Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2020 Mar 15;2020:8475246. doi: 10.1155/2020/8475246

Sequence Analysis of the K13-Propeller Gene in Artemisinin Challenging Plasmodium falciparum Isolates from Malaria Endemic Areas of Odisha, India: A Molecular Surveillance Study

Ramakanta Rana 1, Manoranjan Ranjit 1, Madhusmita Bal 1, Hemant Kumar Khuntia 1, Sanghamitra Pati 1, Sri Krishna 2, Aparup Das 2,✉
PMCID: PMC7102476  PMID: 32258150

Abstract

Estimation of the spread and advancement of Plasmodium falciparum artemisinin-resistant parasites can be done by probing polymorphisms in the kelch (Pfk13) domain (a validated molecular marker). This study aimed to provide baseline information for future artemisinin surveillance by analyzing the k13-propeller domain in P. falciparum field isolates collected from 24 study areas in 14 malaria hot spots of Odisha (previously Orissa) during July 2018-January 2019. A total of 178 P. falciparum mono infections were assessed. An 849-base pair fragment encoding the Pfk13 propeller was amplified by nested polymerase chain reaction and sequenced in both directions (PCR). After DNA alignment with the 3D7 reference sequence, all samples were found to be wild type. It can be anticipated that malaria public health is not under direct threat in Odisha relating to ART resistance.

1. Introduction

Malaria infection by Plasmodium falciparum is creating a major public health burden all over the world particularly in tropical and subtropical areas. After the clinical failure of Chloroquine and Sulphadoxine–Pyrimethamine due to the occurrence of resistance in South East Asian region and many more countries, Artemisinin or Artemisinin Combination Therapy (ACT) has been recommended by the World Health Organizations (WHO) as the first-line treatment for uncomplicated P. falciparum malaria since 2006 [1]. Further continuous reuse of this single ACT resulting in P. falciparum-resistant alleles to Artemisinin or its derivatives has been reported for the first time in Western Cambodia and Thailand border [2, 3]; more interestingly, these resistant isolates might be carried by the parasites distributed rapidly across all SE Asian countries and also some parts of Africa [4, 5]. Both Artemisinin Combination Therapies (ACTs) and its derivatives along with partner drug resistance to P. falciparum isolates have threatened the current efforts for the reduction of the burden of infectious malaria all over the world [6, 7]

As per the WHO guidelines, the definition of the emerged resistant alleles across Thai and Cambodia border has been characterized by [8, 9] not only with reduced parasite clearance rate and increasing parasite clearance half-life or survived young ring stage parasites but also with the continuation of parasites on the third day of ACTs [1, 10–18]. These worldwide problems give rise to several approaches for the intense surveillance and detection of Artemisinin-resistant falciparum parasites including molecular marker evaluation [7, 19]. Genome-wide association studies of the P. falciparum whole genome sequencing data have identified a gene named PfKelch13-PF3D7-1343700 locating on chromosome 13 which encodes K13-propeller protein. The clinical ART failure has been emerged independently by the occurrence of nonsynonymous mutations or polymorphisms in the beta-propeller domain of that kelch protein mutation-expressed substituted AA sequence. But still the question remains unreciprocated why the alleles get transformed into a resistant form and whether they spread geographically to other adjacent countries. In Southeast Asia, Ariey and coworkers [20] have detected some alleles of the K13 propeller genes (C580Y, Y493H, R539T, and I543T) to display delayed parasite clearance. And the rest of the 9 candidate resistance mutations, i.e., P441L, F446I, G449A, N458Y, P553L, R561H, V568G, P574L, and A675V, also were detected by several group of researchers [4, 16, 20–23].

On one hand, in the year 2010, the Government of India launched the National Malaria Control Policy for the complete eradication of malaria infection starting from the rural level by providing LLINs and ACT kits to the village-level health workers ASHA; and the other hand, recent detection of the low frequency, candidate gene mutations of Kelch13 G625R, R539T in certain regions of North Eastern India has put in danger the eradication program. The recent researchers from India could not highlight completely whether these mutant alleles are able to repress the protein expression or causing direct clinical Artemisinin failure [9, 24, 25] remains a research question to be evaluated through molecular genotyping of K13 polymorphism.

The percentage of Plasmodium falciparum malaria has been drastically reduced in the year 2018 (81%) as compared with 2012 (93%) in Odisha, which previously remained one of the malaria-endemic state contributing to 40% (until 2017) of the total malaria burden of India [26]. The state geographically lies adjacent to the North-Eastern regions of India. The presence of the above low frequency and nonsynonymous candidate mutation of k13-resistant alleles, whether involved in clinical ART failure in this state or not, could not be ignored in the routine surveillance of falciparum malaria for the complete malaria elimination approach in Odisha, India.

