Abstract
Three of six arginine codons (CGU, CGC and CGA) are decoded by two Escherichia coli tRNAArg isoacceptors. The anticodon stem and loop (ASL) domains of tRNAArg1 and tRNAArg2 both contain inosine and 2-methyladenosine modifications at positions 34 (I34) and 37 (m2A37). tRNAArg1 is also modified from cytidine to 2-thiocytidine at position 32 (s2C32). The s2C32 modification is known to negate wobble codon recognition of the rare CGA codon by an unknown mechanism, while still allowing decoding of CGU and CGC. Substitution of s2C32 for C32 in the Saccharomyces cerevisiae tRNAIleIAU anticodon stem and loop domain (ASL) negates wobble decoding of its synonymous A-ending codon, suggesting that this function of s2C at position 32 is a generalizable property. X-ray crystal structures of variously modified ASLArg1ICG and ASLArg2ICG constructs bound to cognate and wobble codons on the ribosome revealed the disruption of a C32-A38 cross-loop interaction, but failed to fully explain the means by which s2C32 restricts I34 wobbling. Computational studies revealed that the adoption of a spatially broad inosine-adenosine base pair at the wobble position of the codon cannot be maintained simultaneously with the canonical ASL U-turn motif. C32-A38 cross-loop interactions are required for stability of the anticodon/codon interaction in the ribosomal A-site.
Keywords: RNA structure, RNA function, tRNA, modified nucleosides, wobble decoding
GRAPHICAL ABSTRACT

INTRODUCTION
Transfer RNA (tRNA) functions in protein translation by transporting amino acids to the ribosome for protein synthesis. During this process, the tRNA anticodon recognizes and binds the complementary triplet code on messenger RNA (mRNA). The accuracy and efficiency with which tRNA executes this role is significantly enhanced by at least ninety-three currently known naturally occurring post-transcriptional nucleoside modifications, representing a wide array of chemistries and physicochemical properties [1–3]. The most chemically complex and best-studied of these modifications occur within the tRNA anticodon stem and loop (ASL) domain. Among these, modifications to positions 34 and 37, which are respectively within and immediately 3′-adjacent to the anticodon, are the most common [1,4]. The presence of modified nucleosides in the tRNA ASL has been shown to affect its thermal stability and structural conformation [5–10], increase its ribosomal binding affinity [5,6,11–13], enhance specificity of codon decoding [10,11,14–18], maintain the translational reading frame [2,19–21] and promote correct tRNA and mRNA translocation through the ribosome [13]. Modifications have also been demonstrated in some instances to be requirements for pre-structuring the ASL into the canonical tRNA U-turn capable of binding the ribosomal A-site [8,10,22–25].
In E. coli, six possible mRNA codons specify the amino acid arginine. They are decoded by five different tRNA isoacceptors, each with its own distinct modification profile [4]. Of particular note are the tRNAArg1ICG and tRNAArg2ICG isoacceptors, which share identical ASL primary sequences. The ASLs differ only in one post-transcriptional modification. Only tRNAArg1ICG possesses the rare modification 2-thiocytidine (s2C) at position 32, upstream of the anticodon (Figure 1A). Both ASLs have a 2-methyladenosine at position 37 (m2A37) and an inosine at position 34 (I34) (Figures 1A and B; Figure 1D) [26,27]. Outside of the ASL region, tRNAArg2 also possesses an additional nucleoside, A20, in its dihydrouridine loop [4,26,27]. A20, which is present in the other three E. coli tRNAArg isoacceptors as well, has been implicated as an essential aminoacylation determinant [4,26–28]; its deletion or mutation in tRNAArg2 results in a 370-fold decrease in aminoacylation activity, suggesting that constitutively, tRNAArg1 is likely to be aminoacylated at a lower efficiency than tRNAArg2 [29]. It is also possible that A20 in tRNAArg2 may be an anti-determiner with regard to the biosynthesis of s2C32.
Figure 1.

Anticodon stem and loop (ASL) domain constructs. A. The primary sequences, secondary structures, and sites of modifications of the constructs for E. coli ASLArg1 and ASLArg2. B. The primary sequence, secondary structure, and sites of modifications of S. cerevisiae ASLIle. S. cerevisiae tRNAIle has the modification I34, but C32 is not naturally modified. The s2C32 (blue) was introduced into two of the ASLIle constructs under investigation. C. The atomic structures of the modified nucleosides inosine (I), 2-thiocytidine (s2C), and 2-methyladenosine (m2A).
The rare 2-thiocytidine modification at position 32 of tRNAArg1 merits special attention, as the implications of this unusual cytidine thiolation are only just beginning to be explored [1,30,31]. Although s2C is observed in species in both the Archaea and Bacteria kingdoms, it occurs much more rarely than other thiolated tRNA nucleosides, such as the relatively common 2-thiouridine at position 34 (s2U34) or methylthioadenosine derivatives at position 37 [32,33]. In E. coli, the s2C modification at position 32 is observed only in the members of the tRNAArg family (except tRNAArg2) and in tRNASer2GCU [1,4,34]. In all known instances, s2C32 is found within a common consensus sequence element, C32U33NC35NA37A38 [4,35], characterized by a conserved cytidine at the second position of the anticodon, a modified purine at position 37, an adenosine at position 38 and the invariant U33. The cytidine at position 35 has, like A20, been shown to be a key determinant for aminoacylation [27–29]. In all known tRNA structures, C32 and A38 interact via a conserved bifurcated hydrogen bond between the O2 of C32 and the N6 of A38 that forms a non-canonical mismatch base pair at the junction between the stem and loop regions of the ASL [36].
Consistent with the predictions of the Wobble Hypothesis, the presence of inosine (a structural analogue of guanosine) in wobble position 34 enables tRNAArg1ICG and tRNAArg2ICG to decode not only their cognate codon CGC, but also the wobble codons CGU and CGA [37]. Both E. coli and S. cerevisiae decoding of CGA have been noted to be inherently inefficient in the presence of I34 [38–40]. The roles of the s2C32 and m2A37 modifications in tRNAArg1ICG and tRNAArg2ICG, however, are only partially understood.
The structural and functional properties of 2-thiocytidine were initially predicted to mimic those observed for the similarly modified pyrimidine 2-thiouridine (s2U), which occupies the wobble position of several tRNA species. The s2U modification has been shown to increase the degree of base stacking between U34 and U35 [41], an effect attributed to the greater polarizability of sulfur in comparison to oxygen [42,43]. The larger van der Waals radius of sulfur also significantly promotes the adoption of a C3′-endo sugar pucker and an anti- conformation of the N-glycosidic (X) dihedral angle in both U34 and its 3′-neighbor at position 35 [14,44–46]
Given that precedent, as well as with the observation that a change from C32 to s2C32 alters the accessibility of the tRNAArg1 anticodon loop to nuclease S1 in a pattern more indicative of an initiator tRNA than an elongator [47], it seemed that the structure or conformation of the stacked bases at positions 31, 32 and 33 in the canonical U-turn of tRNAArg1 might be altered in the presence of s2C32. The less electronegative sulfur was also predicted to disrupt the conserved C32-A38 cross-loop base pair, a stable interaction known to affect the conformation of the anticodon stem and loop domain [36,41,48]. However, although the presence of s2C32 in E. coli ASLArg1ICG was shown spectroscopically to decrease thermodynamic stability and increase base stacking of the RNA, NMR solution structures of variously modified ASLArg1 and ASLArg2ICG constructs were found to be nearly identical. Unusually, they were all observed to adopt a 5′-UNCG-3′tetraloop conformation in solution rather than the expected pre-structured U-turn motif [14].
In this study, we describe the mechanism by which the 2-thiocytidine modification at position 32 attenuates wobble recognition of adenosine by inosine. An unrelated yeast ASL was engineered to contain both modifications, and demonstrated that the effects observed in modified tRNAArg1 are not unique to this specific tRNA and may be more universally applicable. To better understand the structural basis of that effect, four crystal structures were solved of variously modified ASLs of E. coli tRNAArg1 and tRNAArg2ICG bound to both cognate and synonymous wobble codons in the ribosomal A-site. We compared these structures to a previously published crystal structure of a shorter ASLArgICG construct, with only the one modified nucleoside, I34, bound to CGA on the ribosome. This CGA-bound ASLArgICG construct revealed a significant displacement of the C32 nucleobase, disrupting the classic bifurcated cross-loop C32-A38 hydrogen bond. This suggested the C32-A38 interaction as a structural locus that might be further disrupted upon s2C32 modification. Indeed, previous studies have pointed to other systems in which modification, or changes to the identity, of the nucleoside occupying position 32 (resulting in a weakened interaction between 32 and 38) has had an effect on local conformational flexibility, ribosomal A-site affinity, and translational fidelity [36,49–51]. Accordingly, molecular dynamics (MD) simulations were employed to model the ribosome-bound structures of various modified ASLArg1 and ASLArg2 constructs and mRNA codons. Results indicated that the addition of the sulfur moiety of s2C32 disrupts the ability of the purine inosine to wobble-pair with another purine at the anticodon-codon interface due to stress imparted to the structure by the adoption of a distorted C32-A38 cross-loop hydrogen bond. This altered intraloop interaction sterically hinders formation of the canonical U-turn motif and thus, tRNAArg1 insertion into the ribosomal A-site, thereby abolishing CGA, but not CGU or CGC, codon binding.
RESULTS
Thermodynamic and conformational properties of s2C32 and I34 in the anticodon stem and loop are consistent across tRNAs
Previous studies [14] suggested thermodynamic, conformational and functional consequences of the combined presence of 2-thiocytidine at position 32 and inosine at position 34 of the tRNAArg1 and tRNAArg2 isoacceptors. To assess those effects in other molecular contexts, four ASL constructs of 5-base pair stems and 7-membered loops of S. cerevisiae tRNAIleIAU were designed to contain various possible combinations of s2C32 and I34: ASLIleAAU with and without s2C32, and ASLIleIAU with and without s2C32. The ASL of S. cerevisiae tRNAIleIAU was chosen to test our hypothesis that the C32-A38 cross-loop interaction plays a critical role in s2C32-dependent codon restriction because in addition to a naturally-occurring I34, it contains an unmodified C32 that participates in a canonical C32-A38 interaction. Furthermore, the second and third anticodon positions differ from E. coli ASLArg1 (Figures 1A and B) [4]. If our hypothesis regarding s2C32-dependent wobble restriction is correct and does not rely on ASL features other than s2C32, I34, and a C32-A38 cross-loop interaction, ASLIle with an s2C32 modification will bind NNU and NNC codons only (not NNA). Standard phosphoramidite and 5′-silyl-2′-acetoxyethyl orthoester (ACE) [52] chemistries were employed to synthesize the four differently modified ASLIle constructs: ASLIleAAU, ASLIle-AAU:s2C32, ASLIleIAU and ASLIleIAU:s2C32 (Figure 1C) [53].
The thermodynamic and conformational properties of the modifications to the ASLIle were assessed using UV-monitored thermal denaturation studies and circular dichroism (CD) spectroscopy (Figures 2A and B). In agreement with trends observed previously for modified ASLArg, the addition of either inosine or 2-thiocytidine to ASLIle resulted in a modest and reproducible reduction in thermal stability (Table 1) [14]. The introduction of 2-thiocytidine at position 32 (s2C32) to ASLIleAAU also lowered the melt temperature (Tm, the temperature at which half of the ASL hairpins are fully denatured) by 7.2 °C compared to that of the unmodified ASLIleAAU and resulted in an increase in the Gibbs free energy at 37 °C (ΔΔG37 = −1.96 kcal/mol). The magnitude of this effect on melting temperature and overall stability agrees well with that observed upon addition of s2C32 to unmodified ASLArgACG [14]. A destabilization of similar magnitude was observed upon the addition of an inosine at position 34 (I34) to the unmodified ASL; the Tm decreased by 6.1 °C, while the ΔΔG37 increased by 1.81 kcal/mol. The doubly-modified ASLIleICG:s2C32 construct showed the most dramatic decrease in thermodynamic stability and suggested a modest additive destabilizing effect of the two modifications (ΔTm = 7.8 °C; ΔΔG37 = −2.39 kcal/mol). These trends differed only slightly from those observed for the E. coli ASLArg constructs, for which similar increases in Gibbs free energy were noted for the singly and doubly modified ASLs, but in which the introduction of inosine by itself had no significant effect on melting temperature [14].
Figure 2.

Thermal stability and base stacking of the S. cerevisiae ASLIle constructs. A. Circular dichroism (CD) spectra of the four ASLIle constructs. Spectra are the averages of six normalized molar circular dichroic absorption spectra with data points collected at a resolution of 1 nm. B. UV-monitored thermal denaturation and renaturation spectra of the ASLIle constructs (1 mL; ~0.2 OD260) collected at 260 nm. The profiles shown are the first derivative plots of the averages of four repeated denaturation/renaturation cycles (5 – 95 °C; 1 °C/min).
Table 1.
Thermal stability and propertiesa of the four ASLIle constructs.
| ASLIle | ΔH (kcal/mol) |
ΔS (cal/K*mol) |
ΔG (kcal/mol, 37°C) |
Tm (°C) |
Hyperchromicity (%) |
|---|---|---|---|---|---|
| ACG | −53.7 ± 0.6 | −159.7 ± 1.1 | −4.18 ± 0.02 | 63.2 ± 0.2 | 35.4 ± 1.2 |
| ACG-s2C32 | −38.0 ± 8.3 | −115.3 ± 24.9 | −2.22 ± 0.59 | 56.1 ± 0.9 | 27.6 ± 1.7 |
| ICG | −38.7 ± 0.4 | −117.0 ± 22.1 | −2.37 ± 0.55 | 57.1 ± 0.8 | 27.4 ± 0.9 |
| ICG-S2C32 | −32.1 ± 3.1 | −97.6 ± 9.3 | −1.79 ± 0.19 | 55.4 ± 0.3 | 26.8 ± 1.3 |
Determined from curve-fitting analysis of thermal denaturation curves using MeltWin
v3.5. All errors are reported as standard error of the mean.
Two experimental values are often consulted to give insight into base stacking within a nucleic acid construct and to identify the changes that occur upon introduction of modified nucleosides: the change in hyperchromicity observed during thermal denaturation, and the ellipticity calculated by circular dichroism (CD) spectroscopy [2,20]. The circular dichroism spectra of all four ASL constructs exhibited positive ellipticity (Δɛ) between 250 and 290 nm (λmax ≈ 270 nm), a hallmark of A-form RNA (Figure 2A) that also decreased upon introduction of either modification singly or together. The magnitude of the change was similar for all modification states, and this decrease in ellipticity, consistent with the observed changes in hyperchromicity, also suggested a decrease in base stacking. The introduction of s2C32 or I34 singly or simultaneously to S. cerevisiae ASLIleAAU caused a significant reduction of ~8% in observed hyperchromicity relative to that of the unmodified ASL, suggesting a decrease in base stacking (Figure 2B). These results agree well with previous studies that reported that modifications to the 5′ side of the anticodon stem and loop, such as those at or upstream of wobble position 34, tend to disorder and destabilize the structure [24,43]. They also mirror the reported effect of inosine on base stacking in the ASLArg constructs, although the effect of s2C32 is significantly more pronounced in S. cerevisiae ASLIle, perhaps an effect of the local chemical environment [14].
The s2C32-mediated restriction of tRNA wobble decoding is a functional property observable in other tRNA species
The striking discovery that the introduction of 2-thiocytidine at position 32 in E. coli tRNAArg1ICG acts to restrict its ability to wobble decode its non-cognate CGA codon (yet still correctly reading CGC and CGU) led to the exploration, in this study, of the effect of the presence of an s2C32 on the ability of other tRNAs to recognize adenine in the third codon position. Saccharomyces cerevisiae tRNAIleIAU, like E. coli tRNAArg2, contains native C32, and A38 nucleosides, but otherwise contains neither an endogenous s2C32 modification nor any other sequence homology to tRNAArg1 or tRNAArg2. To investigate the functional effect of s2C32, ribosome A-site binding of S. cerevisiae ASLIleIAU and ASLIleIAU:s2C32 was assessed in vitro to its cognate (AUC) and synonymous wobble codons (AUU and AUA) using 70S E.coli ribosome binding assays. Consistent with the predictions of the Wobble Hypothesis for ASLs with inosine in position 34 [37], ASLIleIAU bound to its cognate AUC codon, as well as to AUU and AUA, with physiologically relevant binding constants (Figures 3A–C; Figure 3 table inset). The addition of the 2-thiocytidine modification at position 32, however, completely abrogated binding of the S. cerevisiae ASLIleIAU:s2C32 to the non-cognate codon AUA. This negative function for the s2C32 modification, in which it restricts the expected wobble decoding of inosine of codons ending in adenine, is identical to that observed in ribosomal A-site binding assays of E. coli ASLArg1ICG:s2C32 to CGA [14].
Figure 3.

Ribosomal A-site codon binding by modified and unmodified S. cerevisiae ASLIleIAU. ASLIle IAU (open symbols; ○; △; □) and ASLIleIAU:s2C32 (filled symbols; ●; ▲; ■) bound in the ribosomal A-site to mRNA codons A. AUC, B. AUU and C. AUA. Error bars represent standard error of the mean. Table shows dissociation constants (Kd) derived from ribosomal A-site codon binding assays and calculated from a one-site saturation ligand binding model in SigmaPlot version 13.0 (Systat Software, San Jose, CA). “NB” indicates no measurable binding above background.
X-ray crystallographic structures of modified E. coli ASLArg1ICG and ASLArg2ICG constructs bound to mRNA on the ribosome are nearly identical
The thermodynamic and ribosome binding studies of the E. coli ASLArg1ICG and the ASLArg2ICG in the context of an S. cerevisiae tRNAIleIAU suggested that the 2-thiocytidine modification in position 32 has a demonstrable effect on the thermodynamic properties, base stacking and wobble decoding ability of the anticodon stem and loop region. Recently published NMR solution structures of several ASLArg1and ASLArg2 constructs bearing different combinations of the modifications s2C32, I34, and m2A37, however, were virtually identical and gave few hints as to the structural basis for the functional effect of s2C on inosine wobbling [14]. Interestingly, all four available NMR structures of modified ASLArg domains adopted non-canonical 5′-UNCG-3′ tetraloop conformations, rather than the expected U-turn motif for ribosomal A-site binding, although binding studies showed all four ASLs to be competent for ribosomal interaction [14].
To determine whether a structural effect of s2C32 on ASL structure and codon binding might instead become observable in the context of mRNA binding on the ribosome, where the ASL would be expected to have adopted its functional U-turn conformation, four x-ray crystal structures were determined by molecular replacement. Native Thermus thermophilus 30S crystals were soaked with solutions containing each of the variously modified ASLArg constructs and one of two hexameric RNA oligonucleotides (5′-CG(U/C)AAA-3′) (Figure 4 and Table S2). The four crystal structures comprise the unmodified ASLArgACG with the codon CGU, the ASLArg2ICG with CGU, and the ASLArg1ICG:s2C32 with CGC and CGU. Not unexpectedly, diffraction-quality crystals of an s2C32 -modified ASLArg1ICG in complex with the CGA codon were unattainable. The antibiotic paromomycin was included as an established crystallographic aid in facilitating the formation of the closed form of the 30S subunit; this is known to improve diffraction resolution and result in better-ordered electron density for the tRNA moiety [54,55].
Figure 4.

Crystal structures of E. coli ASLArg1 and ASLArg2 constructs on the ribosome responding to the arginine codons CGC and CGU. E. coli ASLArg constructs (green with anticodons) and mRNAs (violet) were soaked into empty cryoprotected T. thermophilus 30S ribosome crystals. A. ASLArgACG bound to the arginine codon CGU; B. ASLArg2ICG bound to CGU; C. ASLArg1ICG:s2C32 bound to CGC; and D. ASLArg1ICG:s2C32 bound to CGU. Structures are displayed with 2mFo-DFc maps contoured at sigma = 1.25. E. Overlay of ASLArg crystal structures. The interactions of the ASLs with the various mRNA codons for all four structures were aligned using ASLArgACG as reference.
