Effects of Different Concentrations of Reversine on Plasticity of Mesenchymal Stem Cells

Abstract

Dedifferentiation can be induced by small molecules. One of these small molecules used in this study in order to increase the plasticity of differentiation of stem cells was reversine. The objective of present study was to investigate the effect of different concentrations of reversine on the plasticity of ovine fetal bone-marrow mesenchymal stem cells (BM-MSCs). BM-MSCs were extracted from ovine fetal and cultured. Passaged-3 cells were evaluated for their differentiation potential into osteocytes and adipocytes cells. In the present study, BM-MSCs were culture plated in the presence of 0, 300, 600, 900 and 1200 nM of reversine. The number of viable cells was determined by MTT test after addition of different concentrations of reversine. Furthermore, expression of the nanog gene was evaluated. The culture without reversine was taken as the control group. Expression of nanog was analysed by immunocytochemistry. Multi-lineage differentiation showed that the BM-MSCs could be differentiated into adipose cells and osteocytes. Our results indicated that the addition of 1200 nM of reversine to medium significantly decreased overall proliferation compared to the other treatment groups (p > 0.05). Real-time PCR analysis showed that after addition of 600 nM of reversine significantly increased nanog expression compared to other treatments. All treatments received reversine were seen to be relative expression of nanog. Our findings confirm that low concentrations reversine increases the plasticity of ovine BM-MSCs.

Introduction

Dedifferentiation of complete differentiated cells to multi-potent progenitor cells gives a supreme potency to improve degenerative and incurable diseases by patient-specific stem cell therapy. There are four methods by which dedifferentiation of somatic cells is induced, including fusion of adult cells to embryonic stem cells (ESCs), somatic cell nuclear transfer (SCNT), and forced expression of certain genes [1–3]. However, each induction method has challenges that need to be overcome, such as teratoma formation, genetic mutations, ethical problems and technical issues. Small molecules can be a good alternative to solve these problems. Researchers have suggested several advantages for small molecules. Meanwhile can be noted benefits including nonimmunogenic, more cost-effective, and more easily synthesized, preserved, and standardized as well as they can be cell permeability. Moreover, their effects on inhibiting and activating the function of specific proteins are often reversible and can be finely tuned by varying their concentrations. This chemical reprogramming strategy has powerful potential for use in generating functionally desirable cell types for future clinical applications [4]. Pikir et al. [5] stated that, as a general rule, transdiferentiation of stem cell can be induced easily into several specific cell tissues by increasing potency of stem cell. To be a substitute, synthetic small molecule; reversine; synthesized by Shultz and Ding has been used for induction of dedifferentiation in complete differentiated cells, such as fibroblast and C2C12 cell [6]. In several studies, the researchers worked with different concentrations of reversine in order to increase dedifferentiation of somatic cells or multi-potent stem cells. It seems that the reaction of different cells in reversine is varied. In the study of Conforti et al. [7], low concentration (50 nM) of reversine increased the plasticity and multi-lineage differentiation (skeletal muscles, osteocytes and adipocytes) of bone-marrow mesenchymal stem cells (BM-MSCs) and adipose derived stem cells (ADSCs). In contrast, high concentration (5 µM) of reversine had detrimental effects on multi-lineage differentiation of BM-MSCs and ADSCs. However, the presence of high concentrations (5 µM) of reversine into the culture medium of bovine fibroblast increased the plasticity of these cells as it has been shown to re-differentiate into osteocytes, adipocytes, neurons and hepatocytes [8]. Piker et al. [5], was pre-treated rabbit BM-MSCs by the addition of reversine and subsequently treated with 5-aza-2-deoxycytidine toward cardiac differentiation. They have detected an increased level of the expression of cardiomyocytes progenitor cell markers, but the timing and dosage of specific small molecules need to be optimized.

On the basis of our knowledge, there are a few studies that evaluate the effects of reversine on ruminant BM-MSCs plasticity. Therefore, in the present study, we tested the effects of different concentrations of reversine to the increase plasticity of ovine fetal BM-MSCs.

Materials and Methods

Except where otherwise indicated, all chemicals were obtained from Sigma-Aldrich (USA).