2. Materials and Methods

2.1. Ethical Approval

All the methods of this molecular surveillance study was reviewed and approved by the Institutional Human Ethics Committee of ICMR-RMRC Bhubaneswar, Odisha, India, in accordance with relevant guidelines and regulations of Indian Council of Medical Research (ICMR). The informed consent was obtained from all individual patients prior to blood collection.

2.2. Study Area, Sample, and Demographic Data Collection

The study was carried out in both urban and remote areas of the different districts of Odisha, India. 16 sampling sites were selected from localities which were surrounded by dense forest and inaccessible areas, and 9 areas from urban areas as shown in Table 1. The present study was carried out from July 2018 to January 2019. Finger prick bloods of both asymptomatic and symptomatic patients were evaluated for Plasmodium falciparum malaria parasites by field-based rapid immunochromatographic test. Patients having Pf/Pv-positive cases were included in this study, and RDT-negative cases were excluded from this study. After obtaining the written informed consent, 1 ml of intravenous blood was collected from the patients ICT positive for Pf/Pv and stored in EDTA vial.

Table 1.

Total number of cases of IDT+ve, nested PCR+ve, PfKelch13 amplified, and 57 (89.06%) sequenced out of 64 P. falciparum isolates, by different sites and districts of Odisha, India.

SL no. District SL no. (area wise) Sites No. of samples IDT Pf/Pv PCR+ve Pf K13 amplified (n/%) Samples sequenced
Samples collected from tribal areas (1-16) All sequenced P. falciparum PfKelch13 isolates are of wild type, 89.06% (57 out of 64)
1 Keonjhar 1 Saria 2 2 2 2(100) 1
2 Kalahandi 2 Banigaon, Lanjigarh 35 35 23 19() 12
3 Kandhamal 3 Similipadar 31 30 22 18() 13
4 Kandhamal 4 Saperivatta 8 8 8 6() 3
5 Sundargarh 5 Sanajala, Baneigarh 1 1 1 1() 1
6 Sundargarh 6 Uparginia, Baneigarh 15 15 15 5() 4
7 Angul 7 Rugudidiha 1 1 1 1() 1
8 Angul 8 Bandhabhui 2 2 2 1() 1
9 Deogarh 9 Jalisuan, Barkot 5 3 2 1() 1
10 Raygada 10 Patalamba 12 12 8 7() 4
11 Raygada 11 Gartali 5 5 5 4() 3
12 Raygada 12 Kandsui 3 3 3 3() 2
13 Raygada 13 Parsali 2 2 2 2() 2
14 Ganjam 14 Uparabartala 5 4 1 1() 1
15 Malkangiri 15 Andrahal 2 2 2 2() 2
16 Malkangiri 16 Kanininga 1 1 1 1() 1
        130 129 107 76(71) 52
Samples collected from urban areas CHC, PHC, and dist HQ hospital (17-24)
17 Cuttack 17 SCB MCH 21 21 1 1() 1
18 Khurda 18 Capital Hospital 5 5 4 3() 2
19 Khurda 19 SUM Hospital 1 1 1 1() 1
20 Kandhamal 20 RKSSDH, Baliguda 5 2 2 1() 1
21 Kandhamal 21 Dist HQ hospital, Phulbani 1 1 1 1() 1
22 Bargarh 22 Paikmal PHC 5 5 4 3() 3
23 Bargarh 23 Dunguripali, Jharbandh 5 2 2 2() 1
24 Nuapada 24 Dist HQ hospital, Bukuramunda 5 4 4 3() 2
48 46 21 17(80) 12
Total 178 175 (98.31%) 128 (73.14%) 93 (72%) 64

2.3. Parasitic DNA Extraction and Genotyping

Parasitic DNA was isolated by using proteinase K and phenol method with slight modifications as described by Sambrook et al.'s molecular cloning and stored at -20°C until use [27].

2.4. Nested PCR Amplification

Species-specific nested PCR amplification was carried out to screen the Plasmodium falciparum malaria parasites using 18srRNA genes as described in [28, 29]. The PfKelch13 gene fragment was amplified by nested PCR protocols reported previously by F. Ariey et al. with modifications [20]. The quality and concentration of all the PCR products were analyzed by using 1.5% agarose gel electrophoresis following ethidium bromide stains. The details of nested PCR primers and conditions for the PfKelch13 conditions are shown in Table 2.

Table 2.

PCR thermo cycling conditions for primary and secondary PCR (for PF3D7_1343700).

Primer name PCR Sequence 5′-3′ Product Initial denaturation Denaturation Annealing Extension Final extension No. of cycles
K13_PCR-F 10 PCR CGGAGTGACCAAATCTGGGA 2097 bp 95-15 m 95-00.30 s 58-2.00 m 72-2.00 m 72-10.00 m 25
K13_PCR_R 10 PCR GGGAATCTGGTGGTAACAGC
K13_N1_F 20 PCR GCCAAGCTGCCATTCATTTG 849 bp 60-1.00 m 72-2.00 m 28
K13_N1_R 20 PCR GCCTTGTTGAAAGAAGCAGA

2.5. DNA Sequencing

Successful PCR products showing single band in gel were then subjected to PCR purification (using FastAP alkaline phosphatise and exonuclease I) and further processed for DNA sequencing by Sanger methods (an in-house facility of ICMR-NIRTH, Jabalpur) with 2x coverage (sequenced from both the forward and reverse directions). Briefly, the amplified fragments were sequenced using Big Dye Terminator cycle sequencing ready reaction version 3.1 and ABI Prism DNA sequence Analyzer3130 [17, 20]. For each isolate, sequence chromatograms were viewed carefully, and all the sequences from a single population were aligned (with the help of Gene Doc multiple Sequence Alignment Editor and shading utility version 2.7.000) alongside the reference Pfkelch13 sequence.

3. Results

During the study period, a total of 178 patients (aged 4 to 78 years) were enrolled and diagnosed with Plasmodium falciparum by RDT kit and molecular tests shown in Tables 1 and 3. 175 (98.31%) positive cases were detected by RDT and 128 (73.14%) were confirmed Plasmodium falciparum through nested PCR diagnosis, by using published primers (rPLU6, rPLU5 primary PCR, and rFAL1 and rFAL2 as nested primer for falciparum infections) [29]. 72% (93/128) of the K13-propeller gene was amplified by nested PCR method as described in [20] and the thermo cycling conditions shown in Table 2. 57 PfK13-propeller genes were successfully sequenced in the selected 64 samples. Samples that could not be amplified were excluded from sequencing; by using this approach, out of 64 monoinfected P. falciparum isolates, only 57 (89.96%) could be successfully sequenced for the 849 nucleotide base pair DNA fragment of the Pfk13 gene. After sequence alignment with the 3D7 reference sequence, all samples were found to be wild type. The nonavailability of novel K13 mutations (neither validated nor candidate) associated with ART resistance to malaria parasites suggested no risk for the Artemisinin Combination Therapy (ACT), in Odisha.

Table 3.

Distribution of P. falciparum isolates age wise, gender wise, and k13 sequencing results.

Age group Frequency of Pf cases % Pf cases in male K13 male Pf cases in female K13 female
0-9 36 28.12 27 20 9 5 K13 selected for sequencing no. 64 Propeller sequenced/results (no-wild type, 57 wild type)
10-19 26 20.31 12 8 14 5
20-29 13 10.15 5 5 8 6
30-39 9 7.03 4 4 5 4
40-49 24 18.75 17 12 7 5
50-59 14 10.93 7 7 7 6
60-69 5 3.9 2 2 3 3
70-79 1 0.78 0 0 1 1
Total 128 74 (57.8%) 58 54 (42.1%) 35

4. Discussions and Conclusion

Currently, ACT is the only WHO-recommended antimalarial drug to combat the severity of Plasmodium falciparum infection across the globe including Odisha, India. Not only is the emergence and spread of ART-resistant isolate in South East Asian regions a matter of concern but also the occurrence of low-frequency candidate mutations in the k13-propeller gene across certain regions of North-Eastern India could draw the state of Odisha's attention. Since there is no report of transformation of sensitive to resistant alleles reported, molecular evolutionary patter is not known yet in this area of Odisha.

Prior articles from India could not put emphasis on the geographical distribution of validated k13 mutant alleles [9], but the above presented mutations probably create the ACT regimen in high risk for the uncomplicated falciparum malaria in the study areas of Odisha. As Odisha is aiming to reduce malaria particularly Plasmodium falciparum infections completely in 2020 to become a malaria-free state, RDT kits and ACTs have been provided to the village-level ASHA workers under the joint action of National Health Mission-National Vector Borne Diseases (NHM-NVBDCP) [26, 27]. Unfortunately, there is no alternative to the current regimen ACT for the severe uncomplicated malaria and also no significant research has yet been done on K13-propeller polymorphism; hence, it is essential to monitor the efficacy of the Artemisinin derivative through molecular surveillance study in the selected areas of the state during the year 2018. Recent study aims to track the research questions raised for the surveillance of falciparum infections by the PCR-based sequencing analysis of Pfkelch13 gene propeller polymorphism.

None of the mutations in the k13 gene whether validated or candidate marker has originated from the current study. Furthermore, the nonoccurrence of resistant alleles in Odisha defines against the contention that the resistant alleles might be distributed in other geographically closer state(s) to Odisha. To the best of our knowledge, this is the first report of a study in Odisha, India, that investigates the efficacy of usual ART resistance through the detection of the Pfkelch13 gene propeller polymorphism study.

Though it may be interpreted from this study that no direct threat to the consequence of ART on the falciparum isolates in Odisha, more attention is required on account of the surveillance study for the complete elimination of malaria in Odisha. Field-based survey along with low-cost molecular diagnosis, genotyping of markers related to causing clinical failure of ART should be carried out along with a large number of sample sizes.

Acknowledgments

RKR thanks the Indian Council of Medical Research, New Delhi, for awarding Senior Research Fellowship (ICMR-SRF). RKR and MR thank the director of ICMR-RMRC, Bhubaneswar, for the constant encouragement and providing the necessary laboratory facilities during the first phase of the work. We are grateful to all patients and their families, who participated in this study. We thank Dr. Praveen Kumar Bharti (Scientist-E) ICMR-NIRTH for providing the necessary laboratory facilities during the sequencing work.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no conflicts of interest regarding the publication of this manuscript.

References

  • 1.World Health Organization. Guidelines for the Treatment of Malaria. 3rd edition. Geneva: World Health Organization; 2015. [Google Scholar]
  • 2.Daily J. P. K13-propeller mutations and malaria resistance. The New England Journal of Medicine. 2016;374(25):2492–2493. doi: 10.1056/NEJMe1604520. [DOI] [PubMed] [Google Scholar]
  • 3.Dondorp A. M., Nosten F., Yi P., et al. Artemisinin resistance inPlasmodium falciparumMalaria. New England Journal of Medicine. 2009;361(5):455–467. doi: 10.1056/NEJMoa0808859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ocan M., Akena D., Nsobya S., et al. K13-propeller gene polymorphisms in Plasmodium falciparum parasite population in malaria affected countries: a systematic review of prevalence and risk factors. Malaria Journal. 2019;18(1):1–17. doi: 10.1186/s12936-019-2701-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Haldar K., Bhattacharjee S., Safeukui I. Drug resistance in _Plasmodium_. Nature Reviews Microbiology. 2018;16(3):156–170. doi: 10.1038/nrmicro.2017.161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Miotto O., Almagro-Garcia J., Manske M., et al. Multiple populations of artemisinin-resistant Plasmodium falciparum in Cambodia, Nature genetics. 2013;45(6):648–655. doi: 10.1038/ng.2624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Thuy-Nhien N., Tuyen N. K., Tong N. T., et al. K13 propeller mutations in Plasmodium falciparum populations in regions of malaria endemicity in Vietnam from 2009 to 2016. Antimicrobial Agents and Chemotherapy. 2017;61(4):1–10. doi: 10.1128/AAC.01578-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.World Health Organization. Global Malaria Programme, status report on artemisinin resistance, and artemisinin based combination therapy efficacy. WHO; 2018. August, 2018, https://www.who.int/malaria/publications/atoz/artemisinin-resistance-august2018/en/ [Google Scholar]
  • 9.Das S., Manna S., Saha B., Hati A. K., Roy S. Novel pfkelch13 gene polymorphism associates with artemisinin resistance in Eastern India. Clinical Infectious Diseases. 2019;69:144–1152. doi: 10.1093/cid/ciy1038. [DOI] [PubMed] [Google Scholar]
  • 10.Hanboonkunupakarn B., White N. J. The threat of antimalarial drug resistance. Tropical Diseases Travel Medicine and Vaccines. 2016;2(1):1–5. doi: 10.1186/s40794-016-0027-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Duru V., Witkowski B., Ménard D. Plasmodium falciparum resistance to artemisinin derivatives and piperaquine: a major challenge for malaria elimination in Cambodia. The American Journal of Tropical Medicine and Hygiene. 2016;95(6):1228–1238. doi: 10.4269/ajtmh.16-0234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cheng Q., Kyle D. E., Gatton M. L. Artemisinin resistance in Plasmodium falciparum: a process linked to dormancy? International Journal for Parasitology: Drugs and Drug Resistance. 2012;2(2012):249–255. doi: 10.1016/j.ijpddr.2012.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.White N. J. Antimalarial drug resistance. The Journal of Clinical Investigation. 2004;113(8):1084–1092. doi: 10.1172/JCI21682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Thu A. M., Phyo A. P., Landier J., Parker D. M., Nosten F. H. Combating multidrug-resistant Plasmodium falciparum malaria. The FEBS Journal. 2017;284(16):2569–2578. doi: 10.1111/febs.14127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Phyo A. P., Nkhoma S., Stepniewska K., et al. Emergence of artemisinin-resistant malaria on the western border of Thailand: a longitudinal study. The Lancet. 2012;379(9830):1960–1966. doi: 10.1016/s0140-6736(12)60484-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Woodrow C. J., White N. J. The clinical impact of artemisinin resistance in Southeast Asia and the potential for future spread. FEMS Microbiology Reviews. 2017;41(1):34–48. doi: 10.1093/femsre/fuw037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Oboh M. A., Ndiaye D., Antony H. A., et al. Status of Artemisinin Resistance in Malaria Parasite Plasmodium falciparum from Molecular Analyses of the Kelch13 Gene in Southwestern Nigeria. Bio Med Research International. 2018;2018, article 2305062:1–5. doi: 10.1155/2018/2305062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Witkowski B., Amaratunga C., Khim N., et al. Novel phenotypic assays for the detection of artemisinin-resistant Plasmodium falciparum malaria in Cambodia: in-vitro and ex-vivo drug-response studies. The Lancet Infectious Diseases. 2013;13(12):1043–1049. doi: 10.1016/S1473-3099(13)70252-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Miotto O., Almagro-Garcia J., Manske M., et al. Multiple populations of artemisinin-resistant Plasmodium falciparum in Cambodia. Nature Genetics. 2013;45(6):648–655. doi: 10.1038/ng.2624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ariey F., Witkowski B., Amaratunga C., et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505(7481):50–55. doi: 10.1038/nature12876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Blasco B., Leroy D., Fidock D. A. Antimalarial drug resistance: linking Plasmodium falciparum parasite biology to the clinic. Nature Medicine. 2017;23(8):917–928. doi: 10.1038/nm.4381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gomes L. R., Lavigne A., Peterka C. L., et al. Absence of K13 polymorphism in Plasmodium falciparum from Brazilian areas where the parasite is endemic. Antimicrobial Agents and Chemotherapy. 2018;62(10):1–4. doi: 10.1128/AAC.00354-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.He Y., Campino S., Benavente E. D., et al. Artemisinin resistance-associated markers in Plasmodium falciparum parasites from the China-Myanmar border: predicted structural stability of K13 propeller variants detected in a low-prevalence area. PLoS One. 2019;14(3):e0213613–e0213686. doi: 10.1371/journal.pone.0213686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Das S., Saha B., Hati A. K., Roy S. Evidence of artemisinin-resistant Plasmodium falciparum malaria in Eastern India. The New England Journal of Medicine. 2018;379(20):1962–1964. doi: 10.1056/NEJMc1713777. [DOI] [PubMed] [Google Scholar]
  • 25.Mishra N., Bharti R. S., Mallick P., et al. Emerging polymorphisms in falciparum Kelch13 gene in North- eastern region of India. Malaria Journal. 2016;15(1):1–6. doi: 10.1186/s12936-016-1636-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Dhangadamajhi G., Hazra R. K., Ranjit M. R. Malaria in Odisha and future perspectives. The Journal of Infectious Diseases. 2015;114:289–304. [Google Scholar]
  • 27.Brook J. S., Russell D. W., Green M. R. Molecular Cloning–A Laboratory Manual. 3rd. Vol. 1. New York: Cold spring Harbor Laboratory Press; 2001. [Google Scholar]
  • 28.Snounou G., Viriyakosol S., Jarra W., Thaithong S., Brown K. N. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infection. Molecular and Biochemical Parasitology. 1993;58(2):283–292. doi: 10.1016/0166-6851(93)90050-8. [DOI] [PubMed] [Google Scholar]
  • 29.Snounou G., Viriyakosol S., Xin Ping Zhu, et al. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Molecular And Biochemical Parasitology. 61(2):315–320. doi: 10.1016/0166-6851(93)90077-B. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.


Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES