Skip to main content
Wiley - PMC COVID-19 Collection logoLink to Wiley - PMC COVID-19 Collection
. 2006 Nov 27;580(30):6807–6812. doi: 10.1016/j.febslet.2006.11.046

Augmentation of chemokine production by severe acute respiratory syndrome coronavirus 3a/X1 and 7a/X4 proteins through NF‐κB activation

Noriyuki Kanzawa 1, Kazuo Nishigaki 1,✉, Takaya Hayashi 1, Yuichi Ishii 1, Souichi Furukawa 1, Ayako Niiro 1, Fumihiko Yasui 2, Michinori Kohara 2, Kouichi Morita 3, Kouji Matsushima 4, Mai Quynh Le 5, Takao Masuda 1, Mari Kannagi 1
PMCID: PMC7094718  PMID: 17141229

Abstract

Severe acute respiratory syndrome (SARS) is characterized by rapidly progressing respiratory failure resembling acute/adult respiratory distress syndrome (ARDS) associated with uncontrolled inflammatory responses. Here, we demonstrated that, among five accessory proteins of SARS coronavirus (SARS‐CoV) tested, 3a/X1 and 7a/X4 were capable of activating nuclear factor kappa B (NF‐κB) and c‐Jun N‐terminal kinase (JNK), and significantly enhanced interleukin 8 (IL‐8) promoter activity. Furthermore, 3a/X1 and 7a/X4 expression in A549 cells enhanced production of inflammatory chemokines that were known to be up‐regulated in SARS‐CoV infection. Our results suggest potential involvement of 3a/X1 and 7a/X4 proteins in the pathological inflammatory responses in SARS.

Keywords: SARS, ARDS, Inflammation, NF-κB, Transcription, IL-8, ARDS, acute/adult respiratory distress syndrome, EGFP, enhanced green fluorescent protein, ELISA, enzyme-linked immunosorbent assay, HA, hemagglutinin, IL-8, interleukin 8, JNK, Jun N-terminal kinase, NF-κB, nuclear factor kappa B, ORF, open reading frame, RANTES, regulated on activation normal T cell expressed and secreted, SARS-CoV, severe acute respiratory syndrome coronavirus

1. Introduction

Severe acute respiratory syndrome (SARS) is characterized by dyspnea with rapidly progressing changes on radiography in the later stages of the illness [1, 2]. Pathological findings of the lungs in SARS resemble those in acute/adult respiratory distress syndrome (ARDS) associated with various clinical conditions [3]. It has been proposed that ARDS is the outcome of an uncontrolled inflammatory response and that nuclear factor kappa B (NF‐κB) is a critical transcription factor involved in the pathogenesis of ARDS [4, 5].

SARS coronavirus (SARS‐CoV) genome contains open reading frames (ORFs) for several accessory proteins without sequence similarity to known coronavirus proteins. These include 3a (originally called X1 or ORF3), 3b (X2 or ORF4), 6 (X3 or ORF7), 7a (X4 or ORF8), and 8b (X5 or ORF11) [6, 7, 8]. Here, we investigated whether these accessory gene products of SARS‐CoV were able to induce inflammatory responses.

2. Materials and methods

2.1. Construction of lentivirus vectors expressing SARS‐CoV proteins

DNA fragments corresponding to the SARS‐CoV 3a/X1, 3b/X2, 6/X3, 7a/X4, and 8b/X5 genes (identical to the Urbani strain, GenBank accession number AY278741) were amplified by polymerase chain reaction (PCR) from cDNA from the Hanoi 01‐03 strain [9] of SARS–CoV using the specific primers 5′‐CACCATGGATTTGTTTATGAGA‐3′ (forward) and 5′‐CAAAGGCACGCTAGTAGTCGTCG (reverse) for 3a/X1; 5′‐CACCATGATGCCAACTACTTTGTTTGC‐3′ (forward) and 5′‐ACGTACCTGTTTCTTCCGAAACG‐3′ (reverse) for 3b/X2; 5′‐CACCATGTTTCATCTTGTTGACTTCC‐3′ (forward) and 5′‐TGGATAATCTAACTCCATAGGTTC‐3′ (reverse) for 6/X3; 5′‐CACCATGAAAATTATTCTCTTCCTG‐3′ (forward) and 5′‐TTCTGTCTTTCTCTTAATGGTGAAGC‐3′ (reverse) for 7a/X4; 5′‐CACCATGTGCTTGAAGATCCTTGTAAG‐3′ (forward) and 5′‐ATTTGTTCGTTTATTTAAAACAACAAG‐3′ (reverse) for 8b/X5. Each amplified fragment was inserted into the pENTR™/D‐TOPO vector (Invitrogen, Carlsbad, CA), and was subsequently transferred into a modified lentivirus expression vector (pLenti6/V5‐DEST, Invitrogen) containing an intron of human beta‐globin (Fig. 1 A) by site‐specific recombination using the Gateway Cloning System (Invitrogen). They were designated as pLenti/V5/X1, pLenti/V5/X2, pLenti/V5/X3, pLenti/V5/X4, and pLenti/V5/X5, respectively. An enhanced green fluorescent protein (EGFP)‐expressing vector (pLenti/V5/GFP) was also constructed as a control.