Fetal Ovine BM-MSCs Isolation and Culture

All procedures related to sample collection and preparation were approved by Ethics Committee of National Institute of Genetic Engineering and Biotechnology under code number IR.NIGEB.EC.1397.8.1.F. Animals (ewes) were slaughtered at the rock slaughter house using standard protocol supervised by a veterinarian officer present in abattoir. We obtained only fetuses from slaughtered ewes that were accidentally pregnant. Ovine 30–35 day fetuses were collected and transported to laboratory in Dulbecco’s Phosphate-Buffered Saline (DPBS) on ice. Femurs and tibias from ovine fetuses were dissected and bone marrow flushed with a 21-gauge needle and syringe containing Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham (DMEM/F12) medium supplemented with 100 IU/ml penicillin, 100 μg/ml streptomycin. BM-MSCs are present in the nucleated cell fraction of bone-marrow. In order to isolate of BM-MSCs, the bone marrow aspiration sample was carefully layered on top of equal volume of ficoll and then centrifuged at 1900×g for 30 min at room temperature. Cloudy layer was collected into a new tube and washed twice with DPBS. The cells were resuspended, counted and plated at 10⁶ cells/cm² in T25 flask with basal medium consisting of DMEM/F12 medium supplemented with 5% fetal bovine serum (FBS), 2 mM l-glutamine and 1% streptomycin/penicillin. For media change, the plates were washed with DPBS in order to remove non-adhered cells and the medium was replaced [9].

Multi-lineage Cell Differentiation

Three passages of BM-MSCs were adjusted to a concentration of 2 × 10⁴ cells/cm² in 4-well plates and cultured under osteogenic conditions for 3 weeks. Differentiation medium was as followes: DMEM supplemented with 10% FBS, 50 mg/ml dexamethasone, 10 nM ascorbic 2-phosphate and 10 mM β-glycerol phosphate. The cells were fixed with 4% paraformaldehyde for 15 min and stained with 2% Alizarin Red S for 10 min [9].

For adipogenic differentiation, the cells were first grown to 100% confluency and then incubated for 3 days in an induction medium consisting of DMEM medium supplemented with 50 μg/ml ascorbic acid 3-phosphate, 100 nM dexamethasone and 50 μg/ml indomethacin. The cells were incubated in the induction and maintenance media for 3 weeks. The cells were fixed with 4% paraformaldehyde for 15 min at room temperature and stained with 0.3% Oil Red O [9].

Flow Cytometric Analysis

Passaged-3 cells were detached from the flask by using trypsin/EDTA then; single cell suspension was prepared in cold DPBS. The cells at a concentration of 1 × 10⁶ cells/ml were labeled with the mouse anti human antibodies conjugated with fluorescein isothiocyanate (FITC): CD44 and CD34 FITC conjugate. The negative control used in this evaluation was Isotype-matched antibody (mouse anti-human IgG). Subsequently, the mixture was analyzed by flow-cytometry (partec Cy-Flow) and assayed by FloMax software [10].

MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) Assay

Passaged-3 cells were plated at 10⁴ cells per wells in 96-well culture plate. One day after culture initiation, the medium was changed with fresh medium containing various concentrations of reversine (300, 600, 900 and 1200 nM). The culture without reversine was taken as the control group. After 24 h, the cultures plates were examined for cell viability using MTT assay. MTT is an assay that is based on the ability of live cells to reduce a tetrazolium-based compound to a purplish formazan product. In brief, the cultures were washed with PBS and treated with the MTT solution (5 mg/ml in PBS), after 4 h incubation at 37 °C, medium and MTT solution was removed and 0.1 ml Dimethyl sulfoxide (DMSO) was added to dissolve the formazan precipitate. The absorbance of the supernatant was read with a microplate reader at 540 nm. Cell number was determined through a standard curve [10].

Real-Time PCR

Total RNA was extracted with AccuZol (Bioneer) from the experimental groups. Reverse transcription was performed by the Revert Aid First Strand cDNA Synthesis Kit (Fermentas). Gene specific primers were designed using the Oligo6 software, as listed in Table 1. Transcript level of the target genes was determined by real-time PCR. The reaction was prepared in volume of 20 µl using Maxima SYBR Green qPCR Master Mix kit (Fermentas) as the following thermal profile: 95 °C for 10 min, 40 cycles of 95 °C for 20 s, 57.8 °C for 30 s and 72 °C for 20 s. Data were standardized to the corresponding ovine GAPDH level. All reactions were carried out in triplicates and the fold changes were calculated by the 2^−∆∆CT method. The data was analyzed by SPSS using ANOVA test and indicated as the mean ± SD. The level of significance was assumed as p < 0.05.

