Abstract
Context
NOTCH signaling is activated in endometriotic lesions, but the exact mechanisms remains unclear. IL-6, which is increased in the peritoneal fluid of women with endometriosis, induces NOTCH1 through E-proteins including E2A and HEB in cancer.
Objective
To study the role of E-proteins in inducing NOTCH1 expression under the regulation of IL-6 in endometriosis.
Setting and Design
The expression of E-proteins and NOTCH1 was first investigated in endometrium of women with endometriosis and the baboon model of endometriosis. Regulation of E-proteins and NOTCH1 expression was examined after IL-6 stimulation and siRNA mediated inhibition of E2A or/and HEB in human endometriotic epithelial cells (12Z) in vitro, and subsequently following IL-6 treatment in the mouse model of endometriosis in vivo.
Results
E2A, HEB, and NOTCH1 were significantly upregulated in glandular epithelium (GE) of ectopic endometrium compared to eutopic endometrium in both women and the baboon model. IL-6 treatment upregulated the expression of NOTCH1 together with E2A and HEB in 12Z cells. Small interfering RNA inhibition of E2A and HEB or HEB alone decreased NOTCH1 expression. Binding efficiency of both E2A and HEB was significantly higher at the binding sites on the human NOTCH1 promoter after IL-6 treatment. Finally, IL-6 treatment resulted in a significantly increased number of endometriotic lesions along with increased expression of E2A, HEB, and NOTCH1 in GE of the lesions compared with the vehicle group in an endometriosis mouse model.
Conclusions
IL-6 induced NOTCH1 expression is mediated by E-proteins in the ectopic GE cells, which may promote endometriotic lesion development.
Keywords: interleukin-6, NOTCH1, E-proteins, p38MAPK, endometriosis
Endometriosis is an inflammatory and estrogen-dependent chronic gynecological disorder characterized by the presence of endometrial tissue outside the uterus and affects 10% to 15% of women of reproductive age (1, 2). Among patients with endometriosis, approximately 70% have chronic pelvic pain, and 20% to 50% suffer from infertility (3, 4). The pathogenesis of endometriosis is still unclear but the inflammatory activity of endometriotic lesions and the development of subsequent adhesions are the likely causes of the disease symptoms and progression (5). Hence, dissecting the molecular mechanism of lesion development is important for understanding the pathogenesis and improving effective therapies for endometriosis.
Endometriotic lesion development has been associated with cell proliferation, invasion, and inflammation (6). The NOTCH family of transmembrane receptors (NOTCH1-4) transduces extracellular signals and NOTCH signaling controls multiple cell fate decisions such as proliferation, survival, and immune modulation (7, 8). Emerging evidence suggests that there is aberrant expression of NOTCH1 in endometriotic lesions and the NOTCH1 signaling pathway is involved in endometriotic lesion development by regulating cellular functions (9–11). Ectopic endometrium from patients with endometriosis demonstrated hyperactivation of NOTCH signaling, which leads to fibrosis and inhibition of NOTCH cleavage can reduce fibrosis in ectopic endometrial stromal cells (9). In an immunocompetent mouse model of experimental endometriosis, loss of Klf9 expression promotes lesion establishment and survival and Klf9 null lesions showed increased levels of NOTCH intracellular domain (N1ICD) and transcript levels of the NOTCH ligand Jag2 compared with wild-type lesions (10). Furthermore, in a recent study (11), NOTCH signaling has been shown to control sprouting angiogenesis in endometriotic lesions in the dorsal skinfold chamber of C57BL/6 mice. Taken together, these findings suggest that the NOTCH signaling pathway actively promotes lesion development in endometriosis. However, the detailed molecular mechanisms contributing to the upregulation of NOTCH1 in the endometriotic lesions has not yet been elucidated.
The most widely accepted theory for the development of endometriosis is Sampson’s theory of retrograde menstruation, in which the exfoliated menstrual endometrial cells attach to the peritoneum, and subsequent cell proliferation and invasion into the underlying tissue results in endometriotic lesions (12). Retrograde menstruation is a physiologic process that occurs in most women of reproductive age. However, only 10% to 15% of women develop endometriosis which suggests that in this subset of women an immune dysfunction may prevent the clearance of menstrual debris and result in the development of endometriosis. During menstruation, immune cells that infiltrate the abdominal cavity secrete a large number of cytokines, including IL-6 (13–16). IL-6 is the leading member of a larger family of cytokines that use the gp130 receptor subunit for its activity (17, 18). It is elevated in the peritoneal fluid, endometriotic lesions, and serum from women with endometriosis (13–16). IL-6 can bind to its receptor to stimulate p38MAPK phosphorylation (19, 20) and stabilize E-proteins (21). E-proteins, which include, E-47 (collectively termed E2A) and HEB encode a class of basic helix-loop-helix transcription factors that regulate the expression of NOTCH1 in the thymus and during cancer development (22, 23).
Therefore, we hypothesized that IL-6 induces NOTCH1 expression by mediating the function of E-proteins, which in turn contributes to the development of endometriotic lesions.