Figure 1.

figure image

Expression of SARS‐CoV accessory proteins. (A) Locations of SARS‐CoV 3a/X1 (X1), 3b/X2 (X2), 6/X3 (X3), 7a/X4 (X4), and 8b/X5 (X5) gene fragment amplified (gray squares) (top) and the construct of the resulting lentivirus vectors expressing SARS‐CoV genes (pLenti/V5/X1‐X5) (bottom) are schematically shown. (B) Western blot analysis of cell lysates from HEK293T cells transfected with the indicated SARS‐CoV gene expression plasmid (pLenti/V5/X1‐X5) was carried out using an anti‐V5 antibody. Arrows indicate predicted sizes of each product.

2.2. Plasmids

A reporter plasmid expressing luciferase (κB‐Luc) driven by five tandem NF‐κB binding sites derived from IL‐2 receptor α [10] was provided by Dr. Junichi Fujisawa (Kansai Medical School, Osaka, Japan). Reporter plasmids for the wild‐type (‐133‐Luc) and various mutant (AP‐1‐Luc, NF‐κB‐Luc, and NF‐IL6‐Luc) interleukin 8 (IL‐8) promoters [11] were provided by Dr. Naofumi Mukaida (Kanazawa University, Kanazawa, Japan). The HA‐tagged expression vectors HA‐JNK1 and HA‐JNK3 were provided by Dr. Hidenori Ichijo (The University of Tokyo, Tokyo, Japan). A control plasmid expressing renilla luciferase driven by the cytomegalovirus promoter (phRL‐CMV) was purchased from Promega (Madison, WI).

2.3. Western blotting

Cell lysates were prepared in lysis buffer (20 mM Tris–Hcl [pH 7.5], 150 mM NaCl, 10% glycerol, 1% Triton X‐100 and protease inhibitor cocktail [CALBIOCHEM, La Jolla, CA]), and proteins (20 μg) were separated by electrophoresis on a Tris–Glycine minigel (Invitrogen), transferred to nitrocellulose filters, and reacted with antibodies followed by visualization with the enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech, Piscataway, NJ). Densitometoric analysis was performed on scanned filters using ImageJ 1.37v software (http://rsb.info.nih.gov/ij/).

2.4. Antibodies

Anti‐V5 antibody (Invitrogen) and anti‐phospho Jun N‐terminal kinase (JNK) antibody (Cell Signaling Technology, Beverly, MA) were used for Western blotting. Immunoprecipitation was performed with anti‐HA (Roche) or anti‐V5 antibodies as previously described [12].

2.5. Reporter assays

Luciferase‐expressing various reporter plasmids (200 or 300 ng) together with renilla luciferase‐expressing phRL‐CMV (20 ng) were co‐transfected with vectors expressing SARS‐CoV genes into HEK293T or A549 cells (2 × 105 cells) using Lipofectamine2000 (Invitrogen) or Fugene6 (Roche), respectively. Luciferase and renilla luciferase activities were measured from cell lysates 30 or 40 h after transfection, using the Luciferase assay system (Promega) and the Renilla luciferase assay system (Promega), respectively.

2.6. Enzyme‐linked immunosorbent assay (ELISA)

The amounts of IL‐8 and regulated on activation normal T cell expressed and secreted (RANTES) in the culture supernatants of A549 cells were measured by Quantikine human IL‐8 and RANTES ELISA kits (R&D Systems), respectively, 48 h after transfection.