Table 1.

The genes analysed by real-time PCR, the forward and reverse primers, their expected product sizes and annealing temperatures

PCR primers	Sequences	Annealing temperatures (°C)	Product size (BP)
GAPDH	For: ATCGTGGAGGGACTTATGACC Rev: CGCCAGTAGAAGCAGGGATG	57.8	130
Nanog	For: GCCGAGGAATAGCAATGGTGTG Rev: GCAGGTTTCCAGGAGAGTTCAC	57.8	104

Immunocytochemistry

Cells were fixed in 4% paraformaldehyde in PBS for 15 min. After rinsing with PBS, they were permeated with PBS + 0.2% Triton X-100, then blocked in blocking buffer (PBS + 1% BSA and 0.1% Triton X-100) for 30 min. Cells were incubated with the indicated primary antibody (Nanog; abcam) overnight at 4 °C, followed by three washes with PBS for 5 min and then incubation with FITC conjugated secondary antibody diluted with PBS at a ratio of 1:400 for 2 h at room temperature. Cells were rinsed three times with PBS, and nuclear staining with DAPI was carried out for 5-min incubation time. Cells were being observed and Photographed under an inverted fluorescence microscope (TE2000; Nikon) [9].

Results

Plastic-adherent fibroblast-like cells were observed under the phase contrast microscopy within the first days of culture of the nucleated cell fraction (Fig. 1) of a cloudy layer of cells obtained from a density gradient centrifugation. Non-adherent cells were removed by changing the medium after 24 h and the culture continued with a small portion of the attached cells until the confluency reached to 80% at day 5, which was ready for passage.

Fig. 1.

Passage-2 ovine fetal mesenchymal stem cells (magnification × 200)

Multi-lineage potential of the isolated ovine fetal BM-MSCs was evaluated by their differentiation into adipogenic and osteogenic lineages. For adipogenic differentiation, cells cultured under adipogenic conditions after 21 days presented cytoplasmic lipid droplets under light microscope. The contents of the droplets of lipids were confirmed by staining the cells with oil red O. The ability of ovine fetal BM-MSCs to differentiate into osteoblasts was also demonstrated by alizarin red staining. Nodule-like aggregations appeared in red color (Fig. 2).

Fig. 2.

Multi-lineage differentiation of ovine fetal BM-MSCs. a Adipogenic culture stained by oil red O; b osteogenic culture stained by alizarin red S (magnification × 100)

To characterize the ovine fetal BM-MSCs expression of two cell surface markers specific to mesenchymal and heamatopoietic cells was analyzed by flow-cytometry. Flow-cytometric analysis revealed that ovine fetal BM-MSCs were CD-44 positive, which considered as a marker for MSCs, and CD34-negative, which is a hematopoietic lineage marker CD34 (Fig. 3).

Fig. 3.

Flow cytometry characterization of ovine fetus BM-MSCs. Majority of the isolated cells have shown to express mesenchymal markers including CD90. Hematopoietic marker (CD34) were slightly expressed in the isolated cells

To determine cytotoxicity rates different concentrations of reversine, MTT analysis was performed. Figure 4 shows the viability of ovine fetal BM-MSCs treated with reversine for 24 h. At 300–900 nM reversine, there was no significant difference in viability with control group or untreated group. At the highest concentration (1200 nM), there was a significant decrease in BM-MSCs viability (p < 0.05).

Fig. 4.

Different concentrations of reversine effect on cell proliferation

The effects of different concentrations of reversine on expression of reprogramming factor; Nanog showed that after 48 h addition of 600 nM of reversine, Nanog expression was considerably higher compared to other treatments. Lower levels of nanog expression were observed in the group treated with 1200 nM reversine; however, it was significantly different from control group (Fig. 5).

Fig. 5.