Material and Methods
Reagents
Recombinant human IL-6 (catalog number: 206-IL-010) was obtained from R&D Systems, Inc. (Minneapolis, MN). Anisomycin (catalog number: #2222) was from Cell Signaling Technology, Inc (Danvers, MA). p38 MAPK inhibitor SB203580 (catalog number: S1076) was from Selleckchem (Houston, TX). Rabbit anti-human polyclonal antibodies against p38MAPK (#9212), p-p38 MAPK (#9211), and β-Actin (#4967) were purchased from Cell Signaling Technology, Inc. Rabbit anti-human polyclonal antibodies against E2A (ab69999), HEB (ab70746), and Histone H3 antibody (ab4729) were from Abcam (Cambridge, MA). Rabbit anti-human polyclonal antibody against NOTCH1 (sc6014R) was from Santa Cruz Biotechnology (Santa Cruz, CA). Normal rabbit IgG (#12–370) was from Millipore Sigma (Darmstadt, Germany). Small interfering RNA (siRNA) against E2A(S13889) and HEB(S13876) and the scrambled siRNAs were form Thermo Fisher Scientific (Waltham, MA).
Patient sample collection
The study was reviewed and approved by the institutional review boards of Michigan State University, Spectrum Health Medical System (Grand Rapids, MI), and Prisma Healthcare (Greenville, SC). Written informed consent was obtained from all human subjects. Human endometrial samples were obtained through the Michigan State University’s Center for Women’s Health Research Female Reproductive Tract Biorepository, and Prisma Healthcare. Participants were aged 18 to 45 years and had regular menstrual cycles. None of the women had an IUD or were on hormonal therapy for at least 3 months before the surgery. All women in the study were determined to be in the secretory phase based on their last menstrual period and confirmed by histological dating. Normal endometrium obtained from disease-free women were used as controls, paired ectopic, and eutopic endometrial tissues were obtained from women with revised American Society for Reproductive Medicine stages II to III of endometriosis based on laparoscopic staging with histologic confirmation.
Induction of experimental endometriosis and collection of baboon tissues
All experimental procedures were approved by the Institutional Animal Care and Use Committee of the University of Illinois, Chicago, and Michigan State University. Endometriosis was experimentally induced in 5 female baboons (Papio anubis) by intraperitoneal inoculation with menstrual tissue on 2 consecutive menstrual cycles, as previously described (24, 25). In the cycle before the induction of endometriosis, control eutopic endometrium (n = 5) was obtained at laparotomy on day 10 postovulation. Endometriosis was then induced in the same 5 animals by intraperitoneal inoculation of autologous menstrual tissue on 2 consecutive cycles. Following laparoscopic confirmation of endometriosis at the second inoculation, the animals (n = 5) were sampled at 3-month intervals postinoculation and euthanized at 15 months as required by the Institutional Animal Care and Use Committee, which permits a maximum of 4 invasive surgeries. At necropsy eutopic and ectopic endometrial tissues were collected and samples were snap-frozen in liquid nitrogen for RNA/protein extraction and fixed in 10% formalin for morphological and immunohistochemical analysis.
Induction of endometriosis in mice
Animals were maintained in a designated animal care facility according to the Michigan State University’s Institutional Guidelines for the care and use of laboratory animals. All animal procedures were approved by the Institutional Animal Care and Use Committee of Michigan State University. Eight-week-old mice were injected with estradiol (E2) (0.1μg/mouse) every 24 hours for 3 days, and then surgical induction of endometriosis was performed as previously described (26). Endometriotic lesions were established by inoculating endometrial tissue into the peritoneal cavity. To access the peritoneal cavity, mice underwent a laparotomy under anesthesia and a midventral incision (1 cm) was performed to expose the uterus and intestine. The left uterine horn was removed and placed in a petri dish containing sterile PBS. The uterine horn was opened longitudinally and then cut into small fragments. The fragments suspended in 0.5 mL sterile PBS were injected into the peritoneal cavity of the same mouse from which the uterus was taken for an autologous implantation, and the abdominal cavity was gently massaged to disperse the tissue. Following the induction of endometriosis, 5 μg IL-6 per injection or PBS (Veh) was injected IP twice per week for 2 weeks. After 2 weeks, mice were euthanized, the peritoneal cavity was opened, and endometriosis-like lesions were counted and removed under the dissection microscope. Endometriosis-like lesions and uterine tissues were fixed with 4% (vol/vol) paraformaldehyde for histological analysis.