3. Results and discussion

3.1. Expression of SARS‐CoV accessory proteins

Lentivirus expression vectors for SARS‐CoV 3a/X1, 3b/X2, 6/X3, 7a/X4, and 8b/X5 genes were constructed as shown in Fig. 1A. These expression vectors were transfected into HEK293T cells, and expression of coding proteins with predicted sizes were confirmed by Western blotting (Fig. 1B). The expression level of 3b/X2 protein was always lower than the other SARS‐CoV proteins tested in this system. Anti‐V5 antibody detected two bands of 3a/X1 protein presumably due to a posttranslational modification as recently reported [13].

3.2. Activation of NF‐κB and JNK by SARS‐CoV accessory proteins

We first examined effects of SARS‐CoV genes on NF‐κB, the major transcription factors activated in ARDS [5], using a reporter plasmid expressing luciferase (κB‐Luc) [10]. As shown in Fig. 2 , expression of 3a/X1 and 7a/X4 significantly enhanced NF‐κB mediated transcription (9.1 and 3.5‐folds, respectively) in HEK293T cells (P < 0.05). The effects of 3b/X2, 6/X3 and 8b/X5 were not significant compared to the GFP control. We also determined the effect of SARS‐CoV genes on mitogen‐activated protein kinases that are also associated with chemokine production [14, 15]. HA‐tagged JNK1 expressed in HEK293T cells was markedly phosphorylated by 3a/X1and 7a/X4 but not by 3b/X2, 6/X3, or 8b/X5 (Fig. 3 A and B). 3a/X1 and 7a/X4 also activated JNK3 (Fig. 3C). There was no obvious activation of ERK and p38α by any SARS‐CoV genes tested (data not shown).

Figure 2.

figure image

Activation of NF‐κB by SARS‐CoV accessory gene expression. (A) The NF‐κB reporter plasmid (κB‐Luc) (closed bar) and phRL‐CMV (open bar) were cotransfected with pLenti/V5/X1‐X5 or control pLenti/V5/GFPvectors (X1‐5, C) into HEK293T cells, and luciferase activities were measured approximately 40 h after transfection. Data were expressed as means ± S.D. (n = 3) of the relative values against GFP controls. Similar results were obtained in three independent experiments. ∗ P < 0.05 vs GFP controls.

Figure 3.

figure image

Activation of JNK by SARS‐CoV accessory gene expression. (A) Lysates from HEK293T cells co‐transfected with HA‐JNK1 plasmid (3 μg) and pLenti/V5/X1‐ X5 or control pLenti/V5/GFP plasmid (X1‐5, C) (3 μg) were immunoprecipitated (IP) with mouse anti‐HA antibody and subjected to Western blot (WB) analysis with rabbit anti‐phospho JNK antibody. The filter was stripped and re‐stained with anti‐HA antibody. (B) A similar phosphorylation assay of HA‐JNK1 with different doses of pLenti/V5/X1, X4, or X5 (3 or 1 μg) plasmids. pCDNA3.1 (Invitrogen) plasmid was used to standardize transfection efficiency. (C) A phosphorylation assay on HEK293T cells that were co‐transfected with HA‐JNK3 plasmid (3 μg) and the indicated lentivirus vectors (3 μg). The values at the bottom end of each lane represent relative densities against control bands.

3.3. Augmentation of IL‐8 promoter activity by SARS‐CoV accessory proteins

We next examined whether SARS‐CoV proteins were capable of activating the promoter of IL‐8 that is a representative chemokine involved in ARDS [16] and regulated by NF‐κB and MAP kinases including JNK [17]. It has been shown that the IL‐8 level is elevated in the plasma of SARS patients [18]. When the reporter plasmids expressing luciferase under the control of the human wild‐type IL‐8 promoter (‐133‐Luc) [11] were co‐transfected in HEK293T cells, IL‐8 promoter activity was enormously augmented by expression of 3a/X1 (28.7‐fold) and 7a/X4 (13.2‐fold). The effects of 3b/X2, 6/X3, and 8b/X5 were not significant (Fig. 4 A). Augmentation of the IL‐8 promoter activity by 3a/X1 and 7a/X4 was abolished by a mutation at the NF‐κB site in the IL‐8 promoter, indicating that this effect was mainly mediated through NF‐κB (Fig. 4B).

Figure 4.

figure image

SARS‐CoV 3a/X1 and 7a/X4 augment IL‐8 promoter activity in HEK293T cells. (A) The IL‐8 promoter reporter plasmid (closed bar) and phRL‐CMV (open bar) was co‐transfected with pLenti/V5/X1‐X5 or control pLenti/V5/GFP plasmid (X1‐5, C) into HEK293T cells, and luciferase activities were measured. ∗ P < 0.05 vs GFP controls. (B) The wild‐type (WT) or mutant (ΔNF‐κB, ΔAP‐1, and ΔNF‐IL6) IL‐ 8 promoter reporter plasmids (closed bar) together with phRL‐CMV (open bar) were cotransfected with control or pLenti/V5/X1 plasmids (C, X1 or X4) into HEK293T cells. Luciferase activities were measured approximately 40 h after transfection. Data were expressed as means ± S.D. (n = 3) of the relative values against GFP controls.

3.4. Effects of SARS‐CoV accessory proteins in A549 cells

We next examined the effect of SARS‐CoV gene products in human lung cancer‐derived A549 cells [19]. The expression levels of SARS‐CoV proteins in transiently transfected A549 cells were lower than those in HEK293T cells, but were detectable following immunoprecipitation with anti‐V5 antibody (Fig. 5 A). In a reporter assay using A549 cells, 7a/X4 showed the greatest effect on the IL‐8 promoter activity (11.2‐fold) among tested (Fig. 5B). Although 3a/X1 showed a 2.2‐fold increase in IL‐8 promoter activity at an early time point, such as 24 h after transfection (data not shown), it was no longer significant 40 h after transfection in A549 cells. A mutation at the NF‐κB site affected 7a/X4‐mediated activation of the IL‐8 promoter (Fig. 5C), indicating that the effect of 7a/X4 in A549 cells was also mainly mediated through the NF‐κB site. A reporter assay using the κB‐Luc plasmid showed that 7a/X4 enhanced NF‐κB activity 9.3‐fold while 3a/X1 enhanced it 2.8‐fold in A549 cells (Fig. 5D).

Figure 5.

figure image

Effects of SARS‐CoV accessory gene expression on IL‐8 promoter and NF‐κB activities in A549 cells. (A) Cell lysates from A549 cells transfected with the indicated SARS‐CoV gene expression plasmids (pLenti/V5/X1‐X5) were immunoprecipitated (IP) with an anti‐V5 antibody and then subjected to Western blot (WB) analysis using the same antibody. Arrows indicate predicted sizes of each product. IgH and IgL, immunoglobulin heavy and light chains, respectively. (B) The wild‐type IL‐8 promoter reporter plasmid (closed bar) and phRL‐CMV (open bar) were cotransfected with pLenti/V5/X1‐X5 or control plasmids (X1‐5, C) into A549 cells, and luciferase activities were measured. (C) The wild‐type (WT) or mutant (ΔNF‐κB, ΔAP‐1, and ΔNF‐IL6) IL‐8 promoter reporter plasmids (closed bar) and phRL‐CMV (open bar) were co‐transfected with control or pLenti/V5/X4 plasmids (C, X4) into A549 cells, and luciferase activities were measured. (D) The κB‐Luc (closed bar) and phRL‐CMV (open bar) were co‐transfected with pLenti/V5/X1‐X5 or control plasmids (X1‐5, C) into A549 cells. Luciferase activities were measured approximately 40 h (B, C) and 30 h (D) after transfection. Data were expressed as the means ± S.D. (n = 3) of the relative values against GFP controls. ∗ P < 0.05 vs GFP controls.

Thus, 3a/X1 and 7a/X4 were capable of activating NF‐κB and IL‐8 promoter, but such effects were predominantly elicited by 3a/X1 in HEK293T cells and by 7a/X4 in A549 cells.

3.5. Enhancement of inflammatory chemokine production by SARS‐CoV 3a/X1, and 7a/X4

Finally, we examined whether 3a/X1, and 7a/X4 actually induced inflammatory chemokine production in A549 cells. As shown in Table 1 , although A549 cells spontaneously produced IL‐8, expression of 7a/X4 further increased the levels of IL‐8 production. 3a/X1 also enhanced IL‐8 production, but its statistical significance was variable (Table 1). Production of another chemokine RANTES, that is controlled at least by NF‐κB [20] and up‐regulated in SARS‐CoV‐infected cells [21], was significantly induced by 3a/X1 and 7a/X4 (Table 1).

Table 1.

Enhancement of IL‐8 and RANTES production by SARS‐CoV 3a/X1 and 7a/X4

Chemokines Experiment Chemokine production (pg/ml) in A549 cells expressing
GFP (control) 3a/X1 7a/X4
IL‐8 Exp. 1 685 ± 9 N.D. 1027 ± 111 ⁎
Exp. 2 591 ± 16 615 ± 13 719 ± 20 ⁎
Exp. 3 1345 ± 56 1767 ± 263 1976 ± 324 ⁎
Exp. 4 537 ± 50 708 ± 29 ⁎ 673 ± 61 ⁎
Exp. 5 481 ± 35 641 ± 38 ⁎ 616 ± 44 ⁎
RANTES Exp. 1 101 ± 5 N.D. 442 ± 57 ⁎
Exp. 2 80 ± 18 192 ± 11 ⁎ 362 ± 15 ⁎
Exp. 3 12 ± 6 120 ± 35 ⁎ 175 ± 54 ⁎

⁎: P &lt; 0.05 vs GFP controls.

ND, not determined.

Both 3a/X1 and 7a/X4 proteins are expressed in SARS‐CoV‐infected cells [22]. 3a/X1 protein is a cell membrane‐associated protein, potentially secreted and incorporated into the virion [23, 24, 25]. 7a/X4 protein is located in the cytoplasm [26]. Recent studies reported that over‐expression of 3a/X1 and 7a/X4 induced apoptosis of the cell [27, 28]. Our results indicated that these cell‐associated SARS‐CoV accessory gene products could activate NF‐κB and JNK, and might be strong candidates to induce pathological inflammatory responses in SARS.

Acknowledgement

We wish to thank Drs. Junichi Fujisawa (Kansai Medical School, Osaka, Japan), Naofumi Mukaida (Kanazawa University, Kanazawa, Japan), and Hidenori Ichijo (The University of Tokyo, Tokyo, Japan) for providing plasmids. This study was supported by the Special Coordination Funds for Promoting Science and Technology of Japan Science and Technology.

Kanzawa Noriyuki,Nishigaki Kazuo,Hayashi Takaya,Ishii Yuichi,Furukawa Souichi,Niiro Ayako,Yasui Fumihiko,Kohara Michinori,Morita Kouichi,Matsushima Kouji,Le Mai Quynh,Masuda Takao and Kannagi Mari(2006), Augmentation of chemokine production by severe acute respiratory syndrome coronavirus 3a/X1 and 7a/X4 proteins through NF-κB activation, FEBS Letters, 580, doi: 10.1016/j.febslet.2006.11.046

References

  • 1. Donnelly C.A., Ghani A.C., Leung G.M., Hedley A.J., Fraser C., Riley S., Abu-Raddad L.J., Ho L.M., Thach T.Q., Chau P., Chan K.P., Lam T.H., Tse L.Y., Tsang T., Liu S.H., Kong J.H., Lau E.M., Ferguson N.M., Anderson R.M., Epidemiological determinants of spread of causal agent of severe acute respiratory syndrome in Hong Kong. Lancet, 361, (2003), 1761– 1766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Peiris J.S., Yuen K.Y., Osterhaus A.D., Stohr K., The severe acute respiratory syndrome. New Engl. J. Med., 349, (2003), 2431– 2441. [DOI] [PubMed] [Google Scholar]
  • 3. Nicholls J.M., Poon L.L., Lee K.C., Ng W.F., Lai S.T., Leung C.Y., Chu C.M., Hui P.K., Mak K.L., Lim W., Yan K.W., Chan K.H., Tsang N.C., Guan Y., Yuen K.Y., Peiris J.S., Lung pathology of fatal severe acute respiratory syndrome. Lancet, 361, (2003), 1773– 1778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Bhatia M., Moochhala S., Role of inflammatory mediators in the pathophysiology of acute respiratory distress syndrome. J. Pathol., 202, (2004), 145– 156. [DOI] [PubMed] [Google Scholar]
  • 5. Fan J., Ye R.D., Malik A.B., Transcriptional mechanisms of acute lung injury. Am. J. Physiol. Lung Cell. Mol. Physiol., 281, (2001), L1037– L1050. [DOI] [PubMed] [Google Scholar]
  • 6. Rota P.A., Oberste M.S., Monroe S.S., Nix W.A., Campagnoli R., Icenogle J.P., Penaranda S., Bankamp B., Maher K., Chen M.H., Tong S., Tamin A., Lowe L., Frace M., DeRisi J.L., Chen Q., Wang D., Erdman D.D., Peret T.C., Burns C., Ksiazek T.G., Rollin P.E., Sanchez A., Liffick S., Holloway B., Limor J., McCaustland K., Olsen-Rasmussen M., Fouchier R., Gunther S., Osterhaus A.D., Drosten C., Pallansch M.A., Anderson L.J., Bellini W.J., Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science, 300, (2003), 1394– 1399. [DOI] [PubMed] [Google Scholar]
  • 7. Marra M.A., Jones S.J., Astell C.R., Holt R.A., Brooks-Wilson A., Butterfield Y.S., Khattra J., Asano J.K., Barber S.A., Chan S.Y., Cloutier A., Coughlin S.M., Freeman D., Girn N., Griffith O.L., Leach S.R., Mayo M., McDonald H., Montgomery S.B., Pandoh P.K., Petrescu A.S., Robertson A.G., Schein J.E., Siddiqui A., Smailus D.E., Stott J.M., Yang G.S., Plummer F., Andonov A., Artsob H., Bastien N., Bernard K., Booth T.F., Bowness D., Czub M., Drebot M., Fernando L., Flick R., Garbutt M., Gray M., Grolla A., Jones S., Feldmann H., Meyers A., Kabani A., Li Y., Normand S., Stroher U., Tipples G.A., Tyler S., Vogrig R., Ward D., Watson B., Brunham R.C., Krajden M., Petric M., Skowronski D.M., Upton C., Roper R.L., The Genome sequence of the SARS-associated coronavirus. Science, 300, (2003), 1399– 1404. [DOI] [PubMed] [Google Scholar]
  • 8. Snijder E.J., Bredenbeek P.J., Dobbe J.C., Thiel V., Ziebuhr J., Poon L.L., Guan Y., Rozanov M., Spaan W.J., Gorbalenya A.E., Unique and conserved features of genome and proteome of SARS-coronavirus, an early split-off from the coronavirus group 2 lineage. J. Mol. Biol., 331, (2003), 991– 1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Yu F., Le M.Q., Inoue S., Thai H.T., Hasebe F., Del Carmen Parquet M., Morita K., Evaluation of inapparent nosocomial severe acute respiratory syndrome coronavirus infection in Vietnam by use of highly specific recombinant truncated nucleocapsid protein-based enzyme-linked immunosorbent assay. Clin. Diagn. Lab. Immunol., 12, (2005), 848– 854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Hirai H., Suzuki T., Fujisawa J., Inoue J., Yoshida M., Tax protein of human T-cell leukemia virus type I binds to the ankyrin motifs of inhibitory factor kappa B and induces nuclear translocation of transcription factor NF-kappa B proteins for transcriptional activation. Proc. Natl. Acad. Sci. USA, 91, (1994), 3584– 3588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Murayama T., Ohara Y., Obuchi M., Khabar K.S., Higashi H., Mukaida N., Matsushima K., Human cytomegalovirus induces interleukin-8 production by a human monocytic cell line, THP-1, through acting concurrently on AP-1- and NFkappaB-binding sites of the interleukin-8 gene. J. Virol., 71, (1997), 5692– 5695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Ohashi T., Masuda M., Ruscetti S.K., Induction of sequence-specific DNA-binding factors by erythropoietin and the spleen focus-forming virus. Blood, 85, (1995), 1454– 1462. [PubMed] [Google Scholar]
  • 13. Oostra M., de Haan C.A., de Groot R.J., Rottier P.J., Glycosylation of the severe acute respiratory syndrome coronavirus triple-spanning membrane proteins 3a and M. J. Virol., 80, (2006), 2326– 2336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Manning A.M., Davis R.J., Targeting JNK for therapeutic benefit: from junk to gold?. Nat. Rev. Drug Discov., 2, (2003), 554– 565. [DOI] [PubMed] [Google Scholar]
  • 15. Ono K., Han J., The p38 signal transduction pathway: activation and function. Cell. Signal., 12, (2000), 1– 13. [DOI] [PubMed] [Google Scholar]
  • 16. Pease J.E., Sabroe I., The role of interleukin-8 and its receptors in inflammatory lung disease: implications for therapy. Am. J. Respir. Med., 1, (2002), 19– 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Hoffmann E., Dittrich-Breiholz O., Holtmann H., Kracht M., Multiple control of interleukin-8 gene expression. J. Leukoc. Biol., 72, (2002), 847– 855. [PubMed] [Google Scholar]
  • 18. Lee C.H., Chen R.F., Liu J.W., Yeh W.T., Chang J.C., Liu P.M., Eng H.L., Lin M.C., Yang K.D., Altered p38 mitogen-activated protein kinase expression in different leukocytes with increment of immunosuppressive mediators in patients with severe acute respiratory syndrome. J. Immunol., 172, (2004), 7841– 7847. [DOI] [PubMed] [Google Scholar]
  • 19. Giard D.J., Aaronson S.A., Todaro G.J., Arnstein P., Kersey J.H., Dosik H., Parks W.P., In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors. J. Natl. Cancer Inst., 51, (1973), 1417– 1423. [DOI] [PubMed] [Google Scholar]
  • 20. Nelson P.J., Kim H.T., Manning W.C., Goralski T.J., Krensky A.M., Genomic organization and transcriptional regulation of the RANTES chemokine gene. J. Immunol., 151, (1993), 2601– 2612. [PubMed] [Google Scholar]
  • 21. Law H.K., Cheung C.Y., Ng H.Y., Sia S.F., Chan Y.O., Luk W., Nicholls J.M., Peiris J.S., Lau Y.L., Chemokine up-regulation in SARS-coronavirus infected, monocyte-derived human dendritic cells. Blood, 106, (2005), 2366– 2374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Chan W.S., Wu C., Chow S.C., Cheung T., To K.F., Leung W.K., Chan P.K., Lee K.C., Ng H.K., Au D.M., Lo A.W., Coronaviral hypothetical and structural proteins were found in the intestinal surface enterocytes and pneumocytes of severe acute respiratory syndrome (SARS). Mod. Pathol., 18, (2005), 1432– 1439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Yuan X., Li J., Shan Y., Yang Z., Zhao Z., Chen B., Yao Z., Dong B., Wang S., Chen J., Cong Y., Subcellular localization and membrane association of SARS-CoV 3a protein. Virus Res., 109, (2005), 191– 202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Shen S., Lin P.S., Chao Y.C., Zhang A., Yang X., Lim S.G., Hong W., Tan Y.J., The severe acute respiratory syndrome coronavirus 3a is a novel structural protein. Biochem. Biophys. Res. Commun., 330, (2005), 286– 292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Ito N., Mossel E.C., Narayanan K., Popov V.L., Huang C., Inoue T., Peters C.J., Makino S., Severe acute respiratory syndrome coronavirus 3a protein is a viral structural protein. J. Virol., 79, (2005), 3182– 3186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Fielding B.C., Gunalan V., Tan T.H., Chou C.F., Shen S., Khan S., Lim S.G., Hong W., Tan Y.J., Severe acute respiratory syndrome coronavirus protein 7a interacts with hSGT. Biochem. Biophys. Res. Commun., 343, (2006), 1201– 1208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Law P.T., Wong C.H., Au T.C., Chuck C.P., Kong S.K., Chan P.K., To K.F., Lo A.W., Chan J.Y., Suen Y.K., Chan H.Y., Fung K.P., Waye M.M., Sung J.J., Lo Y.M., Tsui S.K., The 3a protein of severe acute respiratory syndrome-associated coronavirus induces apoptosis in Vero E6 cells. J. Gen. Virol., 86, (2005), 1921– 1930. [DOI] [PubMed] [Google Scholar]
  • 28. Tan Y.J., Fielding B.C., Goh P.Y., Shen S., Tan T.H., Lim S.G., Hong W., Overexpression of 7a, a protein specifically encoded by the severe acute respiratory syndrome coronavirus, induces apoptosis via a caspase-dependent pathway. J. Virol., 78, (2004), 14043– 14047. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Febs Letters are provided here courtesy of Wiley

RESOURCES