records and range extension of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

Response: We gratefully thank the Reviewer for excellent review with positive comments/suggestions on the manuscript. As suggested by the Reviewer, all the suggested edits indicated in the PDF have been incorporated in the revised manuscript.

Here, we provide following responses to the specific queries pointed out by the Reviewer.

Comment: Shifting & deletion of Lines 106-114

Response: These lines form the background and main purpose of undertaking the present study. Therefore these lines retained in order to have to a flow and continuity in the Discussion also.

Comment: Why only the winter season? It needs to be explained why this data was only collected over one season.

Response: The Indo-Pacific region encompasses the East Asian countries and Indian subcontinent comes under the influence of strong seasonal monsoon wind reversal and associated reversals in the surface currents. It is only during winter monsoon season, i.e. from November until February, the surface circulation in the north Indian Ocean including the Indo-Pacific region experiences currents pattern is from east to west which is shown in Fig. 4.

During summer monsoon season (June to September), the surface current in this region reverses and at this time of the year current flows from west to east. Although the prevailing currents during summer monsoon season was also examined but did not present as the circulation pattern during the summer monsoon cannot support a passive dispersal of marine fish species from east to west.

Due to lack of supportive genetic data from the coastal waters of India and from South East Asia region, the possibility of H. mohnikei originating in India and its dispersal to east was not considered in the present study. With the availability of genetic data from larger sample size and sequencing of mitochondrial DNA (mtDNA) gene, it may be possible to understand the evolutionary and biogeography of H. mohnikei in the Indo-Pacific region. This has been mentioned in the Conclusion section of the revised manuscript.

Now, the rationale for focusing on winter circulation has been added at the beginning of the sub-section Prevailing ocean circulation’ under the lines 260–268 in the revised manuscript.

Comment: were genetic comparisons also made with these species from that area?

Response: Phylogenetic trees constructed with COI and Cyt b genes of H. mohinkei with H. kuda and H. trimaculatus separated out. Genetic sequence data of H. kuda and H. trimaculatus in fact were included in the pre-revised manuscript. But were replaced with a new set of phylogenetic trees (comparing the vouchered specimens) as suggested by one of the Reviewers. Since the morphological features and meristic characters of Goa specimens matched with that of vouchered specimens of H. mohnikei, a detailed genetic analysis of Goa specimens was performed for species reconfirmation and genetic placement of Goa specimens.

Comment: Line Nos. 351-353: combine all accession numbers in a single set of brackets.

Response: GenBank accession Numbers refer to sequences of COI and Cyt b genes. Combining all the sequences into a single bracket would be confusing. Hence the status quo retained.

Comment: Figures 6 and 7 are too low-resolution and are not discernible

Response: The probable reason for reduction in the resolution may be due to reformatting issues. Converting PACE generated figures to PDF. New high resolution figures have been now uploaded along with the revised manuscript.

Comment: Lines, 509-511: It's not clear to me why the high density of prey items would lead to a prolonged planktonic phase. Please elaborate.

Lines, 517-519- again, why the prolonged planktonic phase?

Response: The sentence has been modified/restructured to convey the intended meaning. Further, the reasoning for extension of planktonic phase by juveniles of H. mohnikei has been provided in the revised manuscript.

Attachment

Submitted filename: Response to Reviewers comments.docx

Click here for additional data file.^{(25.2KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0220420.r005

Decision Letter 2

Rui Rosa

4 Mar 2020

Morphological and molecular evidence for first records and range extension of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

PONE-D-19-19415R2

Dear Dr. Rayadurga,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Rui Rosa

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0220420.r006

Acceptance letter

Rui Rosa

9 Mar 2020

PONE-D-19-19415R2

Morphological and molecular evidence for first records and range extension of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

Dear Dr. Rayadurga:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Rui Rosa

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Picture of H. mohnikei posted on social media.

Male specimen of Hippocampus mohnikei caught by gill net in the Chapora estuary, Goa, India.

(TIF)

Click here for additional data file.^{(1.2MB, tif)}

S1 Table. The COI and Cyt b gene sequences.