Cell culture
Immortalized human ectopic endometriotic epithelial cells (12Z) (27) were cultured using DMEM/F-12 (Gibco, USA) supplemented with 10% charcoal-dextran treated fetal bovine serum (Gibco, USA), 1 × Pen/Strep (Gibco), and 1 × sodium pyruvate (Gibco) at 37°C under 5% CO2 and 95% air (27, 28). 12Z cells were plated at 3 × 105 cells per well in 6-well plates. The following day, the cells were treated with IL-6 (10 ng/mL) in 2% charcoal-dextran treated fetal bovine serum DMEM/F-12 media. RNA and protein were isolated after 0, 6, 12, and 24 hours. To inhibit p38 MAPK phosphorylation, 12Z cells were pretreated with a P38 MAPK inhibitor (SB203580, 10 μM) for 1 hour and then treated with IL-6. To knockdown E2A or HEB in 12Z cells, Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) was used to transfect cells either with 25 pmol of E2A siRNA, HEB siRNA, or with 25 pmol of nontargeting negative controls. Twenty-four hours following transfection, the cells underwent the IL-6 treatment and collection as described previously.
RNA isolation and real-time quantitative PCR
Total RNA was isolated from frozen tissue or cultured cells using TRIzol reagent (Life Technologies). RNA was reverse transcribed to cDNA using High Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA). Quantitative PCR (qPCR) was then performed to measure gene expression levels with SYBR® Green PCR Master Mix (Applied Biosystems) using the ViiA7 qPCR System (Applied Biosystems). RPL17 was used for normalization. Primer sequences used for qPCR are listed in Table 1.
Table 1.
Specific primers used for qPCR
| Gene Symbol | Primer Sequence | |
|---|---|---|
| hNOTCH1 | Forward | 5′-TCCAACTGCGACACCAACCC-3′ |
| Reverse | 5′-CCCAGCGAGCACTCATCCAC-3′ | |
| hE2A | Forward | 5′-TCATCCTGAACTTGGAGCAG-3′ |
| Reverse | 5′-CAACCACACCTGACACCTTT-3′ | |
| hHEB | Forward | 5′-TCTCCAGTTTCCATTGTTGG-3′ |
| Reverse | 5′-TTCTTGCTGCTGGTTGAAAA-3′ | |
| hRLP17 | Forward | 5′-ACGAAAAGCCACGAAGTATCTG -3′ |
| Reverse | 5′- GACCTTGTGTCCAGCCCCAT -3′ | |
| E2A ChIP | Forward | 5′-CACTGCGAGACCAACATCAA-3′ |
| Reverse | 5′-TCAGGCAGAAGCAGAGGTA-3′ | |
| HEB ChIP | Forward | 5′-CTCCCAAAGTGCTGGGATTAC-3′ |
| Reverse | 5′-TCAGACTCGCAGAGTCCTTTA-3′ |
Abbreviations: ChIP, chromatin immunoprecipitation; qPCR, quantitative PCR.
Immunohistochemistry
Tissues were fixed in buffered formalin or paraformaldehyde, embedded in paraffin, and sectioned at 6 μm thickness. Sections were then deparaffinized and rehydrated in a graded alcohol series. After antigen retrieval and hydrogen peroxide treatment (Antigen unmasking solution, H-3300, Vector Laboratories, Burlingame, CA), sections were blocked and then incubated with anti-NOTCH1, anti-E2A, anti-HEB, anti-p-p38MAPK, and anti-p38MAPK overnight at 4°C. The next day, sections were incubated with biotinylated secondary antibodies followed by horseradish peroxidase-conjugated streptavidin. Immunoreactivity was detected using the DAB substrate kit (Vector Laboratories, Burlingame, CA) and visualized as brown staining. Normal rabbit IgG was used as negative control. Digital H-score method was used to analyze the expression levels of those proteins as previously described (29).
Western blot
Cells were rinsed with ice-cold PBS on ice and the lysed with Pierce® RIPA lysis buffer (Thermo Fischer Scientific, Rockford, IL) supplemented with protease inhibitors and phosphatase inhibitors (Thermo Fischer Scientific). The protein concentration was measured using the Pierce® BCA protein assay kit (Thermo Fischer Scientific). Eight micrograms of protein were separated on 4% to 20% Tris-Glycine gels (Invitrogen) and transferred onto a polyvinylidene fluoride membranes (Millipore, Billerica, MA). The membranes were then incubated for 1 hour at room temperature in 5% BSA TBST buffer and then incubated overnight with primary antibodies against NOTCH1, E2A, HEB, p38MAPK, p-p38MAPK, or β-actin in blocking buffer overnight at 4°C. The next day, the membranes were incubated with the respective secondary antibodies labeled with horseradish peroxidase (Pierce®, Thermo Fischer Scientific) for 1 hour at room temperature. Immunocomplexes were visualized by enhanced chemiluminescence (GE Amersham, Piscataway, NJ). Protein bands was analyzed with Image J (National Institutes of Health). Protein levels were normalized to β-actin as the internal control.