Expression analysis of the Nanog gene in the experimental groups. Statistical significance was defined at p < 0.05 applying analysis of variance (ANOVA) using SPSS software

Immunocytochemical analysis was performed 48 h after performing treatments with different concentrations of reversine to examine the expression of reprogramming factor (nanog). We observed relative expression of nanog in their nuclei when ovine fetal BM-MSCs treated with different concentrations of reversine (Fig. 6).

Fig. 6.

Expression of Nanog in untreated (control) and treated of ovine fetal BM-MSCs with different concentrations of reversine

Discussion

It seems that in stem cell therapy, large animal species model, such as rabbits, goats, sheep, pigs, dogs and non-human primates are better predictors of responses in humans than small animal models, such as mice and rats. But for some specific usage, the best animal model will be needed to choose [11]. Recently, more researches have shown the capacity of mesenchymal stem cells (MSCs) to differentiate into osteocytes and adipose cells [12–17]. In our study the effect of different concentrations of reversine on proliferation of ovine BM-MSC culture was investigated and the best concentration was determined. According to our result, the presence of 1200 nM of reversine in ovine fetal BM-MSCs culture medium was resulted in the significant decrease propagation of the cells. Regarding to the other concentrations used in our study, no significant difference was observed with the control group. In the study of Saraiya et al. [18], incubation of annulus fibrosus cells for 96 h with different concentrations of reversine showed that concentrations more than 5 µM (namely: 10 and 20 µM) decreased proliferation. But concentrations between 0.05 and 5 µM did not show significant difference in viability between treated and untreated cells. They also observed increasing the incubation time of annulus fibrosus cells up to 96 h, only reversine at 50 nM did not show any reduction in cell proliferation. In addition, Conforti et al. [7], showed treatment of fibroblast cells, human BM-MSCs and ADSCs with 50 nM and 5 µM of reversine for three days reduced 25% and 32% viability of ADSCs and BM-MSCs, respectively, but did not effect on viability of fibroblast cells. Isolated cells from various species and strains showed different proliferation rate in response to reversine concentrations [19, 20]. May be different responses observed in our study was similar to the study of Saraiya et al. [18], related to the different type of cells used in two studies. It seems that different cell types have varying resistance when exposed to small molecules. As well, Mandal et al. [21] showed that high concentrations of reversine (10 µM) did not show any toxicity for NIH-3T3 fibroblast cells and also did not reduce cell proliferation. In our study, incubation of ovine fetal BM-MSCs with high concentration (1200 nM) after 24 h incubation showed decrease proliferation. It could have been possible using higher concentrations or incubation time for BM-MSCs by reversine might have revealed the harmful effects on viability and cellular proliferation. Researchers used several methods for dedifferentiation; including cell fusion, somatic cell nuclear transfer, and cell explanation. Each of these methods has disadvantages such as tumor formation, mutations in the genome, low efficiency, and ethical problem. One alternative for dedifferentiation of somatic cells is reversine. The exact mechanism of reversine on dedifferentiation or increasing the plasticity of complete differentiated cells has not been well known. In this study, incubation with different concentrations of reversine increased the plasticity of the ovine fetal BM-MSCs with increased expression of the pluripotency gene and protein “Nanog”. In the study by Ramkisoensing et al. hMSCs derived from embryonic stem cells did not express embryonic stem cell marker SSEA-4 and the pluripotency markers Oct-4 and Nanog, but h-ESCs expressed embryonic stem cell marker SSEA-4 and the pluripotency markers Oct-4 and Nanog [22]. Szepesi et al. showed that MSCs (isolated from adipose tissue, Wharton’s jelly, and periodontal ligament) did not express the pluripotency markers OCT4, SOX2, or Nanog [23]. Beltrami et al. have confirmed OCT4 and SOX2 and NANOG stem cell markers expression in mesenchymal stem cells [24] while Pierantozzi et al. have not detected OCT4 and NANOG in adult hMSCs [25]. One of the factors reducing the expression of the pluripotency markers is an increase number of cell passage. In Human, BM-MSCs mRNA expression of SoX2 and Nanog decreased as passage increased [26]. Also, age can affect the expression of these genes. In their study, Fafián-Labora et al. showed that the highest level of Nanog expression