GenBank accession numbers and sources of the mitochondrial gene sequences (COI and Cyt b) of seahorse species used for construction of phylogenetic trees.

(DOC)

Click here for additional data file.^{(238.5KB, doc)}

S2 Table. The COI and Cyt b gene sequences.

GenBank accession numbers and sources of the mitochondrial gene sequences (COI and Cyt b) of seahorse species used for construction of phylogenetic trees.

(DOCX)

Click here for additional data file.^{(11.6KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(54.7KB, docx)}

Attachment

Submitted filename: 2nd review.docx

Click here for additional data file.^{(12.3KB, docx)}

Attachment

Submitted filename: PONE-D-19-19415_Review2Reviewer3.pdf

Click here for additional data file.^{(3.8MB, pdf)}

Attachment

Submitted filename: Response to Reviewers comments.docx

Click here for additional data file.^{(25.2KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0220420.ref001] 1.Sreepada RA, Desai UM, Naik S. The plight of Indian seahorses: Need for conservation and management. Curr Sci 2002; 82: 377–378. [Google Scholar]

[pone.0220420.ref002] 2.Foster SJ, Vincent ACJ. Life history and ecology of seahorses: implications for conservation and management. J Fish Biol 2004; 65: 1–61. [Google Scholar]

[pone.0220420.ref003] 3.Kuiter RH. Seahorses and Their Relatives. Aquatic Photographics, Seaford, Australia; 2009.

[pone.0220420.ref004] 4.Froese R, Pauly D. FishBase.www.fishbase.org. Downloaded on 10/2018.

[pone.0220420.ref005] 5.Harasti D, Martin-Smith K, Gladstone W. Ontogenetic and sex-based differences in habitat preferences and site fidelity of White’s seahorse Hippocampus whitei. J Fish Biol 2014; 85: 1413–1428. 10.1111/jfb.12492 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref006] 6.Hellyer C, Harasti D, Poore A. Manipulating artificial habitats to benefit seahorses in Sydney Harbour, Australia. Aquat Conserv Mar Fresh Ecosyst 2011; 21: 582–589. [Google Scholar]

[pone.0220420.ref007] 7.Short G, Harasti D, Hamilton H. Hippocampus whitei Bleeker, 1855, a senior synonym of the southern Queensland seahorse H. procerus Kuiter, 2001: molecular and morphological evidence (Teleostei, Syngnathidae). ZooKeys 2019; 824: 109–133. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0220420.ref008] 8.IUCN Seahorse, Pipefish and Stickleback Specialist Group (2019). https://www.iucn-seahorse.org (downloaded on 01/11/2019).

[pone.0220420.ref009] 9.Salin KR, Mohankumaran NC. Resources and biodiversity of seahorses and the need for their conservation in India. Aquacult Asia 2006; 10: 3–8. [Google Scholar]

[pone.0220420.ref010] 10.Murugan A, Dhanya S, Rajagopal S, Balasubramanian T. Seahorses and pipefishes of the Tamil Nadu coast. Curr Sci 2008; 95: 253–260. [Google Scholar]

[pone.0220420.ref011] 11.Thangaraj M, Lipton AP. Occurrence of the Japanese seahorse Hippocampus mohnikei Bleeker 1854 from the Palk Bay coast of southeastern India. J Fish Biol 2007; 70: 310–312. [Google Scholar]

[pone.0220420.ref012] 12.Krishnan TS, Kuiter RH, Patterson J. Occurrence of western Indian Ocean seahorse, Hippocampus borboniensis Dumeril, 1870, in the Gulf of Mannar, Southeastern India. Ind J Geo-Mar Sci 2011; 40: 642–644. [Google Scholar]

[pone.0220420.ref013] 13.Yogeshkumar JS, Geetha S. A new species of Hippocampus montebelloensis (Family: Syngnathidae) from the southeast coast of India. Int J Plant Anim Env Sci 2012; 2: 56–58. [Google Scholar]

[pone.0220420.ref014] 14.Subburaman S, Murugan A, Goutham S, Kaul R, Prem Jyothi PVR, Balasubramanian T. First distributional record of giraffe seahorse, Hippocampus camelopardalis Bianconi 1854 (Family Syngnathidae) from Gulf of Kachchh waters, north west coast of India. Indian J Geo-Mar Sci 2014; 43: 408–411. [Google Scholar]

[pone.0220420.ref015] 15.Lourie SA, Foster SJ, Cooper EWT, Vincent ACJ. A Guide to the Identification of Seahorses. Project Seahorse and TRAFFIC North America; 2004.