Chromatin immunoprecipitation assay
Chromatin immunoprecipitation (ChIP) assays were conducted following the manufacturer’s protocol (Millipore Sigma). Briefly, to crosslink proteins to DNA, fresh formaldehyde (final concentration, 1%) was added to the culture medium and incubated for 10 minutes at room temperature. Cells were scraped and collected and then lysed successively with cell lysis buffer and nuclear lysis buffer containing protease inhibitors. Aliquots of cell lysates were sonicated to shear DNA into 0.2 to 1.0 kb fragments, and the cellular debris was removed. Chromatin aliquots were incubated with fully suspended protein A magnetic beads and 4 μg specific E2A antibody, 3μg HEB antibody, 4 μg Histone H3 antibody (positive control), or 5 μg normal rabbit IgG (negative control) overnight at 4°C with rotation. Beads were collected with the magnetic separator and then washed. Protein/DNA complexes were decrosslinked with proteinase K for 2 hours at 62°C, 10 minutes at 95°C, following which DNA was purified using spin columns and resuspended. The purified DNA was then subjected to qPCR with the indicated ChIP primers (Table 1).
Statistical analysis
Statistical analysis was performed using SPSS, version 18.0 (SPSS). All data were expressed as mean ± SD. The Student t test was used for comparisons between the 2 groups, and 1-way ANOVA with a post hoc test least-significant difference was used for multiple comparisons. P < 0.05 was considered statistically significant (2-tailed).
Results
E2A, HEB, and NOTCH1 expression are upregulated in the epithelial cells of ectopic endometrium of women and baboons with endometriosis
We first performed quantitative reverse transcriptase (qRT)-PCR to detect mRNA levels of E2A, HEB, and NOTCH1 in ectopic and eutopic endometrium from women with endometriosis (secretory phase). The E2A and NOTCH1 mRNA expression were significantly higher in ectopic endometrium than the paired eutopic endometrium (Fig. 1A). Correlation analyses confirmed that overexpression of NOTCH1 was correlated with a concurrent increase in E2A (R = 0.623, P = 0.006) and HEB (R = 0.629, P = 0.005), additional details are presented in the online repository (30). We observed that E2A and NOTCH1 mRNA expression were also significantly higher in ectopic endometrium compared with eutopic endometrium at 15 months after endometriosis induction in our baboon model of endometriosis (Fig. 1B). We further analyzed the protein localization by immunohistochemistry; E2A and HEB were expressed in the nucleus of epithelial and stromal cells of endometrium, whereas NOTCH1 localized in the membrane and cytoplasm of epithelial cells. A Digital H-score method was used to quantify the expression levels of these proteins. In endometrium from women (Fig. 1C), E2A and NOTCH1 were significantly decreased in the stroma of the eutopic endometrium compared with the controls. In the epithelium, however, E2A, HEB, and NOTCH1 were all elevated in the ectopic endometrium compared to eutopic endometrium. In the endometrium from baboons with induced endometriosis (Fig. 1D), E2A, HEB, and NOTCH1 were all decreased in the eutopic endometrium compared with the controls. In contrast, they were all increased in both epithelium and stroma of the ectopic endometrium compared with the eutopic endometrium. These results suggest a correlation between the upregulation of E-proteins and NOTCH1 in endometriotic lesions.
Figure 1.
E2A, HEB, and NOTCH1 expression in normal endometrium (control) and in paired eutopic (Eosis-Eu) and ectopic (Eosis-Ec) endometrium of women and baboons with endometriosis. (A, B) qRT-PCR analysis of E2A, HEB, and NOTCH1 mRNA expression levels in paired eutopic and ectopic endometrium of women (n = 9) and baboons (n = 5). (C, D) Immunohistochemical localization of E2A, HEB, and NOTCH1 on sections of normal endometrium and paired eutopic and ectopic endometrium from women (control, n = 5; Eosis, n = 9) and baboons (n = 5) with endometriosis. Brown shows positive staining. *P < 0.05; **P < 0.01. Scale bars, 25 µm.
IL-6 induces NOTCH1 expression by stimulating p38MAPK phosphorylation and upregulating E2A and HEB in 12Z cells
To confirm our in vivo data, we used 12Z cells for our in vitro studies. We first initiated a dose response and time course experiment in which we determined that 10 ng/mL of IL-6 had the best response, with additional details are in the online repository (30). Following IL-6 stimulation, the mRNA of E2A and HEB and NOTCH1 increased; E2A showed a significant difference at 12 and 24 hours compared with 0 hours, whereas HEB showed a significant difference only at 24 hours, NOTCH1 expression did not significantly change (Fig. 2A). In contrast, however, the protein levels of E2A, HEB, and NOTCH1 were all significantly increased at 12 and 24 hours (Fig. 2B, S3) (30). Because p38MAPK phosphorylation is important for the stability of E-proteins, we wanted to determine if a p38MAPK inhibitor (SB203580) could affect E-proteins and NOTCH1 expression. Following treatment of 12Z cells with SB203580 (10 μM), the mRNA level of E2A and NOTCH1 showed a significant decrease (P < 0.01 and P < 0.001; Fig. 2C). Phosphorylated p38MAPK, E2A, HEB, and NOTCH1 protein was also markedly decreased when p38MAPK phosphorylation was inhibited (Fig. 2D, S4) (30).
Figure 2.
Recombinant IL-6-induced p38-MAPK activation mediates elevated E2A, HEB, and NOTCH1 expression. (A) Quantitative reverse transcriptase (qRT)-PCR analyses if the expression of E2A, HEB, and NOTCH1 mRNA in 12Z cells in the presence of recombinant IL-6 (10 ng/mL) for 0, 6, 12, and 24 hours. (B) Western blot analysis of E2A, HEB, and NOTCH1 in 12Z cells in the presence of recombinant IL-6 (10 ng/mL) for 0, 6, 12, and 24 hours. (C) qRT-PCR analyses of the expression of E2A, HEB, and NOTCH1 mRNA in 12Z cells treated with either vehicle (0.1% BSA in PBS) or recombinant IL-6 (10 ng/mL) for 24 hours in the absence (only DMSO) or presence of SB203580 (10 μM dissolved in DMSO). (D) Western blot analysis of p-p38 MAPK, p38 MAPK, E2A, HEB, and NOTCH1 expression in 12Z cells treated with either vehicle alone or recombinant IL-6 for 24 hours in the absence or presence of SB203580. *P < 0.05; **P < 0.01; ***P < 0.001.
Inhibition of E2A and HEB reduces the expression of NOTCH1 in 12Z cells
Our in vivo and in vitro data demonstrate that the NOTCH1 expression was positively correlated with the expression of E2A and HEB. To explore if E-proteins directly regulate NOTCH1, we performed siRNA-based inhibition of E2A and HEB in 12Z cells in the presence or absence of IL-6. Scrambled siRNA was used as a control. E2A siRNA had significant inhibitory effect only at mRNA level; HEB siRNA had a significant inhibitory effect at both the mRNA and protein level (Fig. 3, S5) (30). When transfected with E2A siRNA alone there was no significant decrease of NOTCH1 in either the vehicle or IL-6-treated groups. However, cells transfected with HEB siRNA had reduced NOTCH1 expression at both the mRNA and protein levels in both groups. Further, when transfected with both E2A and HEB siRNA, NOTCH1 was dramatically decreased at the protein level compared with the control and HEB siRNA alone (Fig. 3, S5) (30) although it did not show significant changes at the mRNA level when compared to HEB siRNA alone. These data demonstrate that E-proteins can directly regulate NOTCH1 expression in 12Z cells.
Figure 3.
NOTCH1 expression in 12Z cells following E2A and HEB inhibition. (A) mRNA levels of E2A, HEB, and NOTCH1 following E2A, HEB, or combined E2A and HEB inhibition in 12Z cells, in the absence or presence of IL-6 (10 ng/mL) for 24 hours (n = 3). (B) Protein levels of E2A, HEB, and NOTCH1 following E2A inhibition, HEB inhibition or combined E2A and HEB inhibition in 12Z cells, in the absence or presence of IL-6 (10 ng/mL) for 24 hours. *P < 0.05; **P < 0.01; ***P < 0.001.
Binding efficiency of E2A and HEB on the human NOTCH1 promoter is enhanced following IL-6 stimulation
In our experiments, we found that the downregulation or inhibition of E-proteins decreased NOTCH1 expression in 12Z cells. Therefore, we wondered whether E2A and HEB bind to the NOTCH1 promoter and if their binding efficiency was affected by IL-6 stimulation. From the motif map analysis, we found both E2A and HEB have the predicted binding sites on the human NOTCH1 promoter region (Fig. 4A, B). 12Z cells were treated with IL-6 for 24 hours and were then harvested for the ChIP experiment. ChIP confirmed not only that both E2A and HEB bind to the promoter region of NOTCH1 at -2106_-2097bp and -269_-259bp but also showed that binding efficiency of E2A and HEB was enhanced following IL-6 stimulation (P < 0.05) (Fig. 4C, D). Together, the results suggested that E2A and HEB transcriptionally regulate NOTCH1 expression.
Figure 4.
Binding efficiency of E2A and HEB binding sites on the human NOTCH1 promoter is enhanced following IL-6 stimulation. (A, B) Predicted E2A and HEB binding site on the human NOTCH1 promoter. (C, D) Binding efficiency of E2A and HEB on the NOTCH1 promoter was detected by chromatin immunoprecipitation-quantitative PCR (n = 3). *P < 0.05.
IL-6 treatment increases endometriotic lesion development in the mouse model of endometriosis by inducing expression of E2A, HEB, and NOTCH1 in the ectopic epithelial cells
We have demonstrated that IL-6 increases E2A, HEB, and NOTCH1 in vivo and in vitro. We used the mouse model of endometriosis to further confirm our hypothesis. Following treatment with IL-6 (5 μg/injection; IP) for 2 weeks (Fig. 5A), the mice had a significant increase in the number of endometriotic lesions compared with the vehicle-treated group (Fig. 5B, C). This increase was associated with increased p38MAPK phosphorylation in these lesions (Fig.S6), with more details in the online repository (30). We further analyzed the protein expression in endometriotic lesions. E2A, HEB, and NOTCH1 were all increased in the epithelial cells of endometriotic lesions (P = 0.01; P = 0.05, and P = 0.01, respectively) (Fig. 5D), which is similar to what we observed in women and baboons with endometriosis.
Figure 5.
IL-6 promotes endometriotic lesions development in the mouse model of endometriosis by inducing expression of E2A, HEB, and NOTCH1 in the epithelial cells of endometriotic lesions. (A) Experimental schematic of induction of endometriosis and IL-6 treatment in the mouse model. (B) The lesions in a control mouse and a mouse treated with IL-6 (5 µg/injection twice pera week for 2 weeks). (C) The number of endometriotic lesions of IL-6 group was significantly higher than the vehicle group. (D) Immunohistochemical analysis of E2A, HEB, and NOTCH1 was performed on sections of endometriotic lesions from the mouse model of endometriosis (n = 4/group). Brown shows positive staining. *P < 0.05. Scale bars, 25 µm.
Discussion
Our study showed that NOTCH1 was upregulated and this was associated with increased E2A and HEB in the epithelium of endometriotic lesions from women, baboons, and the mouse model of endometriosis following IL-6 treatment. In 12Z cells, IL-6 stimulates p38MAPK phosphorylation and further regulates the expression of E2A and HEB. IL-6 promotes NOTCH1 expression by enhancing the binding efficiency of both E2A and HEB on the NOTCH1 promoter. Therefore, to the best of our knowledge, this is the first report that associates IL-6 with the upregulation of NOTCH1 in the endometriotic lesions (Fig. 6).
Figure 6.
Working model. In the epithelium of endometriotic lesions, IL-6 stimulates p38MAPK phosphorylation to stabilize E-proteins (E2A, HEB) transcripts; E-proteins then bind to the NOTCH1 promoter to induce the expression of NOTCH1.
Previous studies have demonstrated that hyperactivation of NOTCH1 signaling in endometriotic lesions and could promote lesion development by regulating fibroblasts and angiogenesis (9–11). The glandular epithelial cells have been identified to play a key role in the growth of endometriotic lesions during the early stages of lesion development (31). The NOTCH1 signaling pathway mediates cell-to-cell signaling and ultimately influences cell proliferation and survival (32). Thus, increased NOTCH1 in the epithelium of endometriotic lesions could enhance glandular proliferation and further promote lesion development. We propose that the increase in NOTCH1 in epithelial cells is transcriptionally regulated by E2A and HEB.
It is well accepted that endometriosis is an inflammatory disease (33). Previous studies have shown that IL-6 levels are significantly elevated in endometriotic lesions, peritoneal fluid, and in serum of women with endometriosis compared with the disease-free controls (13–16). One study reported that IL-6 upregulates E-proteins in nascent Th17 cells (34). Other studies demonstrated that IL-6 activated p38 MAPK phosphorylation is associated with the wound healing process and cancer progression (19, 20) and that phosphorylated p38MAPK could further enhance E2A mRNA stability (21). Our results showed that IL-6 induces E2A, HEB, and NOTCH1 expression in 12Z cells; the expression of E2A, HEB, and NOTCH1 were decreased after p38MAPK inhibitor treatment with or without IL-6. Similarly, in the mouse model of endometriosis, IL-6 could significantly induce more endometriotic lesions and this increase was associated with increased p38MAPK phosphorylation in those lesions compared with the controls. In addition, both E2A and NOTCH1 were upregulated in the epithelium of the same lesions. Our results from both the in vivo and in vitro studies suggest that IL-6 induces NOTCH1 expression by stimulating p38MAPK phosphorylation and further stabilizing E2A and HEB in the endometriotic epithelial cells, which promotes lesion development by binding to the NOTCH1 promoter, consistent with its proposed role in cell proliferation.
The mechanism by which E-proteins regulate NOTCH1 especially in the presence of IL-6 needs further evaluation. The expression of NOTCH1 was inhibited by E2A or HEB inhibition in 12Z cells in the presence and absence of IL-6 treatment. This suggests that IL-6 regulates the expression of NOTCH1 by stabilizing E-proteins to transcriptionally regulate NOTCH1. Yashiro-Ohtani et al (22) reported that E2A directly activates NOTCH1 transcription in the DN3 cells. In agreement with that study, we found that E2A and HEB could directly bind to the NOTCH1 promoter in 12Z cells. Our results further showed that IL-6 could increase the binding efficiency of both E2A and HEB on the NOTCH1 promoter. This suggests that the enhancement of binding efficiency of E-proteins on the NOTCH1 promoter is one of mechanisms by which IL-6 induces NOTCH1 expression in the endometriotic epithelium.
One observation was that E2A showed a decease only at mRNA level, but not at the protein level following transfection with E2A siRNA in 12Z cells. NOTCH1 expression was also not altered in response to E2A inhibition. A previous study reported that NOTCH1 could induce E2A ubiquitination and degradation in lymphocytes (35), suggesting a negative feedback loop between NOTCH1 and E2A which may be a mechanism to explain our in vitro findings. Moreover, inhibiting both E2A and HEB showed a more robust inhibition in NOTCH1 expression compared to inhibition of HEB alone, suggesting a synergistic effect of E2A and HEB in regulating NOTCH1 expression. It has been reported that E-proteins form E2A or HEB homodimers or E2A-HEB heterodimers depending on cell /tissue types (36). E2A-HEB heterodimers are the major dimer component in thymocytes that regulate bHLH proteins, whereas the E2A homodimer is more predominant in B cells (36). Thus, it is possible that the E2A-HEB heterodimer and HEB homodimer rather than E2A homodimer predominantly binds to the E-box elements of the NOTCH1 promoter in endometriotic epithelial cells. This potential mechanism is currently being explored.
In conclusion, our study suggests that IL-6-induced NOTCH1 expression is mediated by E-proteins in the ectopic glandular epithelial cells, which may promote the development of endometriotic lesions.
Acknowledgments
The authors thank Ms. Samantha Hrbek and Ms. Erin Vegter (both from Michigan State University, Grand Rapids, MI) for their excellent technical assistance.
Glossary
Abbreviations
- ChIP
chromatin immunoprecipitation
- E2
estradiol
- qPCR
quantitative PCR
- qRT
quantitative reverse transcriptase
- siRNA
small interfering RNA
Financial Support: This study was funded by National Institutes of Health Grant (R01 HD042280 to A.T.F.).
Additional Information
Disclosure Summary: The authors have nothing to disclose.
Data Availability: Supplemental data for this article are available in the Dryad Repository: https://doi.org/10.5061/dryad.1zcrjdfnh(30).
References and Notes
- 1. Bulun SE. Endometriosis. N Engl J Med. 2009;360(3):268–279. [DOI] [PubMed] [Google Scholar]
- 2. Giudice LC. Clinical practice. Endometriosis. N Engl J Med. 2010;362(25):2389–2398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Practice Committee of the American Society for Reproductive Medicine. Treatment of pelvic pain associated with endometriosis. Fertil Steril. 2008;90(5 Suppl):S260–S269. [DOI] [PubMed] [Google Scholar]
- 4. The Practice Committee of the American Society for Reproductive Medicine. Endometriosis and infertility. Fertil Steril. 2006;86(5 Suppl 1):S156–S160. [DOI] [PubMed] [Google Scholar]
- 5. Moradi M, Parker M, Sneddon A, Lopez V, Ellwood D. Impact of endometriosis on women’s lives: a qualitative study. BMC Womens Health. 2014;14:123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Vercellini P, Viganò P, Somigliana E, Fedele L. Endometriosis: pathogenesis and treatment. Nat Rev Endocrinol. 2014;10(5):261–275. [DOI] [PubMed] [Google Scholar]
- 7. High FA, Epstein JA. The multifaceted role of Notch in cardiac development and disease. Nat Rev Genet. 2008;9(1):49–61. [DOI] [PubMed] [Google Scholar]
- 8. Gentle ME, Rose A, Bugeon L, Dallman MJ. Noncanonical Notch signaling modulates cytokine responses of dendritic cells to inflammatory stimuli. J Immunol. 2012;189(3):1274–1284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. González-Foruria I, Santulli P, Chouzenoux S, Carmona F, Chapron C, Batteux F. Dysregulation of the ADAM17/Notch signalling pathways in endometriosis: from oxidative stress to fibrosis. Mol Hum Reprod. 2017;23(7):488–499. [DOI] [PubMed] [Google Scholar]
- 10. Heard ME, Simmons CD, Simmen FA, Simmen RC. Krüppel-like factor 9 deficiency in uterine endometrial cells promotes ectopic lesion establishment associated with activated notch and hedgehog signaling in a mouse model of endometriosis. Endocrinology. 2014;155(4):1532–1546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Körbel C, Gerstner MD, Menger MD, Laschke MW. Notch signaling controls sprouting angiogenesis of endometriotic lesions. Angiogenesis. 2018;21(1):37–46. [DOI] [PubMed] [Google Scholar]
- 12. Sampson JA. Peritoneal endometriosis due to the menstrual dissemination of endometrial tissue into the peritoneal cavity. Am J Obstet Gynecol. 1927;14(4):422–469. [Google Scholar]
- 13. Bergqvist A, Bruse C, Carlberg M, Carlström K. Interleukin 1beta, interleukin-6, and tumor necrosis factor-alpha in endometriotic tissue and in endometrium. Fertil Steril. 2001;75(3):489–495. [DOI] [PubMed] [Google Scholar]
- 14. Carmona F, Chapron C, Martínez-Zamora MÁ, et al. Ovarian endometrioma but not deep infiltrating endometriosis is associated with increased serum levels of interleukin-8 and interleukin-6. J Reprod Immunol. 2012;95(1-2):80–86. [DOI] [PubMed] [Google Scholar]
- 15. Volpato LK, Horewicz VV, Bobinski F, Martins DF, Piovezan AP. Annexin A1, FPR2/ALX, and inflammatory cytokine expression in peritoneal endometriosis. J Reprod Immunol. 2018;129:30–35. [DOI] [PubMed] [Google Scholar]
- 16. Jaeger-Lansky A, Schmidthaler K, Kuessel L, et al. Local and systemic levels of cytokines and danger signals in endometriosis-affected women. J Reprod Immunol. 2018;130:7–10. [DOI] [PubMed] [Google Scholar]
- 17. Heinrich PC, Behrmann I, Müller-Newen G, Schaper F, Graeve L. Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem J. 1998;334(Pt 2):297–314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Heinrich PC, Behrmann I, Haan S, Hermanns HM, Müller-Newen G, Schaper F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J. 2003;374(Pt 1):1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Linnskog R, Jönsson G, Axelsson L, Prasad CP, Andersson T. Interleukin-6 drives melanoma cell motility through p38α-MAPK-dependent up-regulation of WNT5A expression. Mol Oncol. 2014;8(8):1365–1378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Nishikai-Yan Shen T, Kanazawa S, Kado M, et al. Interleukin-6 stimulates Akt and p38 MAPK phosphorylation and fibroblast migration in non-diabetic but not diabetic mice. Plos One. 2017;12(5):e0178232. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Frasca D, Van der Put E, Landin AM, Gong D, Riley RL, Blomberg BB. RNA stability of the E2A-encoded transcription factor E47 is lower in splenic activated B cells from aged mice. J Immunol. 2005;175(10):6633–6644. [DOI] [PubMed] [Google Scholar]
- 22. Yashiro-Ohtani Y, He Y, Ohtani T, et al. Pre-TCR signaling inactivates Notch1 transcription by antagonizing E2A. Genes Dev. 2009;23(14):1665–1676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Miyazaki M, Miyazaki K, Chen K, et al. The E-Id protein axis specifies adaptive lymphoid cell identity and suppresses thymic innate lymphoid cell development. Immunity. 2017;46(5):818–834.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Fazleabas AT. A baboon model for inducing endometriosis. Methods Mol Med. 2006;121:95–99. [DOI] [PubMed] [Google Scholar]
- 25. Joshi NR, Miyadahira EH, Afshar Y, et al. Progesterone resistance in endometriosis is modulated by the altered expression of microRNA-29c and FKBP4. J Clin Endocrinol Metab. 2017;102(1):141–149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Kim TH, Yu Y, Luo L, Lydon JP, Jeong JW, Kim JJ. Activated AKT pathway promotes establishment of endometriosis. Endocrinology. 2014;155(5):1921–1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Zeitvogel A, Baumann R, Starzinski-Powitz A. Identification of an invasive, N-cadherin-expressing epithelial cell type in endometriosis using a new cell culture model. Am J Pathol. 2001;159(5):1839–1852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Banu SK, Lee J, Starzinski-Powitz A, Arosh JA. Gene expression profiles and functional characterization of human immortalized endometriotic epithelial and stromal cells. Fertil Steril. 2008;90(4):972–987. [DOI] [PubMed] [Google Scholar]
- 29. Fuhrich DG, Lessey BA, Savaris RF. Comparison of HSCORE assessment of endometrial beta3 integrin subunit expression with digital HSCORE using computerized image analysis (ImageJ). Anal Quant Cytopathol Histpathol. 2013;35(4): 210–216. [PMC free article] [PubMed] [Google Scholar]
- 30. Song Y, Su R, Joshi NR, Kim TH, Lessey BA, Jeong J-W, Fazleabas AT. Interleukin-6 (IL-6) activates the NOTCH1 signaling pathway through E-proteins in endometriotic lesions. Dryad Digital Repository 2020. Deposited 31 January 2020; https://doiorg/105061/dryad1zcrjdfnh. Accessed March 3, 2020. [DOI] [PMC free article] [PubMed]
- 31. Nisolle M, Casanas-Roux F, Donnez J. Early-stage endometriosis: adhesion and growth of human menstrual endometrium in nude mice. Fertil Steril. 2000;74(2):306–312. [DOI] [PubMed] [Google Scholar]
- 32. Afshar Y, Miele L, Fazleabas AT. Notch1 is regulated by chorionic gonadotropin and progesterone in endometrial stromal cells and modulates decidualization in primates. Endocrinology. 2012;153(6):2884–2896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. de Ziegler D, Borghese B, Chapron C. Endometriosis and infertility: pathophysiology and management. Lancet. 2010;376(9742):730–738. [DOI] [PubMed] [Google Scholar]
- 34. Zhang F, Fuss IJ, Yang Z, Strober W. Transcription of RORγt in developing Th17 cells is regulated by E-proteins. Mucosal Immunol. 2014;7(3):521–532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Nie L, Xu M, Vladimirova A, Sun XH. Notch-induced E2A ubiquitination and degradation are controlled by MAP kinase activities. Embo J. 2003;22(21):5780–5792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Takeuchi A, Yamasaki S, Takase K, et al. E2A and HEB activate the pre-TCR alpha promoter during immature T cell development. J Immunol. 2001;167(4):2157–2163. [DOI] [PubMed] [Google Scholar]