was achieved in mesenchymal stem cells extracted from young people [27]. BM-MSCs expressed detectable SOX2, MYC, KLF4 and NANOG even in the absence of exogenous stimuli whereas Ad-MSCs expressed MYC, KLF4, NANOG, LIN28 and REX1, as evidenced by RT-PCR [28]. After Immunocytochemical analysis, we did observe expressions of nanog in the nuclei of mesenchymal stem cells, but a weak expression of this protein was found in the nuclei of mesenchymal stem cells. If treatment of mesenchymal stem cells with reversine were prolonged, it would be possible to observe more increased expression of Nanog in the nuclei of mentioned cells. However, not many studies investigated expression of this gene and protein in stem cells after treatment with reversine. Additionally, finding on Nanog expression in mesenchymal stem cells are contradicting and different considerably. Few studies evaluated the expression of pluripotent factors when reversine was added in their culture medium [7, 8]. Similar results were obtained by Conforti et al. [7], and Li et al. [8]. In former study result indicated the presence of reversine in the culture medium increased the plasticity of hMSCs with high expression of Klf4 as one of the Pluripotent genes [7]. Furthermore, Li et al. [8], evaluated addition of reversine in culture medium of bovine fibroblasts showed the increased expression of Oct4 as one of the Pluripotent genes. More researchers after using reversine did not evaluate the expression of the pluripotency gene, but they evaluated re-differentiation of cells after treatment. The presence of 5 µM of reversine in the culture medium of C2C12 cells (the mouse myoblast cell line) reduced expression of Serum Response Factor (SRF), Myogenin and mir-133; one of the regulatory mi-RNA related to muscle development; these cells were re-differentiate into adipose and osteocytes cell when they were exposed to adipose and osteocyte differentiation medium [29]. They also showed that transfection of C2C12 myoblasts with miR-133a inhibitor consistent with reversine-treated C2C12 cells increased the expression of osteogenic and adipogenic genes [29]. Reversine increased the plasticity of C2C12 cells as well as re-differentiated into neuron cells. Analysis of the promoters of neuron specific genes showed that acetylation of H3K4 and H4K9 were increased as well as decreased trimethylation of H3K9 and increased trimethylation of H3K4 [30]. It is interesting to note that reversine increased the plasticity of macrophage cell line into mesenchymal progenitor-like cells [31]. Regarding to increase the plasticity of other cells; Park et al. [32], reported that addition of reversine in culture medium of 3T3-L1 cells or lineage-committed pre-adipocytes blocked differentiation into adipocyte cells and induced mesenchymal like cells into osteocytes cells differentiation. Several studies reported dedifferentiation of fibroblast cells after reversine treatment. For instance, Mandal et al. [28], showed when reversine was added to the culture medium of NIH-3T3 fibroblast cells, plasticity increased and these cells expressed mesenchymal surface antigen CD105 and CD73 and satellite cells markers (Pax7). They also reported that the plasticity of the fibroblast was increased and this could differentiate into osteocytes and adipose cells, reversine reduced the phosphorylation of ERK and increased the MAPK phosphatase 3. Pretreatment of fibroblast cells with reversine decreased specific fibroblast cells markers (HSP74). Also, co-culture of dedifferentiated GFP-fibroblast cells with C2C12 cells increased the expression of MHC and MyoD genes [33]. Some studies evaluated the role of reversine toward increase potency of mesenchymal stem cells [5, 7].

In conclusion, isolated ovine fetal BM-MSCs can be differentiated into osteocytes and adipose cells. Also, treatment of ovine fetal BM-MSCs with different concentrations of reversine increased plasticity of BM-MSCs with expression of Nanog as well as high concentration of reversine decreased cell proliferation. Further studies are needed to illustrate the state of the expression of pluripotency markers in MSCs treated with reversine.

Abbreviations

BM-MSCs

Bone-marrow mesenchymal stem cells

SCNT

Somatic cell nuclear transfer

DPBS

Dulbecco’s Phosphate-Buffered Saline

DMEM/F12

Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham

FBS

Fetal bovine serum

FITC

Fluorescein isothiocyanate

SRF

Serum Response Factor

MTT

(3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)

ADSCs

Adipose derived stem cells

MSCs

Mesenchymal stem cells

Funding

This study was funded by Council for Stem Cell Sciences and Technology (Grant Number 423).

Compliance with Ethical Standards

Conflict of interest

None of the authors have any conflicts of interest to declare.