The electron density maps are not identical, but no significant differences were observed between the four crystal structures (Figure S4). Unbiased model refinement resulted in structures having a maximum RMSD between all four of the ribosome-bound inosine-containing ASLs with and without the s2C32 modification of 1.09Å (crystallographic parameters and RMSDs, Tables S2 and S3). Therefore, the small density differences that were observed are likely to be experimental variability. In all four structures, the stem of the ASLArgICG constructs exhibited the geometric features characteristic of an A-form RNA conformation with Watson-Crick base pairs [56]. The structures of the codon-anticodon base pairs are in conventional Watson-Crick or wobble geometry, as expected. The structure of the 30S ribosomal subunit is identical within experimental error to other tRNA-codon recognition ribosome structures published previously [56–58]. The 2-thiocytidine at position 32, when present, caused no discernible perturbation to any structural feature of the ASL compared to structures in which it was absent.
In 2004, Murphy and Ramakrishnan published two related structures, depicting shorter E.coli ASLArg2ICG constructs (bearing no other modifications) in complex with cognate CGC and non-cognate CGA codons on the 30S E. coli ribosome. They employed these structures as the basis of an experimental demonstration that the wobble inosine-adenosine pair adopts an Ianti/Aanti geometry at the anticodon-codon interface [57]. When comparing these structures to the crystal structures solved above, which did not include a CGA-bound structure, a salient point of divergence emerged (Figures 5A and B). The orientation of the C32 nucleobase when ASLArg2ICG is bound to CGA [57] deviates from the orientation observed when the ASLArg2ICG instead binds CGU (or CGC). When the backbones of the structures of ASLArg2ICG bound to the CGA and CGC codons are aligned, the C32 nucleobase can be observed to have rotated by 38 degrees (Figure 5B). The hallmark hydrogen bonds forming the stable bifurcated C32-A38 cross-loop interaction are abrogated under inosine-adenosine wobble binding. The amine group on A38 (N6) is within hydrogen bonding distance of N3 on C32 when the codon is CGC (or CGU). When the ASL binds to the CGA codon the distance between A38 (N6) and C32 (N3) is close to 5Å, which prevents any direct cross-loop interaction.
Figure 5.

Comparison of ASLArg crystal structures with previously solved structures. A. The ASLArg2ICG (grey) interaction with the mRNA codon CGU is used as a representative of the structural set and superimposed onto the previously solved structures of the truncated ASLArg2ICG binding the CGC codon (green) and the CGA codon (blue) [57]). B. A comparison of the C32-A38 base pair with the ASLArg2ICG construct reveals a deviation in the structure when bound to the rare codon CGA; same coloration as in A. The structure results from the altered geometry of the I34:A3 anticodon-codon base pair.
It was not possible to obtain a crystal structure of the most interesting ribosome-bound complex, containing an s2C32-modified ASLArg1ICG interacting with CGA. This is an anticipated absence, given that no binding was detected between those species experimentally. Having observed, however, that the unmodified C32 of ASLArg2ICG exhibits a conformational distortion when bound to CGA, it was interesting to speculate that the replacement of an oxygen atom with a sulfur at that position might compound the effect observed. Since a complex between ASLArg1ICG-s2C32 and a CGA codon does not form on the ribosome and an x-ray crystal structure could not be obtained, in silico molecular dynamics methods were employed to study the effect of 2-thiocytidine on inosine-adenosine binding at the anticodon-codon interface.
Force field parameters developed for the modified nucleoside 2-thiocytidine agree with experimental properties
Force field parameters for molecular dynamics are readily available for inosine, a common modified nucleoside, but it was necessary to develop and validate a set of novel force field parameters for 2-thiocytidine in order to simulate s2C-containing RNA molecules accurately. Briefly, AMBER-type parameters were developed as described in detail in the Supplementary Materials. Predictions from simulation about the distributions of the syn-anti glycosidic and sugar pucker angles of 2-thiocytidine in solution were compared to experimental results obtained by NMR (Figures S1 and S2) and found to be in good agreement. The difference in the free energy of folding between the ASLArg2ICG and ASLArg1ICG:s2C32 hairpins determined experimentally by UV-monitored thermal denaturation studies (ΔΔG37 = 0.5 ± 0.10 kcal/mol) [57] was also in good agreement with that obtained from simulation using the new s2C force field parameters (ΔΔG37 = 0.37 ± 0.12 kcal/mol) (Figure S3). These results suggest that the force field parameter set for 2-thiocytidine correctly captured the in vitro behavior of the nucleoside, and it was used in the remainder of the studies reported here.
Molecular dynamics simulations of ASLArgICG constructs bound to mRNA on the ribosome indicate that the purine:purine I34-A3 interaction destabilizes the canonical U-turn motif
In order to investigate the effects of nucleoside modifications on the structure of tRNAArg bound to mRNA on the ribosome, simulations were performed for ASLArgICG binding to each synonymous arginine codon (CGC, CGU and CGA) with and without the s2C modification at position 32. Initially, a 10-ns simulation of each of the structures with the entire ribosome intact demonstrated that the system does not exhibit any structural rearrangements, in either the presence or absence of the modification. Expected interaction between the ribosomal subunit and its tRNA and mRNA substrates (specifically between tRNA and mRNA residues and ribosome nucleosides G530, A1492, A1493) are maintained throughout the simulations. Therefore, to simplify the system and permit longer simulations, the system of interest was thereafter defined as composed of the tRNA and mRNA moieties, an intact stable fragment of the ribosomal RNA which includes all residues making direct contacts with the tRNA and/or mRNA, and associated Mg2+ ions. All simulations were run for 50 ns.
As predicted by numerous previous structural studies, when ASLArg1ICG or ASLArg2ICG binds CGC or CGU, the inosine at position 34 of the ASL interacts in standard wobble geometry with the smaller pyrimidine ring (U3/C3) of the third nucleoside in the mRNA codon [54,57,59]. The standard C1′-C1′ distance between a purine-pyrimidine base pair is in the range of 10.2–10.8 Å [37], a characteristic that can be observed in these molecular dynamics simulations as well when the mRNA codon is either CGC or CGU. In this conformation the canonical U-turn interaction, in which U33 interacts with the phosphate group of G36, is also maintained, as previously observed in simulations and experimentally obtained structures [60–62].
In the case in which the ASLArgICG binds the CGA codon, however, I34 must form a wobble base pair with the larger purine ring of adenosine (A3), an interaction which occupies a broader spatial extent [38,57]. In order to accommodate the larger adenosine in position 3 of the CGA codon, the C1′-C1′ distance between I34 and A3 becomes 2.5 Å greater than the standard purine-pyrimidine distance, occupying nearly 13 Å total [37]. Previous reports based on x-ray crystallography suggested that when ASLArg2ICG binds CGA on the ribosome, the ASL absorbs this structural perturbation chiefly through modest changes in torsion angles between the C1 and P atoms of the inosine [57]. Examination of these simulation results confirmed that those torsion angle alterations occur, but also demonstrated that the purine-purine displacement at the wobble position propagates further than I34. This is reflected in a significantly distorted U-turn in which the U33, instead of interacting with the phosphate group of G36 as in a canonical U-turn [60–62], now interacts with that of C35 through the O2′ hydroxyl group (Figures 6A and B). This altered hydrogen bonding brings about two important changes: a) it introduces a kink in the anticodon stem and loop domain that results in a rotation of the C32 nucleobase away from the center of the loop domain, as also observed experimentally by x-ray crystallography [60–62]; and b) U33 rotates towards the outside, opening the loop cavity for hydration water molecules. In this conformation, the classic bifurcated cross-loop hydrogen bond between C32 and A38 is disrupted (Figures 6C and D), and is instead replaced by dynamic water-mediated interactions involving the N6 and O2 of the tRNA’s A38 and C32 bases, respectively, with one or two bridging water molecules. This behavior is in contrast to the binding of ASLArg2ICG to CGC or CGU, in which the wobble position inosine forms a standard Watson-Crick bond with a pyrimidine nucleoside and, N6 of A38 and N3 of C32 participate in the classic bifurcated hydrogen bond. In this confirmation, the oxygen on the second position (O2) of C32 faces away from the interior of the loop domain. When C32 is unmodified and the codon is CGA, it appears clear that the O2 directly participates in maintaining the loop hydrated with at least one dynamic H2O molecule (Figure 7 & Supplementary video). The absence of these water molecules in the published crystal structure [57] is not surprising due to their highly dynamic nature (Supplementary video).
Figure 6.

Molecular dynamics (MD)-simulated comparison of the U-turns and A38-C32 interactions in ASLArgICG binding the codons CGU (PDB ID: 6MKN) and CGA (PDB ID: 1XNQ). A. Canonical U-turn with stacking and U33-G36 interaction (ASLArg2ICG bound to codon CGU). B. Non-canonical U-turn with U33-C35 interaction. The stacking interaction and U33-G36 interaction are absent (ASLArg2ICG bound to codon CGA). C. A38-C32 interaction via hydrogen bonds (ASLArgICG bound to codon CGU). D. Water-mediated interaction between A38–C32 (ASLArgICG bound to codon CGA).
Figure 7.

The MD simulation of the distribution of water inside the loop of the modified ASLArg1ICG:s2C32 and the ASLArg2ICG in binding to the codon. The MD simulation was conducted in a water box with 4.3 × 104 water molecules. Each dot represents the oxygen of a water molecule which is within 3.5Å of the O2/S2 of C32 and the amine nitrogen, N6, of A38, where the water molecule can establish hydrogen bonds with both these groups. Snapshots were recorded every ps. (See Supplementary video)
A canonical interaction and structure are obtained when ASLArg2 containing only I34 binds CGU or CGC, but that CGA binding results in a distortion of the U-turn that propagates as far as the C32-A38 cross-loop interaction. It therefore seemed probable that the 2-thiocytidine modification at position 32 of ASLArg1ICG:s2C32 would compound the structural instability obtained when a purine-purine interaction occupies the wobble position. Accordingly, the same simulations were performed on the system in which s2C32 replaced C32 in silico. A stable interaction does not form naturally between the mRNA CGA codon on the ribosome and the s2C32-modified ASLArg1ICG; thus, the simulation included an extra set of constraints on the ASL itself, holding it fixed in its initial distorted U-turn structure such that the binding interface between codon and anticodon could not be destabilized. In this way, we were able to account for the failure of ASLArg1ICG:s2C32 to form a complex with CGA under biological conditions.
The addition of an s2C32 to ASLArg1ICG had no discernible effect on the structure of the mRNA-bound ASL on the ribosome when the bound codon is CGC or CGU and a purine-pyrimidine pair occupies the wobble position. In contrast, when the codon is CGA and the codon-anticodon interaction is enforced, the MD simulations demonstrated that the larger and less electronegative sulfur atom replacing O2 in the s2C32-modifiedASLArg1ICG is not able to coordinate water and stabilize the water-mediated C32-A38 interaction as efficiently as the oxygen (Supplementary video). The S2-for-O2 substitution is expected to have both enthalpic and entropic penalties. The larger sulfur atom and the longer C=S bond result in a reduction of available space for water molecules inside the loop of the ASLArg1ICG:s2C32 construct when in complex with CGA, as observed in simulation (Figure 7). In the presence of s2C32, the water molecules are confined to three distinct clusters, while in the unmodified case the water molecules are relatively dispersed in the accessible space. The confined, more ordered distribution of water in the presence of the modified s2C32 implies that the water-mediated interaction occupies a smaller number of possible configurations, resulting in an entropic penalty. The reduced enthalpy arising from the weakened water-mediated interaction, and the entropic penalty as a result of the fewer accessible configurations for the water-mediated hydrogen bond between the A38 and C32, both contribute to destabilization of the loop structure.
Further, in the absence of constraints on the ASLArg1ICG:s2C32 in complex with CGA, the U-turn-stabilizing U33 (O2′) - C35 (OP) hydrogen bond is observed to break, in favor of a U33 (O2′) - I34 (OP) hydrogen bond, further destabilizing the positioning of U33 in the loop. While the simulations did not sample the time-scales necessary to observe spontaneous unbinding of the ASL from the CGA codon in response to the sulfur modification, they do provide valuable molecular insights into the interactions that weaken and finally break. Consequently, they provide insight to the substantial decrease of the experimentally observed binding affinity between tRNAArg1ICG:s2C32 and its cognate codon CGA.
DISCUSSION
The effect of modified nucleosides on the ability of tRNA to recognize codons has been discussed ever since 1966, when Crick published the Wobble Hypothesis and proposed that an inosine occupying position 34 of the anticodon can bind A, C or U [37]. Other modifications, particularly those at positions 34 and 37, affect the anticodon stem and loop in a variety of ways, including restricting codon recognition, enabling translocation, pre-structuring of the anticodon stem and loop to bind the ribosomal A-site in addition to expanding and restricting wobble recognition [22,58,63]. In fact, the ASL of the two tRNAArg isoacceptors (tRNAArg1, tRNAArg2) discussed here contain another modification at position 37, 2-methyladenosine (m2A37) [1,34]. Aliphatic modifications at position 37 of tRNAs are commonly shown to stabilize the codon-anticodon pairs by additional stacking interactions and thus enhance binding affinity of the tRNA-mRNA complex [1,34]. However, in case of ASLArg1ICG and ASLArg2ICG, ribosomal binding studies show that the m2A37 modification also reduces or negates binding of the ASL to its cognate and near cognate codons [14]. A complete structural and dynamic explanation for this counterintuitive result is being pursued using molecular dynamic simulations and is a part of our ongoing investigative efforts.
Other than s2C32, modifications at position 32 are not uncommon. Modified nucleosides that have been found at this position include N3-methylcytidine (m3C), 2′-O-methyl-(cytidine, uridine and adenosine) (Cm, Um and Am) [64,65] and pseudouridine (Ψ). The m3C32 modification has been found to impart resistance to oxidative stress in yeast and higher eukaryotes when present in tRNASer and tRNAThr, and in tRNAArg, respectively [66]. When absent, the lack of Cm at position 32 on tRNAPhe negatively affects translational efficiency of the tRNA [67].
Among the several modifications that occur at position 32, however, the s2C32 modification is rare. The nucleoside s2C was first reported in an E. coli tRNASer [68]. An in vitro investigation of the synthesis of the T4 phage coat protein in E. coli showed that the triply-modified tRNAArg1ICG:s2C32,m2A37 was required to maintain the translational reading frame; substitution of C32 for s2C32 increased the incidence of frameshift mutations during translation [47]. A Salmonella enterica mutant unable to synthesize 2-thiocytidine exhibited no overall growth disadvantage, but the reintroduction of the modification was observed to decrease the rate of peptide translation for the rare CGA codon and not the common CGU [69]. This finding was in broad agreement with the recent discovery that, while E.coli ASLArg1ICG (identical to ASLArg2ICG) carrying an unmodified C32 binds all three Wobble Hypothesis-predicted mRNA codons, the s2C32-modified ASLArg1 ICG was completely unable to bind to CGA, although it bound CGC and CGU with physiological binding constants [14]. The negative influence of s2C32 on I34 decoding of A3 was clearly replicated with a yeast tRNAIle ASL construct. Yet, after determining three NMR structures of variously modified ASL constructs of tRNAArg [14], as well as four crystal structures of ASLArg1ICG with and ASLArg2ICG without s2C32 on the ribosome in response to various codons, the mechanism by which s2C32 was modulating the ability of I34 to read A3 was not clear. A comparison of crystal structures containing the CGU/CGC codon with one containing the CGA codon revealed that in the case of I34-A3, the hallmark interactions of the canonical U-turn are modified to accommodate the larger purine-purine base pair. This evident structural difference was, however, not itself sufficient to explain the role of s2C32 in negating binding of the ASLArg1ICG:s2C32 to the CGA codon. Taken together, the above results do suggest both a global role for s2C32 in preventing frameshift mutations during protein translation, and a specific role in restricting the ability of tRNAArg1ICG to decode the rare arginine codon CGA.
Molecular dynamics simulation of the I34-A3 interaction in explicit water appears to have revealed a possible mechanism based on dynamics and the ordering of water by s2C32 between the ASL nucleosides C32 and A38. The interaction between the nucleosides Y32-R38 at the base of the loop domain of the ASL is typically characterized by a single or bifurcated hydrogen bond [36]. The strength of this interaction appears to be carefully modulated. While a stronger interaction, like that of a canonical base pair, could lead to a loss in flexibility of the loop domain at this position, a weaker interaction could conversely result in loss of stacking between Y32 and U33 and result in a disruption of the functional U-turn conformation of the ASL. Indeed, the identity of the bases occupying these positions and the nature of their interaction correlates strongly to the affinity of the tRNA for the ribosomal A-site for cognate and near cognate codons (reviewed in [51]). The nature of the C32-A38 interaction is attributed to energetic penalties and structural changes that affect the codon-anticodon helix in cognate and near cognate recognition [51]. Thus, we hypothesized that tRNAs having s2C32 have an altered anticodon loop conformation and enthalpy penalties whereas interaction of C32 with A38 could significantly affect wobble of I34 to A3.
In the crystal structure of the ASLArg2ICG bound to the CGA codon at the ribosomal A-site, the direct cross-loop interaction between C32 to A38 is disrupted in the presence of the I34-A3 interaction [57]. In our molecular dynamics simulations, we observed that the subtle distortion reported at the codon-anticodon mini-helix of ASLArg2ICG due to the I34-A3 purine-purine base pair results in a substantially distorted, non-canonical U-turn upstream. This, in turn opens up the loop domain for hydration waters and brings about a water-mediated interaction between C32 to A38 involving the O2 atom of C32. It is well established that pseudouridine at position 32 uses a water-mediated base-backbone interaction to stabilize the 32–38 interaction pair [36]. Replacing C32 with s2C32 in the ASLArg1ICG construct weakens the water-mediated interaction, due to the larger size and weaker electronegativity of the sulfur atom. We hypothesize that this diminished interaction makes formation of the required non-canonical U-turn less favorable, which destabilizes the interactions within the loop and with the mRNA and leads to the inability of s2C32-modified ASLArg1ICG to bind to the CGA codon.
It is interesting to note that the rare modification s2C32 affects the decoding capacity of the ASLArg1ICG only in the case of the similarly rare codon CGA. It does not significantly affect the structure or the ribosomal binding capacity of the ASLArg1ICG to the more common CGU and CGC codons of arginine, nor does its absence affect the growth rate or physiology, under laboratory conditions, of bacteria in which it is native [69]. This observation permits speculation that the incorporation of the s2C32 modification in tRNAArg1ICG may have originally been an evolutionary accident but that its negative effect on the already inefficient decoding of the rare codon CGA conferred an advantage in some environments.
It is increasingly acknowledged that tRNA modification profiles can be reprogrammed, under various stresses and during environmental changes, to better read specific codons over their synonymous counterparts [70–72]. The reprogramming of tRNA wobble modifications has already been shown to lead to enhanced translation of codon-biased mRNAs (known as modification-tunable transcripts, or MoTTs) with roles in survival and stress response [72,73]. It is not difficult to imagine a similar tunable role for s2C32 in regulating the translation of MoTTs containing disproportionate stretches of rare CGA codons, which have been shown in both E. coli and S. cerevisiae to promote ribosomal stalling and affect translation negatively under ordinary cellular conditions [70,74,75]. An investigation of proteins consisting of a generous percentage of arginines coded by CGA codons, and their functions in the bacteria, would be useful in understanding the physiological impact of this modification [76].
MATERIAL AND METHODS
Oligonucleotide Preparation
The modified nucleoside 2-thiocytidine (s2C) was synthesized chemically (Trilink Biotechnologies, San Diego, CA) and then derivatized to the 5′-O-BzH-2′-O-ACE-protected 2-thiouridine-3′-(methyl-N,N-diisopropyl) phosphoramidite (Dharmacon Products; Thermo Fisher, Lafayette, CO). The chemically synthesized heptadecameric E. coli ASLArg1 [4] and S. cerevisiae ASLIle constructs [4,77] were also produced by ACE chemistry [52] to contain A34 or I34 with or without s2C32 (Dharmacon Products; Thermo Fisher). After deprotection via standard protocol, the RNA was desalted and dialyzed against water using a 3500 Da cutoff membrane (Pierce) followed by resuspension in 20 mM sodium phosphate buffer, pH 6.8.
UV-Monitored Thermal Denaturation and Circular Dichroism
ASLIleIAU RNA samples (Figure 1C) were prepared as above at concentrations adjusted to ~0.3 absorbance units at 260 nm. Thermal denaturations and renaturations were monitored by UV absorbance at 260 nm with a Cary 100 UV-visible spectrophotometer (Agilent) using Thermal software. Five successive denaturations and renaturations were conducted over a temperature range of 5–95 °C using 1-cm pathlength cuvettes. The temperature ramp rate was 1.0 °C/min with a data sa mpling interval of 1 min. Thermodynamic parameters were obtained by fitting absorbance versus temperature profiles using the curve-fitting program Meltwin (version 3.5). After normalization, the first derivative was determined and smoothed by cubic splines. Circular dichroism (CD) spectra on each sample were collected immediately after thermal denaturation studies as a series of six scans on a Jasco 600 spectropolarimeter (Jasco, Inc.) at 20 °C in a 1-cm pathlength quartz cuvette. All data were baseline corrected using a control containing buffr only. Data were analyzed by normalizing the spectra to molar circular dichroic absorbance using simultaneously collected absorbance data to calculate the concentrations of each sample (Δɛ=θ/32980·C·L·N) [78].
Codon-specific ribosomal binding assays
E. coli 70S ribosomes were purified from MRE 600 cultures and used in codon-specific ribosomal A-site binding assays as described previously [14]. Together with ASLIleIAU constructs, the following mRNA sequences based on the T4 gp32 message and S. cerevisiae tRNAIleIAU were used. (A-site codon sequences are bold and underlined.):
GGCAAGGAGGUAAAAAUGAUCGCACGU
GGCAAGGAGGUAAAAAUGAUUGCACGU
GGCAAGGAGGUAAAAAUGAUAGCACGU
Heptadecamer ASLs were 5′−32P-radiolabeled and purified using preparative denaturing 15% polyacrylamide gel electrophoresis. mRNA-programmed ribosomes (250 nM ribosome and 2.5 μM mRNA) were P-site saturated with tRNAfMet and incubated for one hour at 37 °C with varying concentrations (0, 0.25, 0.5, 1.0, 1.5, 2.5, 5 μM) of unlabeled ASL spiked with up to 2 kCPM radiolabeled ASL in ribosome binding buffer (50 mM HEPES, pH 7; 30 mM KCl; 70 mM NH4Cl; 1 mM DTT; 100 μM EDTA; 20 mM MgCl2 adjusted to pH 7 with 2 M NaOH). Binding reactions were then filtered through a 0.22 μM nitrocellulose filter (Whatman) using a modified Micro-Sample Filtration Manifold (Whatman Schleicher & Schuell Minifold) 96-well dot blot apparatus [79,80]. A standard curve was generated by spotting known amounts of radiolabeled ASL onto a small strip of nitrocellulose filter. Filters were imaged using a Typhoon phosphor imager (GE Healthcare) and radioactive spot density was calculated using ImageQuant TL software (Amersham). Binding constants were calculated using the one-site specific binding function in Prism v3 (Graphpad). An internal positive control using unmodified yeast ASLPhe binding to polyuridylic acid and non-specific negative controls using a control mRNA with GCG in the A-site position were performed in tandem with every experiment. All binding curves were performed in triplicate in each of three independent experiments. Determination of ribosome activity and usability of mRNAs was accomplished using filter binding assays consisting of only ribosomes and 5′−32P-radiolabeled mRNAs. This approach to assessing the binding of tRNA to ribosomes by treating it in the manner of a standard ligand-binding experiment has historical precedents as far back as 1966 [81] and also appears in a large number of more modern studies of ribosome/tRNA interaction [82–84].
Crystallization
Chemically synthesized hexamer mRNA oligonucleotides (5′-CG(U/C)AAA-3′) were purified by preparative polyacrylamide electrophoresis (Thermo Fisher Scientific). The 30S ribosome subunits were purified from T. thermophilus followed by crystallization and cryoprotection in 26% (v/v) MPD, 100 mM K-MES (pH 6.5), 75 mM NH4Cl, 200 mM KCl, and 15 mM MgCl2 as described [85]. Empty, cryoprotected 30S ribosome crystals were then soaked in cryoprotection solution containing 80 μM paromomycin, 300 μM ASL and 300 μM mRNA [54,55]. After soaking for at least 48 hours, crystals were plunged in liquid nitrogen and stored until data collection. Paromomycin, an antibiotic, induces a closed conformation of the 30S ribosomal subunit without affecting the conformation of the A-site tRNA [55], resulting in improved density and resolution of the ASL [54].
Data collection and refinement
Native RNA-bound ribosome diffraction data were collected at NE-CAT beamlines 24-ID-C and 24-ID-E of the Advanced Photon Source and processed using XDS [86]. Phases were obtained by molecular replacement using PHENIX with PDB ID: 1XNR a search model [87]. The model was refined in PHENIX, followed by additional refinement, visualization and model building in Coot [87,88]. PyMOL was used for figure production [89]. The eLBOW module within PHENIX was used to generate geometry restraints and dictionary files for the non-standard residues (paromomycin, inosine, 2-methyladenosine and 2-thiocytidine) using the semi-empirical quantum mechanical AM1 method [90]. Datasets were not collected at the same time; differences in resolution of the structures were, therefore, likely caused by variation in the X-ray beam rather than in the crystals themselves. A summary of data and refinement statistics is given in Table S1. The atomic coordinates for the ASLArg1 and ASLArg2 constructs bound to mRNA on the 30S ribosome were deposited in the Protein Data Bank under the accession numbers 6DTI (unmodified ASLArgACG binding codon CGU), 6MKN (ASLArg2ICG binding codon CGU), 6MPF (ASLArg1ICG:s2C32 binding CGC) and 6MPI (ASLArg1ICG:s2C32 binding CGU).
Simulation Methods
Force field parameterization and validation
AMBER-type force field parameters for the modified nucleoside 2-thiocytidine (s2C) were obtained and validated as described in detail in the Supplementary Materials. Briefly, published values were used for the partial charges of the s2C atoms, while AMBER-99 force field parameters and AMBER-99 parameters with the Chen-Garcia correction were used for bonded and Lennard-Jones (LJ) interactions, respectively [91,92]. To validate these force field parameters, two sets of molecular dynamics simulations were performed: (i) single nucleoside simulations of cytidine and 2-thiocytidine; and (ii) simulations in solution of ASLArg1ICG with the 2-thiocytidine modification at position 32 and of ASLArg2ICG without the s2C32. The simulated distributions of the syn-anti glycosidic and sugar pucker angles for s2C in solution were then compared to experimental results obtained from NMR 1H-1H NOESY-HSQC and DQF-COSY spectra (Figures S1A and B), and the folding free energy difference between the ASLArg2ICG and ASLArg1ICG:s2C32 RNA hairpins (Figure S2; Table S1) was compared to that determined experimentally by UV-monitored thermal denaturation studies [14]. The simulation results were in good agreement with experiment, suggesting that the force field parameter set for 2-thiocytidine correctly captured the in vitro behavior of the nucleoside.
Molecular dynamics simulations
The crystal structures of the 16S ribosomal subunit of Thermus thermophilus containing the anticodon stem and loop domains (ASLs) of tRNAArg1ICG and tRNAArg2ICG and the mRNA codon fragment in the decoding center were obtained from the Protein Data Bank: ASLArg2ICG bound to CGC (1XNR) and CGA (1XNQ) [57]; or acquired crystallographically as above: unmodified ASLArgACG bound to CGU (deposited as 6DTI), ASLArg2ICG bound to CGU (deposited as 6MKN), ASLArg1ICG:s2C32 bound to CGC (deposited as 6MPF) and ASLArg1ICG:s2C32 bound to CGU (deposited as 6MPI). To model the binding of ASLArg1ICG:s2C32 to the CGA codon, the cytosine at position 32 in the ASLArg2ICG-CGA crystal structure (1XNQ) was modified to s2C32 in silico. Missing atoms and ions in the ribosome-associated proteins were added using MOE [93].
A 10-ns all-atom simulation of each of the structures with the entire ribosome intact was employed to demonstrate that the system does not exhibit any changes in the interaction between the canonical tRNA-mRNA pair and the ribosomal subunit. Thereafter, the simulation system included the tRNA and mRNA moieties, an intact stable fragment of the ribosomal RNA comprising those residues making direct contacts with the tRNA and/or mRNA, and associated Mg2+ ions in a solution of 1M KCl in a 3D periodic box. The box size was 11.25 × 11.25 × 11.25 nm3 containing ~997 K+ ions, ~884 Cl− ions and 4.3 × 104 water molecules.
Molecular dynamics simulations were performed using Gromacs-4.6.3 and Gromacs-5.0.6 packages [94]. The MD simulations incorporated a leap-frog algorithm with a 2-fs timestep to integrate the equations of motion. The system was maintained at 300K, using the velocity rescaling thermostat [95]. The pressure was maintained at 1 atm using the Berendsen barostat for equilibration [96,97]. The long-range electrostatic interactions were calculated using particle mesh Ewald (PME) algorithm with a real space cut-off of 1.0 nm [98]. Lennard-Jones interactions were also truncated at 1.0 nm. The TIP3P model was used represent the water molecules, and the LINCS algorithm was used to constrain the motion of hydrogen atoms bonded to heavy atom [99]. The system was subjected to energy minimization to prevent any overlap of atoms, followed by 0.5 ns of equilibration in NPT ensemble and a 50-ns NVT production run. During simulations, the ribosomal subunit was held in place using position restraints on its heavy atoms with a force constant of 1000 N/nm in each spatial dimension for the equilibration run, and then was frozen for the rest of the simulation. When modeling the binding of ASLArg1ICG:s2C32 to the CGA codon, the atoms comprising the ASL were held fixed in the conformation adopted during the simulation of the binding of ASLArg2ICG without s2C32, to enforce the binding interface between the anticodon and the codon. Coordinates of the RNA components (rRNA, tRNA, and mRNA) of the system were stored every 1 ps for further analysis.
Accession numbers
The final model coordinates and the corresponding structure factors were submitted to Protein Data Bank with the accession numbers PDB ID: 6DTI (unmodified ASLArgACG bound to CGU); PDB ID: 6MNK (ASLArg2ICG bound to CGU); PDB ID 6MPF (ASLArg1ICG:s2C32 bound to CGC); and 6MPI (ASLArg1ICG:s2C32 bound to CGU).
Supplementary Material
Highlights:
Modification to 2-thiocytidine at position 32 (s2C32) of tRNAArg’-ICG’s anticodon stem and loop domain negates wobble position inosine binding to codons beginning in A.
The s2C32 alters the C32-A38 cross-loop interactions required for tRNA binding to the mRNA codon such that the I34/A1 interaction cannot be maintained with the canonical U33-turn.
The incorporation of the s2C32 modification in tRNAArg1ICG and its negative effect on CGA decoding may confer an advantage in some environments and promote the translation of CGA-codon-biased mRNAs.
ACKNOWLEDGEMENTS
The authors thank Jennifer Lorenz Badua and Thomas Sarachan for assistance in preparing figures.
This work was supported by the National Institutes of Health, National Institute of General Medical Science [2RO1GM23037-25 to P.F.A. and 1R01GM110588-01 to P.F.A. as co-investigator, Manal Swairjo, Principal Investigator]; and the National Science Foundation [MCB1101859 and CHE{Hess:1997hd} to P.F.A]. H.D. acknowledges support from NSF Science and Technology 349 Centers grant NSF-1231306 (Biology with X-ray Lasers, BioXFEL). The open access publication charge for this paper were paid in part from the funding sources listed above.
Abbreviations:
- tRNA
transfer RNA
- mRNA
messenger RNA
- ASL
anticodon stem and loop
- s2C
2-thiocytidine
- m2A
2-methyladenosine
- I
inosine
- s2U
2-thiouridine
- MD
molecular dynamics
- NMR
nuclear magnetic resonance
- MoTTs
modification-tunable transcripts
- ACE
5′-silyl-2′-acetoxyethyl orthoester
- CD
circular dichroism
- NOESY
HSQC, Nuclear Overhauser Enhancement Spectroscopy-Heteronuclear Single Quantum Coherence
- COSY
DQF, correlation spectroscopy-double quantum filtered
- NPT
constant pressure-constant temperature ensemble
- NVT
constant volume-constant temperature ensemble
- PME
particle mesh Ewald
Footnotes
Publisher's Disclaimer: This is a PDF flle of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its flnal form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
SUPPLEMENTARY DATA
Supplementary Data are available at JMB Online.
Declaration of interest: No conflict of interest exists with any of the authors.
REFERENCES
- [1].Cantara WA, Crain PF, Rozenski J, McCloskey JA, Harris KA, Zhang X, et al. , The RNA modification database, RNAMDB: 2011 update, Nucleic Acids Research. 39 (2010) D195–D201. doi: 10.1093/nar/gkq1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [2].Gustilo EM, Vendeix FA, Agris PF, tRNA’s modifications bring order to gene expression, Current Opinion in Microbiology. 11 (2008) 134–140. doi: 10.1016/j.mib.2008.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Jackman JE, Alfonzo JD, Transfer RNA modifications: nature’s combinatorial chemistry playground, WIREs RNA. 4 (2012) 35–48. doi: 10.1002/wrna.1144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [4].Jühling F, Mörl M, Hartmann RK, Sprinzl M, Stadler PF, Pütz J, tRNAdb 2009: compilation of tRNA sequences and tRNA genes, Nucleic Acids Research. 37 (2009) D159–62. doi: 10.1093/nar/gkn772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [5].Lusic H, Gustilo EM, Vendeix FAP, Kaiser R, Delaney MO, Graham WD, et al. , Synthesis and investigation of the 5-formylcytidine modified, anticodon stem and loop of the human mitochondrial tRNAMet, Nucleic Acids Research. 36 (2008) 6548–6557. doi: 10.1093/nar/gkn703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Yarian C, Marszalek M, Sochacka E, Malkiewicz A, Guenther R, Miskiewicz A, et al. , Modified Nucleoside Dependent Watson–Crick and Wobble Codon Binding by tRNA LysUUU Species †, Biochemistry. 39 (2000) 13390–13395. doi: 10.1021/bi001302g. [DOI] [PubMed] [Google Scholar]
- [7].Davis DR, Durant PC, Nucleoside modifications affect the structure and stability of the anticodon of tRNALys3, Nucleosides Nucleotides. 18 (1999) 1579–1581. [DOI] [PubMed] [Google Scholar]
- [8].Cabello-Villegas J, Winkler ME, Nikonowicz EP, Solution Conformations of Unmodified and A37N6-dimethylallyl Modified Anticodon Stem-loops of Escherichia coli tRNAPhe, Journal of Molecular Biology. 319 (2002) 1015–1034. doi: 10.1016/S0022-2836(02)00382-0. [DOI] [PubMed] [Google Scholar]
- [9].Cabello-Villegas J, Solution structure of ψ32-modified anticodon stem-loop of Escherichia coli tRNAPhe, Nucleic Acids Research. 33 (2005) 6961–6971. doi: 10.1093/nar/gki1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Denmon AP, Wang J, Nikonowicz EP, Conformation Effects of Base Modification on the Anticodon Stem–Loop of Bacillus subtilis tRNATyr, Journal of Molecular Biology. 412 (2011) 285–303. doi: 10.1016/j.jmb.2011.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Yarian C, Townsend H, Czestkowski W, Sochacka E, Malkiewicz AJ, Guenther R, et al. , Accurate Translation of the Genetic Code Depends on tRNA Modified Nucleosides, J. Biol. Chem 277 (2002) 16391–16395. doi: 10.1074/jbc.M200253200. [DOI] [PubMed] [Google Scholar]
- [12].Kurata S, Weixlbaumer A, Ohtsuki T, Shimazaki T, Wada T, Kirino Y, et al. , Modified Uridines with C5-methylene Substituents at the First Position of the tRNA Anticodon Stabilize U·G Wobble Pairing during Decoding, J. Biol. Chem 283 (2008) 18801–18811. doi: 10.1074/jbc.M800233200. [DOI] [PubMed] [Google Scholar]
- [13].Phelps SS, Malkiewicz A, Agris PF, Joseph S, Modified Nucleotides in tRNALys and tRNAVal are Important for Translocation, Journal of Molecular Biology. 338 (2004) 439–444. doi: 10.1016/j.jmb.2004.02.070. [DOI] [PubMed] [Google Scholar]
- [14].Cantara WA, Bilbille Y, Kim J, Kaiser R, Leszczyńska G, Malkiewicz A, et al. , Modifications modulate anticodon loop dynamics and codon recognition of E. coli tRNAArg1,2, Journal of Molecular Biology. 416 (2012) 579–597. doi: 10.1016/j.jmb.2011.12.054. [DOI] [PubMed] [Google Scholar]
- [15].Ashraf SS, Sochacka E, Cain R, Guenther R, Malkiewicz A, Agris PF, Single atom modification (O-->S) of tRNA confers ribosome binding, RNA. 5 (1999) 188–194. doi: 10.1017/s1355838299981529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Li J, Esberg B, Curran JF, Björk GR, Three modified nucleosides present in the anticodon stem and loop influence the in vivo aa-tRNA selection in a tRNA-dependent manner, Journal of Molecular Biology. 271 (1997) 209–221. doi: 10.1006/jmbi.1997.1176. [DOI] [PubMed] [Google Scholar]
- [17].Chiari Y, Dion K, Colborn J, Parmakelis A, Powell JR, On the possible role of tRNA base modifications in the evolution of codon usage: queuosine and Drosophila, J. Mol. Evol 70 (2010) 339–345. doi: 10.1007/s00239-010-9329-z. [DOI] [PubMed] [Google Scholar]
- [18].Ninio J, Multiple stages in codon-anticodon recognition: double-trigger mechanisms and geometric constraints, Biochimie. 88 (2006) 963–992. doi: 10.1016/j.biochi.2006.06.002. [DOI] [PubMed] [Google Scholar]
- [19].Urbonavicius J, Qian Q, Durand JM, Hagervall TG, Björk GR, Improvement of reading frame maintenance is a common function for several tRNA modifications, Embo J. 20 (2001) 4863–4873. doi: 10.1093/emboj/20.17.4863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20].Björk GR, Durand JM, Hagervall TG, Leipuviene R, Lundgren HK, Nilsson K, et al. , Transfer RNA modification: influence on translational frameshifting and metabolism, FEBS Lett. 452 (1999) 47–51. doi: 10.1016/s0014-5793(99)00528-1. [DOI] [PubMed] [Google Scholar]
- [21].Brierley I, Meredith MR, Bloys AJ, Hagervall TG, Expression of a coronavirus ribosomal frameshift signal in Escherichia coli: influence of tRNA anticodon modification on frameshifting, Journal of Molecular Biology. 270 (1997) 360–373. doi: 10.1006/jmbi.1997.1134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Agris PF, Vendeix FAP, Graham WD, tRNA’s Wobble Decoding of the Genome: 40 Years of Modification, Journal of Molecular Biology. 366 (2007) 1–13. doi: 10.1016/j.jmb.2006.11.046. [DOI] [PubMed] [Google Scholar]
- [23].Vendeix FAP, Dziergowska A, Gustilo EM, Graham WD, Sproat B, Malkiewicz A, et al. , Anticodon domain modifications contribute order to tRNA for ribosome-mediated codon binding, Biochemistry. 47 (2008) 6117–6129. doi: 10.1021/bi702356j. [DOI] [PubMed] [Google Scholar]
- [24].Stuart JW, Koshlap KM, Guenther R, Agris PF, Naturally-occurring modification restricts the anticodon domain conformational space of tRNAPhe, Journal of Molecular Biology. 334 (2003) 901–918. doi: 10.1016/j.jmb.2003.09.058. [DOI] [PubMed] [Google Scholar]
- [25].Sundaram M, Durant PC, Davis DR, Hypermodified nucleosides in the anticodon of tRNALys stabilize a canonical U-turn structure, Biochemistry. 39 (2000) 12575–12584. doi: 10.1021/bi0014655. [DOI] [PubMed] [Google Scholar]
- [26].Chakraburtty K, Primary structure of tRNAIIArg of E. coli B, Nucleic Acids Research. 2 (1975) 1787–1792. doi: 10.1093/nar/2.10.1787. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27].Murao K, Tanabe T, Ishii F, Namiki M, Nishimura S, Primary sequence of arginine transfer RNA from Escherichia coli, Biochem. Biophys. Res. Commun 47 (1972) 1332–1337. doi: 10.1016/0006-291x(72)90218-5. [DOI] [PubMed] [Google Scholar]
- [28].Sissler M, Giegé R, Florentz C, Arginine aminoacylation identity is context-dependent and ensured by alternate recognition sets in the anticodon loop of accepting tRNA transcripts, Embo J. 15 (1996) 5069–5076. [PMC free article] [PubMed] [Google Scholar]
- [29].Tamura K, Himeno H, Asahara H, Hasegawa T, Shimizu M, In vitro study of E.coli tRNAArg and tRNALys identity elements, Nucleic Acids Research. 20 (1992) 2335–2339. doi: 10.1093/nar/20.9.2335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Kumar RK, Davis DR, Synthesis and studies on the effect of 2-thiouridine and 4-thiouridine on sugar conformation and RNA duplex stability, Nucleic Acids Research. 25 (1997) 1272–1280. doi: 10.1093/nar/25.6.1272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Romby P, Carbon P, Westhof E, Ehresmann C, Ebel JP, Ehresmann B, et al. , Importance of conserved residues for the conformation of the T-loop in tRNAs, J. Biomol. Struct. Dyn 5 (1987) 669–687. doi: 10.1080/07391102.1987.10506419. [DOI] [PubMed] [Google Scholar]
- [32].McCloskey JA, Graham DE, Zhou S, Crain PF, Ibba M, Konisky J, et al. , Post-transcriptional modification in archaeal tRNAs: identities and phylogenetic relations of nucleotides from mesophilic and hyperthermophilic Methanococcales, Nucleic Acids Research. 29 (2001) 4699–4706. doi: 10.1093/nar/29.22.4699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33].Auffinger P, Westhof E, Location and distribution of modified nucleotides in tRNA, Modification and Editing of RNA, 1998. [Google Scholar]
- [34].Boccaletto P, Machnicka MA, Purta E, Piatkowski P, Baginski B, Wirecki TK, et al. , MODOMICS: a database of RNA modification pathways. 2017 update, Nucleic Acids Research. 46 (2018) D303–D307. doi: 10.1093/nar/gkx1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [35].Sprinzl M, Vassilenko KS, Compilation of tRNA sequences and sequences of tRNA genes, Nucleic Acids Research. 33 (2005) D139–40. doi: 10.1093/nar/gki012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36].Auffinger P, Westhof E, Singly and bifurcated hydrogen-bonded base-pairs in tRNA anticodon hairpins and ribozymes, Journal of Molecular Biology. 292 (1999) 467–483. doi: 10.1006/jmbi.1999.3080. [DOI] [PubMed] [Google Scholar]
- [37].Crick FH, Codon--anticodon pairing: the wobble hypothesis, Journal of Molecular Biology. 19 (1966) 548–555. doi: 10.1016/s0022-2836(66)80022-0. [DOI] [PubMed] [Google Scholar]
- [38].Curran JF, Decoding with the A:I wobble pair is inefficient, Nucleic Acids Research. 23 (1995) 683–688. doi: 10.1093/nar/23.4.683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [39].Letzring DP, Dean KM, Grayhack EJ, Control of translation efficiency in yeast by codon-anticodon interactions, RNA. 16 (2010) 2516–2528. doi: 10.1261/rna.2411710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [40].Letzring DP, Wolf AS, Brule CE, Grayhack EJ, Translation of CGA codon repeats in yeast involves quality control components and ribosomal protein L1, RNA. 19 (2013) 1208–1217. doi: 10.1261/rna.039446.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Durant PC, Bajji AC, Sundaram M, Kumar RK, Davis DR, Structural effects of hypermodified nucleosides in the Escherichia coli and human tRNALys anticodon loop: the effect of nucleosides s2U, mcm5U, mcm5s2U, mnm5s2U, t6A, and ms2t6A, Biochemistry. 44 (2005) 8078–8089. doi: 10.1021/bi050343f. [DOI] [PubMed] [Google Scholar]
- [42].Testa SM, Disney MD, Turner DH, Kierzek R, Thermodynamics of RNA RNA duplexes with 2- or 4-thiouridines: implications for antisense design and targeting a group I intron, Biochemistry. 38 (1999) 16655–16662. doi: 10.1021/bi991187d. [DOI] [PubMed] [Google Scholar]
- [43].Saenger W, Principles of Nucleic Acid Structure, Springer Science & Business Media, 2013. [Google Scholar]
- [44].Bilbille Y, Vendeix FAP, Guenther R, Malkiewicz A, Ariza X, Vilarrasa J, et al. , The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs, Nucleic Acids Research. 37 (2009) 3342–3353. doi: 10.1093/nar/gkp187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [45].Agris PF, Söll D, Seno T, Biological function of 2-thiouridine in Escherichia coli glutamic acid transfer ribonucleic acid, Biochemistry. 12 (1973) 4331–4337. doi: 10.1021/bi00746a005. [DOI] [PubMed] [Google Scholar]
- [46].Sierzputowska-Gracz H, Sochacka E, Malkiewicz A, Kuo K, Gehrke CW, Agris PF, Chemistry and structure of modified uridines in the anticodon, wobble position of transfer RNA are determined by thiolation, J. Am. Chem. Soc 109 (1987) 7171–7177. doi: 10.1021/ja00257a044. [DOI] [Google Scholar]
- [47].Baumann U, Fischer W, Sprinzl M, Analysis of modification-dependent structural alterations in the anticodon loop of Escherichia coli tRNAArg and their effects on the translation of MS2 RNA, Eur. J. Biochem 152 (1985) 645–649. doi: 10.1111/j.1432-1033.1985.tb09243.x. [DOI] [PubMed] [Google Scholar]
- [48].Shi H, Moore PB, The crystal structure of yeast phenylalanine tRNA at 1.93 A resolution: a classic structure revisited, RNA. 6 (2000) 1091–1105. doi: 10.1017/s1355838200000364. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [49].Grosjean H, Westhof E, An integrated, structure- and energy-based view of the genetic code, Nucleic Acids Research. 44 (2016) 8020–8040. doi: 10.1093/nar/gkw608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [50].Auffinger P, Westhof E, An extended structural signature for the tRNA anticodon loop, RNA. 7 (2001) 334–341. doi: 10.1017/s1355838201002382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [51].Olejniczak M, Uhlenbeck OC, tRNA residues that have coevolved with their anticodon to ensure uniform and accurate codon recognition, Biochimie. 88 (2006) 943–950. doi: 10.1016/j.biochi.2006.06.005. [DOI] [PubMed] [Google Scholar]
- [52].Stephen A Scaringe A Francine E Wincott, Caruthers MH, Novel RNA Synthesis Method Using 5’-O-Silyl-2’-O-orthoester Protecting Groups, American Chemical Society, 1998. doi: 10.1021/ja980730v. [DOI] [Google Scholar]
- [53].Hartsel SA, Kitchen DE, Scaringe SA, Marshall WS, RNA oligonucleotide synthesis via 5“-silyl-2-”orthoester chemistry, Methods Mol. Biol 288 (2005) 33–50. [DOI] [PubMed] [Google Scholar]
- [54].Ogle JM, Brodersen DE, Clemons WM, Tarry MJ, Carter AP, Ramakrishnan V, Recognition of cognate transfer RNA by the 30S ribosomal subunit, Science. 292 (2001) 897–902. doi: 10.1126/science.1060612. [DOI] [PubMed] [Google Scholar]
- [55].Ogle JM, Murphy FV, Tarry MJ, Ramakrishnan V, Selection of tRNA by the ribosome requires a transition from an open to a closed form, Cell. 111 (2002) 721–732. doi: 10.1016/s0092-8674(02)01086-3. [DOI] [PubMed] [Google Scholar]
- [56].Ashraf SS, Guenther RH, Ansari G, Malkiewicz A, Sochacka E, Agris PF, Role of modified nucleosides of yeast tRNAPhe in ribosomal binding, Cell Biochem. Biophys 33 (2000) 241–252. doi: 10.1385/CBB:47:1:159. [DOI] [PubMed] [Google Scholar]
- [57].Murphy FV, Ramakrishnan V, Structure of a purine-purine wobble base pair in the decoding center of the ribosome, Nat. Struct. Mol. Biol 11 (2004) 1251–1252. doi: 10.1038/nsmb866. [DOI] [PubMed] [Google Scholar]
- [58].Weixlbaumer A, Murphy FV, Dziergowska A, Malkiewicz A, Vendeix FAP, Agris PF, et al. , Mechanism for expanding the decoding capacity of transfer RNAs by modification of uridines, Nat. Struct. Mol. Biol 14 (2007) 498–502. doi: 10.1038/nsmb1242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [59].Vendeix FAP, Murphy IV FV, Cantara WA, Leszczyńska G, Gustilo EM, Sproat B, et al. , Human tRNALys3UUU Is Pre-Structured by Natural Modifications for Cognate and Wobble Codon Binding through Keto–Enol Tautomerism, Journal of Molecular Biology. 416 (2012) 467–485. doi: 10.1016/j.jmb.2011.12.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [60].Klug A, Robertus JD, Ladner JE, Brown RS, Finch JT, Conservation of the molecular structure of yeast phenylalanine transfer RNA in two crystal forms, Proc Natl Acad Sci USA. 71 (1974) 3711–3715. doi: 10.1073/pnas.71.9.3711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [61].Quigley GJ, Rich A, Structural domains of transfer RNA molecules, Science. 194 (1976) 796–806. doi: 10.1126/science.790568. [DOI] [PubMed] [Google Scholar]
- [62].Jucker FM, Pardi A, GNRA tetraloops make a U-turn, RNA. 1 (1995) 219–222. [PMC free article] [PubMed] [Google Scholar]
- [63].Suddath FL, Quigley GJ, McPherson A, Sneden D, Kim JJ, Kim SH, et al. , Three-dimensional structure of yeast phenylalanine transfer RNA at 3. 0Å resolution, Nature. 248 (1974) 20–24. doi: 10.1038/248020a0. [DOI] [PubMed] [Google Scholar]
- [64].Phizicky EM, Hopper AK, tRNA biology charges to the front, Genes Dev. 24 (2010) 1832–1860. doi: 10.1101/gad.1956510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [65].Jaroensuk J, Atichartpongkul S, Yok Hian C, Wong YH, Chong Wai L, Megan EM, et al. , Methylation at position 32 of tRNA catalyzed by TrmJ alters oxidative stress response in Pseudomonas aeruginosa, Nucleic Acids Research. 44 (2016) 10834–10848. doi: 10.1093/nar/gkw870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [66].Sokołowski M, Klassen R, Bruch A, Schaffrath R, Glatt S, Cooperativity between different tRNA modifications and their modification pathways, Biochimica Et Biophysica Acta (BBA) - Gene Regulatory Mechanisms. 1861 (2018) 409–418. doi: 10.1016/j.bbagrm.2017.12.003. [DOI] [PubMed] [Google Scholar]
- [67].Pintard L, Lecointe F, Bujnicki JM, Bonnerot C, Grosjean H, Lapeyre B, Trm7p catalyses the formation of two 2′-O-methylriboses in yeast tRNA anticodon loop, Embo J. 21 (2002) 1811–1820. doi: 10.1093/emboj/21.7.1811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [68].Yamada Y, Saneyoshi M, Nishimura S, Ishikura H, Isolation and characterization of 2-thiocytidine from a serine transfer ribonucleic acid of Escherichia coli, FEBS Lett. 7 (1970) 207–210. doi: 10.1016/0014-5793(70)80161-2. [DOI] [PubMed] [Google Scholar]
- [69].Jäger G, Leipuviene R, Pollard MG, Qian Q, Björk GR, The Conserved Cys-X1-X2-Cys Motif Present in the TtcA Protein Is Required for the Thiolation of Cytidine in Position 32 of tRNA from Salmonella enterica serovar Typhimurium, Journal of Bacteriology. 186 (2004) 750–757. doi: 10.1128/JB.186.3.750-757.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [70].Deng W, Babu IR, Su D, Yin S, Begley TJ, Dedon PC, Trm9-catalyzed tRNA modifications regulate global protein expression by codon-biased translation, PLOS Genetics. 11 (2015) e1005706. doi: 10.1371/journal.pgen.1005706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [71].Gu C, Begley TJ, Dedon PC, tRNA modifications regulate translation during cellular stress, FEBS Lett. 588 (2014) 4287–4296. doi: 10.1016/j.febslet.2014.09.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [72].Dedon PC, Begley TJ, A system of RNA modifications and biased codon use controls cellular stress response at the level of translation, Chem. Res. Toxicol 27 (2014) 330–337. doi: 10.1021/tx400438d. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [73].Endres L, Dedon PC, Begley TJ, Codon-biased translation can be regulated by wobble-base tRNA modification systems during cellular stress responses, RNA Biology. 12 (2015) 603–614. doi: 10.1080/15476286.2015.1031947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [74].Kane JF, Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli, Curr. Opin. Biotechnol 6 (1995) 494–500. [DOI] [PubMed] [Google Scholar]
- [75].Wolf AS, Grayhack EJ, Asc1, homolog of human RACK1, prevents frameshifting in yeast by ribosomes stalled at CGA codon repeats, RNA. 21 (2015) 935–945. doi: 10.1261/rna.049080.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [76].Quax TEF, Claassens NJ, Söll D, van der Oost J, Codon Bbias as a means to fine-tune gene expression, Molecular Cell. 59 (2015) 149–161. doi: 10.1016/j.molcel.2015.05.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [77].Pixa G, Dirheimer G, Keith G, Sequence of tRNAIAUIle from brewer’s yeast, Biochem. Biophys. Res. Commun 119 (1984) 905–912. doi: 10.1016/0006-291x(84)90859-3. [DOI] [PubMed] [Google Scholar]
- [78].Sosnick TR, Characterization of Tertiary Folding of RNA by Circular Dichroism and Urea, Current Protocols in Nucleic Acid Chemistry. 4 (2001) 11.5.1–11.5.10. doi: 10.1002/0471142700.nc1105s04. [DOI] [PubMed] [Google Scholar]
- [79].Wong I, Lohman TM, A double-filter method for nitrocellulose-filter binding: application to protein-nucleic acid interactions, Proc Natl Acad Sci USA. 90 (1993) 5428–5432. doi: 10.1073/pnas.90.12.5428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [80].Fahlman RP, Dale T, Uhlenbeck OC, Uniform Binding of Aminoacylated Transfer RNAs to the Ribosomal A and P Sites, Molecular Cell. 16 (2004) 799–805. doi: 10.1016/j.molcel.2004.10.030. [DOI] [PubMed] [Google Scholar]
- [81].Leder P, Bursztyn H, Initiation of protein synthesis: the role of formyl-accepting methionyl-tRNA, Cold Spring Harb. Symp. Quant. Biol 31 (1966) 297–301. doi: 10.1101/sqb.1966.031.01.039. [DOI] [PubMed] [Google Scholar]
- [82].Maurizio B, Liquin X, Alexander M, 23S rRNA positions essential for tRNA binding in ribosomal functional sites, Proc Natl Acad Sci USA. 95 (1998) 3525–3530. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [83].Rakauskaite R, Dinman JD, rRNA mutants in the yeast peptidyltransferase center reveal allosteric information networks and mechanisms of drug resistance, Nucleic Acids Research. 36 (2008) 1497–1507. doi: 10.1093/nar/gkm1179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [84].Das D, Samanta D, Bhattacharya A, Basu A, Das A, Ghosh J, et al. , A possible role of the full-length nascent protein in post-translational ribosome recycling, PLoS ONE. 12 (2017) e0170333. doi: 10.1371/journal.pone.0170333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [85].Clemons WM, Brodersen DE, McCutcheon JP, May JL, Carter AP, Morgan-Warren RJ, et al. , Crystal structure of the 30 S ribosomal subunit from Thermus thermophilus: purification, crystallization and structure determination, Journal of Molecular Biology. 310 (2001) 827–843. doi: 10.1006/jmbi.2001.4778. [DOI] [PubMed] [Google Scholar]
- [86].Kabsch W, IUCr, Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants, J Appl Crystallogr. 26 (1993) 795–800. doi: 10.1107/S0021889893005588. [DOI] [Google Scholar]
- [87].Adams PD, Afonine PV, Bunkóczi G, Chen VB, Davis IW, Echols N, et al. , PHENIX: a comprehensive Python-based system for macromolecular structure solution, Acta Crystallogr. D Biol. Crystallogr 66 (2010) 213–221. doi: 10.1107/S0907444909052925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [88].Emsley P, Cowtan K, Coot: model-building tools for molecular graphics, Acta Crystallogr. D Biol. Crystallogr 60 (2004) 2126–2132. doi: 10.1107/S0907444904019158. [DOI] [PubMed] [Google Scholar]
- [89].DeLano WL, Delano Scientific, San Carlos, CA, USA, (n.d.). [Google Scholar]
- [90].Moriarty NW, Grosse-Kunstleve RW, Adams PD, electronic Ligand Builder and Optimization Workbench (eLBOW): a tool for ligand coordinate and restraint generation, Acta Crystallogr. D Biol. Crystallogr 65 (2009) 1074–1080. doi: 10.1107/S0907444909029436. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [91].Cornell WD, Cieplak P, Bayly CI, Gould IR, Merz KM, Ferguson DM, et al. , A second generation force field for the simulation of proteins, nucleic acids, and organic molecules, J. Am. Chem. Soc 117 (1995) 5179–5197. doi: 10.1021/ja00124a002. [DOI] [Google Scholar]
- [92].Chen AA, García AE, High-resolution reversible folding of hyperstable RNA tetraloops using molecular dynamics simulations, Proc. Natl. Acad. Sci. U.S.a 110 (2013) 16820–16825. doi: 10.1073/pnas.1309392110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [93].MOE (The Molecular Operating Environment) Version 2013.08, (n.d.).
- [94].Hess B, Kutzner C, van der Spoel D, Lindahl E, GROMACS 4: Algorithms for highly efficient, load-balanced, and scalable molecular simulation, J Chem Theory Comput. 4 (2008) 435–447. doi: 10.1021/ct700301q. [DOI] [PubMed] [Google Scholar]
- [95].Bussi G, Donadio D, Parrinello M, Canonical sampling through velocity rescaling, The Journal of Chemical Physics. 126 (2007) 014101. doi: 10.1063/1.2408420. [DOI] [PubMed] [Google Scholar]
- [96].Berendsen HJC, Postma JPM, van Gunsteren WF, DiNola A, Haak JR, Molecular dynamics with coupling to an external bath, The Journal of Chemical Physics. 81 (1998) 3684–3690. doi: 10.1063/1.448118. [DOI] [Google Scholar]
- [97].Parrinello M, Rahman A, Polymorphic transitions in single crystals: A new molecular dynamics method, Journal of Applied Physics. 52 (1998) 7182–7190. doi: 10.1063/1.328693. [DOI] [Google Scholar]
- [98].Darden T, York D, Pedersen L, Particle mesh Ewald: An N·log(N) method for Ewald sums in large systems, The Journal of Chemical Physics. 98 (1998) 10089–10092. doi: 10.1063/1.464397. [DOI] [Google Scholar]
- [99].Hess B, Bekker H, Berendsen HJC, Fraaije JGEM, LINCS: A linear constraint solver for molecular simulations, Journal of Computational Chemistry. 18 (1997) 1463–1472. doi: 10.1002/(SICI)1096-987X(199709)18:12<1463::AIDJCC4>3.0.CO;2-H. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