[pone.0220420.ref016] 16.Lourie SA, Pollam RA, Foster SJ. A global revision of the seahorses Hippocampus Rafinesque 1810 (Actinopterygii: Syngnathiformes): taxonomy and biogeography with recommendations for further research. Zootaxa 2016; 4146: 1–66. 10.11646/zootaxa.4146.1.1 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref017] 17.Lourie SA, Vincent ACJ, Hall HJ. Seahorses: an identification guide to the world’s species and their conservation. Project seahorse, London, UK; 1999. [Google Scholar]

[pone.0220420.ref018] 18.Silveira RB, Siccha-Ramirez R, Silva JRS, Oliveira C. Morphological and molecular evidence for the occurrence of three Hippocampus species (Teleostei: Syngnathidae) in Brazil. Zootaxa 2014; 3861: 317–332. 10.11646/zootaxa.3861.4.2 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref019] 19.Casey SP, Hall HJ, Stanley HF, Vincent ACJ. The origin and evolution of seahorses (genus Hippocampus): a phylogenetic study using the cytochrome b gene of mitochondrial DNA. Mol Phylogenet Evol 2004; 30: 261–272. 10.1016/j.ympev.2003.08.018 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref020] 20.Wang X, Han X, Zhang Y, Liu S, Lin Q. Phylogenetic analysis and genetic structure of the seahorse, Hippocampus fuscus from the Arabian and Red Sea based on mitochondrial DNA sequences. Mitochondrial DNA A 2019; 30: 165–171. [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref021] 21.Lourie SA, Green DM, Vincent ACJ. Dispersal, habitat differences and comparative phylogeography of South East Asian seahorses (Syngnathidae: Hippocampus). Mol Ecol 2005; 14: 1073–1094. 10.1111/j.1365-294X.2005.02464.x [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref022] 22.Teske PR, Hamilton H, Palsboll PJ, Choo CK, Gabr H, Lourie SA. et al. Molecular evidence for long-distance colonization in an Indo-Pacific seahorse lineage. Mar Ecol Prog Ser 2005; 286: 249–260. [Google Scholar]

[pone.0220420.ref023] 23.Boehm JT, Waldman J, Robinson JD, Hickerson MJ. Population genomics reveals seahorses (Hippocampus erectus) of the western mid-Atlantic coast to be residents rather than vagrants. PloS One 2015; 10: e0116219 10.1371/journal.pone.0116219. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0220420.ref024] 24.Saarman NP, Louie KD, Hamilton H. Genetic differentiation across eastern Pacific oceanographic barriers in the threatened seahorse Hippocampus ingens. Conserv Genet 2010; 11: 1989–2000. [Google Scholar]

[pone.0220420.ref025] 25.Lourie SA, Pritchard JC, Casey SP, Ky TS, Hall HJ. et al. The taxonomy of Vietnam’s exploited seahorses (family Syngnathidae). Biol J Linn Soc 1999; 66: 231–256. [Google Scholar]

[pone.0220420.ref026] 26.Woodall LC, Otero-Ferrer F, Correia M, Curtis JMR, Garrick Maidment N. et al. A synthesis of European seahorse taxonomy, population structure, and habitat use as a basis for assessment, monitoring and conservation. Mar Biol 2018; 165: 1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0220420.ref027] 27.Curtis JMR, Vincent ACJ. Life history of an unusual marine fish: survival, growth and movement patterns of Hippocampus guttulatus Cuvier 1829. J Fish Biol 2006; 68: 707–733. [Google Scholar]

[pone.0220420.ref028] 28.Caldwell I, Vincent ACJ. A sedentary fish on the move: effects of displacement on long-snouted seahorse (Hippocampus guttulatus Cuvier) movement and habitat use. Environ Biol Fish 2013; 96: 67–75. [Google Scholar]

[pone.0220420.ref029] 29.Correia M, Caldwell IR, Koldewey HJ, Andrade JP, Palma J. Seahorse (Hippocampinae) population fluctuations in the Ria Formosa Lagoon, south Portugal. J Fish Biol 2015; 87: 679–690. 10.1111/jfb.12748 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref030] 30.Luzzatto DC, Estalles ML, Diaz De Astarloa JM. Rafting seahorses: the presence of juvenile Hippocampus patagonicus in floating debris. J Fish Biol 2013; 83: 677–681. 10.1111/jfb.12196 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref031] 31.Han SY, Kim JK, Tashiro F, Kai Y, Yoo JT. Relative importance of ocean currents and fronts in population structures of marine fish: a lesson from the cryptic lineages of the Hippocampus mohnikei complex. Mar Biodiv 2019; 49: 263–275. [Google Scholar]

[pone.0220420.ref032] 32.Luzzatto DC, Pujol MG, Figueroa D, Diaz De Astarloa JM. The presence of the seahorse Hippocampus patagonicus in the deep waters: additional evidence of the dispersive capacity of the species. Mar Biodivers Rec 2014; 7: e71. [Google Scholar]

[pone.0220420.ref033] 33.Harasti D. Range extension and first occurrence of the thorny seahorse Hippocampus histrix in New South Wales, Australia. Mar. Biodivers Rec 2015; 8: 10.1017/S1755267215000263. [DOI] [Google Scholar]

[pone.0220420.ref034] 34.Harasti D. Southward range extension of the great seahorse (Hippocampus kelloggi Jordan and Snyder, 1901) in Australia. J Appl Ichthyol 2017; 1–3 10.1111/jai.13414. [DOI] [Google Scholar]

[pone.0220420.ref035] 35.Mahapatro D, Mishra RK, Panda S. Range extension of a vulnerable Sea horse Hippocampus fuscus (Actinopterygii: Syngnathidae) on the north-eastern Bay of Bengal coast. Mar Biodivers Rec 2017; 10:6 10.1186/s41200-017-0108-z [DOI] [Google Scholar]

[pone.0220420.ref036] 36.Wong NLWS The JC. Direct observation of drifting juvenile seahorse Hippocampus trimaculatus (Leach, 1814) beneath the offshore surface at Malacca Strait. Check List 2017; 13: 993–996. [Google Scholar]

[pone.0220420.ref037] 37.Aylesworth L, Lawson LM, Laksanawimol P, Ferber P, Loh TL. New records of the Japanese seahorse Hippocampus mohnikei in Southeast Asia lead to updates in range, habitat and threats. J Fish Biol 2016; 88: 1620–1630. 10.1111/jfb.12908 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref038] 38.Masuda H, Amaoka K, Araga C, Uyeno T, Yoshino T. The Fishes of the Japanese Archipelago. Tokyo: Tokai University Press; 1984. [Google Scholar]

[pone.0220420.ref039] 39.Kanou K, Kohno H. Early life history of a seahorse, Hippocampus mohnikei, in Tokyo Bay Japan. Ichthyol Res 2001; 48: 361–368. [Google Scholar]

[pone.0220420.ref040] 40.Suda Y, Inoue T, Nakamura M, Masuda N, Doi H, Murai T. Nearshore ichthyofauna in the intermediate sandy beach, Doigahama Beach, Yamaguchi Prefecture, Japan. J Nat Fish Univ 2004; 52: 11–29. [Google Scholar]

[pone.0220420.ref041] 41.Lim K. New Singapore record of the seahorse, Hippocampus mohnikei. Singapore Biodiver Rec 2013; 2013: 68–69. [Google Scholar]

[pone.0220420.ref042] 42.Laksanawimol P, Petpiroon S, Damrongphol P. Trade of seahorses, Hippocampus spp. (Actinopertygii: Syngnathiformes: Syngnathidae), on the East Coast of the Gulf of Thailand. Acta Ichthyol Piscata 2013; 3: 229–235. [Google Scholar]

[pone.0220420.ref043] 43.Chang CH, Jang-Liaw NH, Lin YS, Fang YC, Shao KT. Authenticating the use of dried seahorses in the traditional Chinese medicine market in Taiwan using molecular forensics. J Food Drug Analy 2013; 21: 310–316. [Google Scholar]

[pone.0220420.ref044] 44.Zhang Y, Pham NK, Zhang H, Lin J, Lin Q. Genetic variations in two seahorse species (Hippocampus mohnikei and Hippocampus trimaculatus): evidence for Middle Pleistocene population expansion. PloS One 2014; 9: e105494 10.1371/journal.pone.0105494 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0220420.ref045] 45.Pollom R. Hippocampus mohnikei. The IUCN Red List of Threatened Species 2017: 10.2305/IUCN.UK.20173.RLTS.T41005A54907304.en43. Downloaded on 10 November 2018. [DOI]

[pone.0220420.ref046] 46.Shetye SR, Gouveia AD, Singbal SY, Naik CG, Sundar D. et al. Propagation of tides in the Mandovi–Zuari estuarine network. Proc Indian Acad Sci (Earth Planet Sci) 1995; 104: 667–682. [Google Scholar]

[pone.0220420.ref047] 47.Qasim SZ, Sen Gupta R. Environmental characteristics of the Mandovi-Zuari estuarine system. Estuar Coast Shelf Sci 1981; 13: 557–578. [Google Scholar]

[pone.0220420.ref048] 48.Madhupratap M, Nair KNV, Gopalkrishnan TC, Haridas P, Nair KKC. et al. Arabian sea oceanography and fisheries of the west coast of India. Curr Sci 2001; 81: 355–361. [Google Scholar]

[pone.0220420.ref049] 49.Ansari ZA, Sreepada RA, Dalal SG, Ingole BS, Chatterji A. Environmental influences on the trawl catches in a bay-estuarine system of Goa, west coast of India. Estuar Coast Shelf Sci 2003; 56: 503–515. [Google Scholar]

[pone.0220420.ref050] 50.Ansari ZA, Chatterji A, Ingole BS, Sreepada RA, Rivonker CU. et al. Structure of inshore demersal fish community at Goa. Estuar Coast Shelf Sci 1995; 41: 593–610. [Google Scholar]

[pone.0220420.ref051] 51.Lourie S. Measuring seahorses. Project Seahorse Technical Report No.4, Version 1.0. Project Seahorse, Fisheries Centre, University of British Columbia; 2003.

[pone.0220420.ref052] 52.Zhang Y, Qin G, Wang X, Qiang L. A new species of seahorse (Teleostei: Syngnathidae) from the South China Sea. Zootaxa 2016; 4170: 384–392. 10.11646/zootaxa.4170.2.11 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref053] 53.Wibowo K, Tashiro S, Motomura H. Seahorses of the genus Hippocampus (Syngnathidae) from Kagoshima Prefecture, southern Japan, with a new record of H. mohnikei Bleeker, 1853. Nature of Kagoshima 2017; 43:71–76. [Google Scholar]

[pone.0220420.ref054] 54.Underwood AJ. Experiments in Ecology: their logical and interpretation using Analysis of Variance. Cambridge University Press; Cambridge, UK; 1997. [Google Scholar]

[pone.0220420.ref055] 55.Kumar R Singh PJ, Nagpure NS, Kushwaha B, Srivastava SK. et al. A non-invasive technique for rapid extraction of DNA from fish scales. Ind J Exp Biol 2007; 45: 992–997. [PubMed] [Google Scholar]

[pone.0220420.ref056] 56.Qin G, Zhang Y, Ho ALFC, Zhang Y, Lin Q. Seasonal distribution and reproductive strategy of seahorse. ICES J Mar Sci 2017; 74: 2170–2179. [Google Scholar]

[pone.0220420.ref057] 57.Lourie SA, Vincent ACJ. A marine fish follows Wallace’s line: the phylogeography of the three-spot seahorse (Hippocampus trimaculatus, Syngnathidae, Teleostei) in Southeast Asia. J Biogeogr 2004; 31: 1975–1985. [Google Scholar]

[pone.0220420.ref058] 58.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215: 403–410. 10.1016/S0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref059] 59.Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis, version 7.0 for bigger datasets. Mol Biol Evol 2016; 33: 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0220420.ref060] 60.Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980; 16: 111–120. 10.1007/bf01731581 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref061] 61.Wyrtki K. Physical oceanography of the southeast Asian waters. Scientific results of maritime investigations of the South China Sea and the Gulf of Thailand 1959–1961. Naga Report, 2. Scripps Institution of Oceanography, La Jolla, CA; 1961.

[pone.0220420.ref062] 62.Choi Y, Rho S, Park H, Kang D. Population characteristics of two seahorses, Hippocampus coronatus and Hippocampus mohnikei, around seagrass beds in the southern coastal waters of Korea. Ichthyol Res 2012; 59: 235–241. [Google Scholar]

[pone.0220420.ref063] 63.Kwak S, Huh S, Kim H. Feeding habits of Hippocampus mohnikei in an eelgrass (Zostera marina) bed. Korean J Ichthyol 2008; 20: 112–116. [Google Scholar]

[pone.0220420.ref064] 64.Panithanarak T, Karuwanjaroen R. A preliminary study of genetic differentiation in the Japanese seahorse (Hippocampus mohnikei) populations: a possibility of cryptic species. Burapha Sci J 2019; 24: 124–137. [Google Scholar]

[pone.0220420.ref065] 65.Hou F., Wen L, Peng C, Guo J. Identification of marine traditional Chinese medicine dried seahorses in the traditional Chinese medicine market using DNA barcoding. Mitochondrial DNA A 2018; 29(1):107–112. [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref066] 66.Otsuka Y, Suzuki H, Akagawa I. Occurrence, gonad morphology and maturity of Japanese seahorse Hippocampus mohnikei in Matsushima Bay, Japan. J School Mar Sci Tech Tokai Univ 2009; 7: 11–22. [Google Scholar]

[pone.0220420.ref067] 67.Wafar S. Ecology of mangroves along the estuaries of Goa; Ph. D. Thesis, Karnataka University, Dharward, India; 1987.

[pone.0220420.ref068] 68.Jagtap TG. Distribution of seagrasses along Indian coast. Aquac Bot 1991; 40: 379–386. [Google Scholar]

[pone.0220420.ref069] 69.Padmavati G, Goswami SC. Zooplankton ecology in the Mandovi-Zuari estuarine system of Goa, west coast of India. Ind J Mar Sci 1996; 25: 268–273. [Google Scholar]

[pone.0220420.ref070] 70.Dalal SG, Goswami SC. Temporal and ephemeral variations in copepod community in the estuaries of Mandovi and Zuari–west coast of India. J Plankton Res 2001; 23: 19–26. [Google Scholar]

[pone.0220420.ref071] 71.Das PB. Zooplankton assemblages in spatial stretches of a tropical estuary. Int J Res Appl Sci Engg Technol 2017; 5: 1789–1799. [Google Scholar]

[pone.0220420.ref072] 72.Qin G, Johnson C, Zhang Y, Zhang H, Yin J, Miller G. et al. Temperature-induced physiological stress and reproductive characteristics of the migratory seahorse Hippocampus erectus during a thermal stress simulation. Biol Open 2018; 25: 7(6).bio032888. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0220420.ref073] 73.Scales H. Advances in the ecology, biogeography and conservation of seahorses (genus Hippocampus). Prog Phys Geog 2010; 34: 443–458. [Google Scholar]

[pone.0220420.ref074] 74.Bohonak AJ. Dispersal, gene flow, and population structure. Q Rev Biol 1999; 74: 21–45. 10.1086/392950 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref075] 75.Palumbi SR. Genetic divergence, reproductive isolation, and marine speciation. Annu. Rev Ecol Evol S 1994; 25: 547–572. [Google Scholar]

[pone.0220420.ref076] 76.Shetye SR, Gouveia AD, Shenoi SSC, Michael GS, Sundar D, Almedia AM. et al. The coastal current off western India during the northeast monsoon. Deep-Sea Res 1991; 38: 1517–1529. [Google Scholar]

[pone.0220420.ref077] 77.Fleminger A. The Pleistocene equatorial barrier between the Indian and Pacific oceans and a likely cause for Wallace’s Line. In Pierrot-Bults AC, van der Spoel S, Zahuranec BJ, Johnson RK editors, Pelagic marine science. UNESCO Tech Pap Mar Sci 1986; 49: 84–97. [Google Scholar]

[pone.0220420.ref078] 78.Maree RC, Whitfield AK, Booth AJ. Effect of water temperature on the biogeography of South African estuarine fishes associated with the subtropical/warm temperate subtraction. S Afr J Sci 2000; 96: 184–188. [Google Scholar]

[pone.0220420.ref079] 79.Bowen BW, Bass AL, Rocha LA, Grant WS, Robertson DR. Phylogeography of the trumpetfishes (Aulostomus): ring species complex on a global scale. Evolution 2001; 55: 1029–1039. 10.1554/0014-3820(2001)055[1029:pottar]2.0.co;2 [DOI] [PubMed] [Google Scholar]

[pone.0220420.ref080] 80.Martin-Smith KM, Vincent ACJ. Seahorse declines in the Derwent estuary, Tasmania, in the absence of fishing pressure. Biol Conserv 2005; 123: 533–545. [Google Scholar]

[pone.0220420.ref081] 81.Shokri MR, Gladstone W, Jelbart J. The effectiveness of seahorses and pipefish (Pisces: Syngnathidae) as a flagship group to evaluate the conservation value of estuarine seagrass beds. Aquat Conserv 2009; 19: 588–595. [Google Scholar]

PERMALINK

Morphological and molecular evidence for first records and range extension of the Japanese seahorse, Hippocampus mohnikei (Bleeker 1853) in a bay-estuarine system of Goa, central west coast of India

Sushant V Sanaye

Rakhee Khandeparker

Rayadurga Anantha Sreepada

Mamatha S Shivaramu

Harshada Kankonkar

Jayu Narvekar

Mukund Gauthankar

Roles

Abstract

Introduction

Materials and methods

Collection site and seahorses

Fig 1. Sampling localities of H. mohnikei.

Fig 2. Collected seahorses from Goa.

Fig 3. Close-up view of H. mohnikei.

Morphological analysis

Statistical analysis

Molecular analysis: DNA extraction, PCR amplification and sequencing

Phylogenetic analysis

Prevailing ocean circulation

Fig 4. Oceanic circulation in Indo-Pacific region.

Results

Specimens examined

Morphological taxonomy

Table 1. Detailed morphology of H. mohnikei.

Comparative morphology

Table 2. Morphological comparison of seahorses.

Fig 5. PCA analysis scores.

Table 3. Comparison of morphological characters.

Phylogenetic analysis and genetic distance

Fig 6. Phylogenetic relationships of Goa specimens with other seahorse species based on COI gene sequences.

Fig 7. Phylogenetic relationships of Goa specimens with other seahorse species based on Cyt b gene sequences.

Table 4. Pair-wise genetic distance based on COI gene sequences.

Table 5. Pair-wise genetic distance based on Cyt b gene sequences.

Ocean circulation

Discussion

Fig 8. Reported sightings of H. mohnikei in Indo-Pacific region.

Conclusions

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Rui Rosa

Roles

Author response to Decision Letter 0

Decision Letter 1

Rui Rosa

Roles

Author response to Decision Letter 1

Decision Letter 2

Rui Rosa

Roles

Acceptance letter

Rui Rosa

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases