Yorkie growth promoting activity is limited by Atg1-mediated phosphorylation

Summary:

The expression of multiple growth-promoting genes is coordinated by the transcriptional co-activator Yorkie with its major regulatory input provided by the Hippo/Warts kinase cascade. Here, we identify Atg1/ULK1-mediated phosphorylation of Yorkie as an additional inhibitory input independent of the Hippo/Warts pathway. Two serine residues in Yorkie, S74 and S97, are Atg1/ULK1 consensus target sites and are phosphorylated by ULK1 in vitro, thereby preventing its binding to Scalloped. In vivo, gain-of-function of Atg1, or its activator Acinus, caused elevated Yorkie phosphorylation and inhibited Yorkie’s growth promoting activity. Loss of function of Atg1 or Acinus raised expression of Yorkie target genes and increased tissue size. Unlike Atg1’s role in autophagy, Atg1-mediated phosphorylation of Yorkie does not require Atg13. Atg1 is activated by starvation and other cellular stressors and therefore can impose temporary stress-induced constraints on the growth-promoting gene networks under control of Hippo/Yorkie signaling.

GRAPHICAL ABSTRACT

eTOC

During development or regeneration of Drosophila tissues, growth is promoted by the Yorkie transcriptional cofactor under control of the Hippo signaling pathway. Tyra et al. identify an additional pathway that can regulate Yorkie activity through Atg1-mediated phosphorylation, thereby constraining its activity under conditions of environmental stress.

Introduction:

A fundamental problem in developmental biology is how intrinsic mechanisms that determine growth and final tissue size are coordinated with temporary environmental challenges, such as nutrient deprivation. One major growth-regulating signaling pathway that includes the core Hippo/Warts kinase cascade and the Yorkie transcriptional co-activator was discovered by forward genetic screens in Drosophila (Hamaratoglu et al., 2006; Harvey et al., 2003; Huang et al., 2005; Udan et al., 2003; Wu et al., 2003). The Hippo and Warts kinases receive diverse inputs reporting on the size and shape of tissues, cell contacts and the ensuing mechanical forces (Codelia et al., 2014; Halder et al., 2012; Hariharan, 2015). The major readout of this pathway is the Warts-mediated phosphorylation of Yorkie at three distinct serine residues, S111, S168, and S250, the most important one being S168 (Dong et al., 2007; Oh and Irvine, 2008; Zhao et al., 2007). Phosphorylated Yorkie binds to 14-3-3 proteins (Oh and Irvine, 2009; Ren et al., 2010), which sequesters Yorkie in the cytosol and thereby inhibits its function as growth-promoting transcriptional co-activator (Wu et al., 2008; Zhang et al., 2008). This pathway is highly conserved in vertebrates as well, with the Yorkie homologs YAP and TAZ as effectors of the core kinase cascade consisting of the MST1/2 and LTS1/2 kinases (Johnson and Halder, 2014; Plouffe et al., 2015). In addition to input from the canonical Hippo/Warts cascade, the activity of Yorkie and its mammalian homologs is also modified by other inputs responsive to diverse cellular stressors and metabolic changes (Mo et al., 2015; Nguyen et al., 2013; Santinon et al., 2016; Wehr et al., 2013; Zheng and Pan, 2019).

Acinus has emerged as a signaling node that integrates multiple cellular stress signals (Nandi and Kramer, 2018b). Acinus is a conserved subunit of the nuclear ASAP complex (Murachelli et al., 2012; Schwerk et al., 2003), that interacts with the exon junction complex and participates in alternative RNA splicing (Hayashi et al., 2014; Malone et al., 2014; Rodor et al., 2016). However, genetic experiments in Drosophila revealed a second role for Acinus as inducer of starvation-independent, basal autophagy (Haberman et al., 2010). Acinus levels and its pro-autophagy activity are promoted by stress-regulated kinases, including Cdk5, p38b MAP kinase, and Akt1, and suppressed by non-apoptotic caspase cleavage (Nandi et al., 2017; Nandi et al., 2014). The specific mechanisms by which Acinus promotes basal autophagy remain unclear, but an eye-specific Acinus gain-of-function model revealed a requirement for the Atg1 kinase (Nandi et al., 2014). This suggests Acinus may activate Atg1 by a starvation-independent pathway (Nandi and Kramer, 2018a).

Atg1, like its mammalian homologs ULK1/2, is a serine/threonine kinase that regulates multiple core autophagy proteins through phosphorylation (Egan et al., 2015; Papinski et al., 2014; Park et al., 2016; Russell et al., 2013; Wold et al., 2016). Thereby, Atg1 induces the formation of autophagosomes and promotes their maturation (Mizushima, 2010). Atg1-mediated activation of autophagy requires release from the mTor-imposed inhibitory phosphorylation of the Atg1/ULK1 complex (Egan et al., 2011; Kim et al., 2011; Shang et al., 2011; Zhao and Klionsky, 2011) and the engagement of Atg1 in a protein complex that contains Atg13, and FIP200/Atg17 and other species-specific cofactors (Lin and Hurley, 2016; Zachari and Ganley, 2017).

Here, we describe a role for Atg1 in phosphorylating Yorkie and the resulting inhibition of its growth-promoting activity. We identify two sites at S74 and S97, that match the previously described consensus motifs for Atg1 and ULK1 (Egan et al., 2015; Papinski et al., 2014) and are phosphorylated by ULK1 in vitro. In vivo, Atg1 or Acinus gain-of-function interfere with Yorkie’s growth promoting activity, whereas Atg1 or Acinus loss-of-function enhance expression of Yorkie target genes. These findings reveal a stress-induced mechanism that can inhibit Yorkie activity independently of the canonical Hippo/Warts pathway.

Results

Acinus and Atg1 suppress Yorkie activity

In the context of genetic screens aimed at identifying regulators of Acinus activity (Nandi et al., 2017; Nandi et al., 2014), we noticed suppression of the Acinus-induced rough eye by deficiencies removing genes in the Hippo/Yorkie pathway or by Hippo RNAi (Supplemental Figure S1A–F). Further testing of hippo null clones revealed, however, no changes in levels of Acinus or its phosphorylation on key regulatory sites (Supplemental Figure S1G–I). We therefore tested whether, alternatively, Acinus overexpression may alter signaling through the Hippo/Yorkie pathway. Eye-specific expression of the mutant Yorkie^S168A protein, which lacks its major Warts phosphorylation target, causes dramatic eye overgrowth (Figure 1A, B and Dong et al., 2007; Oh and Irvine, 2009). This phenotype was suppressed by co-expression of Acinus which resulted in a small rough eye (Figure 1C,D).

Figure 1. Acinus and Atg1 interact genetically with Yorkie gain-of-function.

(A-L) SEM images of eyes either expressing only GMR-Gal4 (A) or with GMR-Gal4 driving expression of UAS-Yorkie^S168A (B), UAS-Acn (C), UAS-Yorkie^S168A and UAS-Acn (D), UAS-Atg1 (E), UAS-Yorkie^S168A and UAS- Atg1 (F), UAS-Atg1^K38Q (G), UAS-Yorkie^S168A and UAS-Atg1^K38Q (H), UAS-Atg13 (I), UAS-Yorkie^S168A and UAS-Atg13 (J), UAS-Atg6 (K), UAS-Yorkie^S168A and UAS-Atg6 (L). Scale bar indicates 100 μm in A-L. All crosses were repeated at least three times. For quantification see Supplemental table S1.

(M) Quantification of the survival of flies expressing under GMR-Gal4 control either UAS-Yorkie^{S111,168,250A} alone or together with UAS-Acinus or UAS-Atg1. Scatter plot of average ratios between the indicated genotypes and the sibling controls lacking the GMR-Gal4 drivers (Atg1) or the UAS-Yorkie^{S111,168,250A} transgene (Acinus). Data are from three independent crosses per genotype with at least 140 flies each. Lines indicate means and standard deviations, (Student’s t-test: * p < 0.05,*** p<0.001).

See also Figures S1 and S2 and Tables S1. Detailed genotypes are listed in Table S2.

Acinus overexpression induces elevated autophagy levels (Haberman et al., 2010; Nandi et al., 2017). We therefore wondered whether expression of other autophagy genes yielded similar suppression of Yorkie-induced overgrowth. We found that Yorkie^S168A-induced eye overgrowth was also suppressed by co-expression of the Atg1 kinase (Figure 1E,F, Supplemental Table S1), but not the Atg1^K38Q mutant (Figure 1G,H, Supplemental Table S1) which lacks kinase activity (Scott et al., 2007). Furthermore, co-expression of Atg13 (Figure 1I,J, Supplemental Table S1), an Atg1 cofactor for the induction of autophagy (Chang and Neufeld, 2009), or of Atg6 failed to suppress overgrowth induced by Yorkie^S168A (Figure 1K,L, Supplemental Table S1). Nevertheless, similar to Atg1 or Acinus (Nandi et al., 2017), GMR-Gal4-driven Atg6/Beclin1 overexpression was sufficient to induce elevated levels of Atg8a punctae in developing eye discs (Supplemental Figure S2), consistent with the known role of Atg6/Beclin1 as an inducer of autophagy (Levine et al., 2015).

To test whether Acinus and Atg1 act upstream of Yorkie on elements of the core Hippo/Warts pathway, we used the triple mutant UAS-Yorkie^{S111,168,250A} transgene. In this Yorkie mutant the three known target sites for Warts phosphorylation are mutated, thereby largely insulating Yorkie from input of the Hippo and Warts kinases and resulting in excessive tissue overgrowth and greatly reduced viability upon GMR-Gal4-driven expression (Oh and Irvine, 2009). Lethality of Yorkie^{S110,168,250A} expression was, however, effectively suppressed by Acinus or Atg1 co-expression (Figure 1M), indicating that both acted to suppress Yorkie activity independently of the upstream elements of the core Hippo/Warts pathway.

To test whether the Atg1/Acinus-mediated suppression reflects changes in the expression of downstream elements of the Hippo/Yorkie pathway, we explored expression of previously established Yorkie target genes (Hamaratoglu et al., 2006; Huang et al., 2005; Jia et al., 2003; Nolo et al., 2006; Ryoo et al., 2002; Thompson and Cohen, 2006; Zhang et al., 2008). Elevated expression of bantam, as detected by a ban-lacZ transcriptional reporter in the endogenous locus (Herranz et al., 2012), was induced in eye discs posterior to the furrow upon GMR-Gal4-driven Yki^S168A expression (Figure 2A,B). This increase was suppressed when Atg1 was co-expressed (Figure 2C). Similarly, GMR-Gal4-driven Yki^S168A expression increased the levels of Expanded (Ex) (Figure 2D,E) and Diap1/Thread (Figure 2G,H). Their induction was suppressed, however, when Atg1 was co-expressed with Yki^S168A (Figure 2F,I). Furthermore, clonal expression of Yki in wing discs triggered neoplastic growth (Oh and Irvine, 2008) with elevated levels of Ex and Diap1 (Figure 2J,K,N,O). Co-expression of Atg1 resulted in smaller clones with reduced Ex and Diap1 levels (Figure 2L,M,P,Q).

Figure 2. Atg1 overexpression suppresses Yorkie target genes.

(A-I) Confocal images of third instar eye discs stained for the ban-LacZ reporter (A-C) or for endogenous Ex (D-F) or Diap1 (G-I) proteins. All larvae contained the GMR-Gal4 driver and, as indicated, expressed only UAS-Yki^S168A (B,E,H) or UAS-Yki^S168A together with UAS-Atg1 (C,F,I). Arrowheads indicate the morphogenetic furrow. Posterior is to the right.

(J-Q) Confocal images of third instar wing discs stained for endogenous Ex (J-M) or Diap1 (N-Q) proteins. Clonal expression of UAS-GFP and UAS-Yki without (J,K,N,O) or together with UAS-Atg1 (L,M,P,Q) was driven from a Gal4-Act5C(FRT.CD2) cassette upon hsFLP-mediated activation. Images are representative examples from at least three independent crosses with 5 or more examples each.

Scale bars in A = 50 μm (A-I), in J = 100 μm (J-Q). Detailed genotypes are listed in Table S2.

Next, we tested whether the genetic interactions we observed with these yorkie gain-of-function models extended to endogenous yorkie as well. The size of Drosophila wings is sensitive to modulation of endogenous Yorkie activity thus offering a convenient model to interrogate changes in the level of Yorkie activity (Harvey et al., 2003; Huang et al., 2005; Nolo et al., 2006). Overexpression of Acinus with the en-Gal4 driver reduced the size of the posterior wing compartment (Fig. 3A,B). Effects on wing size caused by Acinus overexpression in the wing pouch using nubbin-Gal4 or MS1096-Gal4 drivers were more difficult to evaluate due to the severe morphological changes (Figure 3C–F). Atg1 overexpression with these drivers caused similarly severe wing deformation or even lethality.

Figure 3. Loss or overexpression of Acinus and Atg1 alter adult wing size.

(A-F) Micrographs of wings expressing only the indicated Gal4 drivers as controls (A,C,E) or UAS-Acn driven by those drivers (B,D,F). Scale bar = 200 μm.

(G-L) Box and whisker plots display adult wing sizes of flies expressing the indicated UAS-RNAi transgene targeting Acinus (G-I) or Atg1 (J-L) under the control of the indicated wing drivers: en-Gal4 (G,J), MS1096-Gal4 (H,K), or nubbin-Gal4 (I,L). Data are from 3 independent crosses with at least 15 wings per genotype. See example images in Figure S3.

(M) Table of wing sizes from flies with the indicated RNAi transgenes and Gal4 drivers. Data are from 3 independent crosses with 15 wings per genotype and displayed as mean ± standard deviation. ns: not significant, * (p < 0.05), ** (p < 0.01), *** (p < 0.001), or **** (p < 0.0001). Green stars indicate significantly increased, and red stars significantly decreased wing sizes.

Detailed genotypes are listed in Table S2.

Acinus or Atg1 loss-of-function experiments in the wing were more informative. Expression of two RNAi transgenes each for Acinus or Atg1 in different wing domains using three different Gal4 drivers (en-Gal4, nubbin-Gal4 and MS1096-Gal4) consistently increased wing size compared to control flies with only the Gal4 driver (Figure 3G–L, Supplemental Figure S3). Additionally, knockdown of Atg1 partially suppressed the lethality caused by Yki-RNAi. While 0% of the expected number of flies emerged when Yki-RNAi was expressed under control of the en-Gal4 driver, coexpression of Atg1-RNAi partially suppressed this lethality and yielded 15% of the expected adults.

By contrast to our findings with Atg1 and Acinus, knockdown of the core autophagy genes Atg5, Atg7, Atg8 or Atg18 did not consistently alter wing size (Figure 3M). With the single exception of Atg18 RNAi driven by nubbin-Gal4, wing sizes decreased as opposed to the increase observed with Acinus or Atg1 knockdown. Together these experiments suggest that Acinus and Atg1 alter Yorkie-dependent growth control during eye and wing development, but in a manner independent of their role in inducing autophagy.

Acinus and Atg1 regulate Yorkie-dependent transcription

We next tested whether the changes in wing sizes in response to Atg1 and Acinus knockdown are reflected in altered expression of Yorkie target genes. As a positive control we knocked down Hippo using the en-Gal4 driver. Consistent with previous reports of bantam as Yorkie target gene (Nolo et al., 2006; Thompson and Cohen, 2006), we observed elevated ban-lacZ expression within the posterior compartment marked by UAS-mCherry expression (Fig. 4A,B). Importantly, knockdown of Atg1 or Acinus also resulted in elevated ban-lacZ levels in the posterior wing (Figure 4C,D). Similarly, knockdown of Hippo, Atg1 or Acinus using the en-Gal4 driver resulted in increased expression of Diap1 (Figure 4E–H) and Expanded (Figure 4I–L) in the posterior wing, consistent with Atg1 and Acinus regulating the expression of these Yorkie target genes. These findings support the model that the genetic interactions of yorkie with acinus and atg1 reflect their direct effect on Yorkie-mediated transcriptional activity.

Figure 4. Loss of Acinus or Atg1 enhances expression of Yorkie target genes.

Confocal images of third instar wing discs stained for the ban-LacZ (A-D) reporter of Yorkie transcriptional activity, or the endogenous Diap1 (E-H) and Ex (I-L) proteins. All larvae contained the en-Gal4 driver and only UAS-mCherry (A,E,I), or, in addition, the indicated UAS-RNAi transgenes knocking down Hippo (B,F,J), Atg1 (C,G,K) or Acinus (D,H,L). The mCherry-marked posterior en-Gal4 expression domains are shown in (A’-L’). Images are representative examples from at least three independent crosses with 5 or more examples each. Scale bar = 100 μm. Detailed genotypes are listed in Table S2.

Atg1 phosphorylates Yorkie in vitro

Recent work in yeast and mammalian cells has established consensus motifs for Atg1/ULK1-dependent phosphorylation (Egan et al., 2015; Papinski et al., 2014). We identified two sites in Yorkie that match these motifs (Figure 5A). Consistent with the partial conservation of these sites, purified ULK1 kinase phosphorylated TAZ or YAP1 proteins in vitro (Figure 5B). To test the two sites individually, purified GST-Yorkie⁵³⁻¹¹⁹ fusion proteins, either wild type or mutants with the potential phosphorylation targets S74 or S97 individually or both changed to alanines, were exposed to purified ULK1 kinase and ATP. Site-specific phospho-Yorkie antibodies revealed phosphorylation at both sites (Figure 5C). In these in-vitro assays, phosphorylation at S74 induced a shift in mobility (red arrows) that affected a substantial fraction of the fusion protein and is dependent on the presence of S74 (Figure 5C). Previous work has indicated that YAP and TAZ require the serine residue equivalent to S97 for binding to TEAD (Chen et al., 2010; Kaan et al., 2017; Li et al., 2010; Tian et al., 2010). Similarly, S97 is required for GST-Yorkie⁵³⁻¹¹⁹ binding to the Scalloped transcription factor (Fig. 5D). Furthermore, phosphorylation of S97, but not S74, prevented GST-Yorkie⁵³⁻¹¹⁹ binding to Scalloped (Fig. 5E).

Figure 5: Atg1/ULK1 phosphorylates serine residues 74 and 97 of Yorkie.

(A) Diagram of Atg1 target consensus sequence, compared to potential phosphorylation sites at serines 74, and 97 in Yorkie and corresponding sites in human and mouse YAP and TAZ proteins.

(B) Auto-radiogram of in-vitro kinase assay shows phosphorylation of YAP1, and TAZ by ULK1.

(C) Western blots of purified wild-type (WT) or S74A, S97A, or S74,97A mutant GST-Yki⁵³⁻¹¹⁹ fusion proteins incubated with or without purified ULK1. Blots were developed with antibodies against GST (1:10,000), pS74-Yki (1:5,000), pS97-Yki (1:1,000). Red arrows indicate mobility shifts for S74-phosphorylated GST-Yki proteins.

D) Western blots of wild-type (WT) or S74A, S97A, or S74,97A mutant GST-Yki⁵³⁻¹¹⁹ fusion proteins bound to MagStrep beads without (−) or with immobilized Twin-Strep-tagged Myc-Sd protein (+). Proteins bound to the beads or found in flow-through were developed with antibodies against GST (1:1,000) or Myc (1:2,000).

E) Western blots of wild-type GST-Yki⁵³⁻¹¹⁹ incubated with or without purified ULK1 and bound to bead-immobilized Twin-Strep-tagged Myc-Sd protein. Proteins eluted from Myc-Sd-beads or found in flow-through were detected with antibodies against Myc (1:2,000), GST (1:1,000), pS74-Yki (1:2,000), or pS97-Yki (1:400). Western blots are representative images from three repeats.

(F-H) Confocal micrographs of fat body cells. A yki^B5 clone (−/−) marked by the absence of GFP (F’) lacks pS74 Yorkie staining (F). (G) Starved wild-type fat bodies exhibit nuclear pS74-Yorkie staining, which is missing in the CRISPR/Cas9-generated yki^S74A allele (H). Nuclei are shown in (G’ and H’). Scale bar = 50 μm.

See also Figure S4. Detailed genotypes are listed in Table S2.

To test the importance of these residues in vivo, we first compared eye overgrowth induced by GMRGal4-driven UAS-Yorkie^S168A and UAS-Yorkie^S74,168A transgenes, both lacking the major Warts phosphorylation site. Both were able to induce eye overgrowth (Supplemental Figure S4A,B) indicating that serine 74 is not necessary for Yorkie’s function. Furthermore, for both of these transgenes eye overgrowth was suppressed by co-expression of either Acinus or Atg1 (Supplemental Figure S4D,E,G,H). By contrast, the triple mutant transgene UAS-Yorkie^S74,97,168A expressed under GMR-Gal4 control was not able to induce eye-overgrowth (Supplemental Figure S4C). This is consistent with the previously established requirement of the corresponding residue for YAP binding to the TEAD transcription factor (Li et al., 2010) and with our in-vitro binding studies pointing to the critical role of S97 (Figure 5D,E).

Atg1 phosphorylates Yorkie in vivo.

Next, we tested whether the antibodies directed against either of these phosphorylation sites was suitable for in-vivo analysis. First, we generated yki^B5 loss-of-function clones in fat bodies (Figure 5F). While we could not detect any specific staining with the pS97-Yorkie antibody, staining with the pS74-Yorkie antibody was specific as indicated by the severely reduced signal in yki^B5 null clones (Figure 5F). Furthermore, using CRISPR/Cas9-mediated homology-directed mutagenesis, we generated two mutant yki alleles in which either S74 alone or S74 and S97 were mutated in the endogenous gene. Homozygous yki^S74,97A mutants were lethal. This is consistent with importance of S97 for Yorkie function described above (Figure 5D,E, Supplemental Figure S4) and the equivalent residue for YAP and TAZ function (Chen et al., 2010; Kaan et al., 2017; Li et al., 2010; Tian et al., 2010). By contrast, homozygous yki^S74A flies were viable and yki^S74A fat bodies showed substantially reduced staining with the pS74-Yorkie antibody (Figure 5 G,H), further indicating that, except for unspecific staining of mitotic cells in imaginal discs (Supplemental Figure S5, A–D) pS74-Yorkie staining is specific.

Atg1 kinase activity is induced by multiple pathways. First, we tested amino acid starvation, which regulates Atg1 in a Tor-dependent manner (Jung et al., 2009; Kim et al., 2011; Scott et al., 2007). In starved 96-hr larval fat bodies, pS74-Yorkie staining was elevated in many but not all cells (Figure 6A,B) without consistent changes in Yorkie levels. Starvation-induced Yorkie-phosphorylation was independent of hpo activity (Figure 6F). In fat bodies of fed larvae, phosphorylation of Yorkie S74 was cell-autonomously elevated by clonal expression of Atg1 (Figure 6C) or Acinus (Figure 6D), but not RFP in control clones (Figure 6E), and without a proportional increase in total Yorkie levels (Figure 6C”–E”). Similarly, Yorkie S74 phosphorylation was observed in some, but not all cells of Atg1 overexpressing clones in wing discs (Supplemental Figure S5E–H).

Figure 6. Atg1 phosphorylates Yorkie in vivo.

Micrographs show confocal projections of fat bodies from fed (A,C,D,E) or starved (B,F-N) third instar larvae stained for DNA and the indicated antigens.

(A,B) In wild-type fat bodies staining for pS74-Yorkie, but not Yorkie, was enhanced by starvation. (C-E) Atg1 (C) and Acinus (D) overexpressing clones are marked by co-expressed RFP, (E) shows an RFP overexpressing control clone.

(F-H) Homozygous loss-of-function clones (−/−) for hpo^KS240 (F), Atg1^D3D (G) or acn²⁷ (H) are marked by loss of GFP or lacZ as indicated and show no requirement of hpo (F) for pS74-Yki staining, in contrast to Atg1 (G) or acn (H).

(I,J) RNAi-expressing clones marked with RFP, show reduced pS74-Yki staining upon knockdown of Atg1 (I) or Acn (J).

(K) In cells of starved wild-type fat bodies, variable levels of Acinus staining parallel differences in pS74-Yki staining.

(L,M) Loss-of-function clones for atg13⁸¹ (−/−) show that it is required for starvation-induced Atg8-positive autophagosomes (K’), but dispensable for pS74-Yki phosphorylation.

(N) Knockdown of AMPK does not alter pS74-Yki staining.

Images are representative examples from at least three independent crosses with 5 or more examples each.

Scale bar in A: 50 μm for A-M and 100 μm for N.

See also Figure S5. Detailed genotypes are listed in Table S2.

Cells positive for pS74-Yorkie were not observed within Atg1 or Acinus loss-of-function clones (Figure 6G–J). Furthermore, pS74-Yorkie phosphorylation in starved wild-type fat bodies closely paralleled the levels of endogenous Acinus protein (Figure 6K). These findings are consistent with both Acinus and Atg1 being required for Yorkie S74 phosphorylation. This differed, however, for Atg13 which is required as cofactor of Atg1 in the formation of ATG8-positive autophagosomes (Figure 6L). Interestingly, Atg13 is not required for Yorkie-S74 phosphorylation in starved fat bodies (Figure 6M). Similarly, knockdown of AMP-activated kinase, which can activate Atg1 in response to metabolic stress (Egan et al., 2011; Kim et al., 2011), did not interfere with pS74-Yorkie phosphorylation (Figure 6N). Together, these data indicate that a distinct, AMPK/Atg13-independent but Acinus-dependent pool of Atg1 kinase phosphorylates Yorkie and regulates its activity.

Discussion

The Hippo/Yorkie pathway plays a critical role in regulating tissue growth during development and regeneration. Here, we describe a mechanism for the integration of this pathway with the temporary constraints imposed by environmental conditions. We find that stress-activated Atg1/ULK kinases phosphorylate Yorkie in vitro and in vivo. Two target sites identified were serine residue S74 and S97. Unlike the cytosolic sequestration initiated by Warts phosphorylating Yorkie (Oh and Irvine, 2008), Atg1-mediated phosphorylation does not interfere with Yorkie’s nuclear localization, but nevertheless inhibits expression of Yorkie downstream targets and thereby interferes with tissue growth.

Inhibition of Yorkie activity, despite increased nuclear accumulation, was previously observed in response to inhibition of TOR activity (Parker and Struhl, 2015). In that study, however, no direct phosphorylation of Yorkie by TOR was reported. Interestingly, TOR and Atg1/ULK kinases mutually inhibit each other’s activity (Egan et al., 2011; Jung et al., 2009; Kim et al., 2011; Shang et al., 2011; Wong et al., 2013; Zhao and Klionsky, 2011). Thus, in the light of our findings, TOR-mediated activation of Yorkie may be explained by Tor’s inhibitory effect on Atg1. This in turn would relieve the Atg1-mediated inhibition of Yorkie.

Hippo/Warts-independent regulation of Yorkie has also been observed in response to activation of LKB1 and its downstream target AMPK in the Drosophila CNS (Gailite et al., 2015). By contrast, we find that starvation-induced Yorkie phosphorylation in fat bodies is independent of AMPK. It is intriguing to note that AMPK in mammalian cells can induce phosphorylation of S94 of YAP, the residue that corresponds to S97 of Yorkie (Mo et al., 2015). Our in-vitro data show that this site is targeted by Atg1/ULK kinases, but our current tools were not adequate to assess the level of S97 phosphorylation in tissues. The regulatory importance of this conserved residue reflects its central role in the interaction of Yorkie/YAP/TAZ transcriptional co-activators with the Scalloped/TEAD transcription factors. In YAP/TEAD or TAZ/TEAD complexes, the hydroxyl group of YAP-S94/TAZ-S51 is placed to form hydrogen bonds with conserved tyrosine and glutamate residues in TEAD proteins (Chen et al., 2010; Kaan et al., 2017; Tian et al., 2010). Thus, not surprisingly, mutating as well as phosphorylating this serine in YAP (Chen et al., 2010; Li et al., 2010) or Yorkie (Zhao et al., 2008)(Figure 5, Supplemental Figure S4) interferes with their function. The strict requirement of this serine residue for Yorkie function thus prevented us from using a Yorkie^S97A mutation to further test the specific role of S97 phosphorylation in the epistatic interactions between Atg1 and Yorkie.

The importance of Yorkie-S74, the second site phosphorylated by Atg1, is less clear. This serine is conserved in TAZ but not in YAP homologs of Yorkie. Furthermore, we found that replacement of this serine with alanine in the endogenous yorkie gene by CRISPR/Cas9-induced homology-directed repair yielded the yorkie^S74A allele that was homozygous viable and lacked any overt phenotype. In the TAZ/TEAD complex the corresponding TAZ-S34 appears not to be directly engaged in TEAD binding (Kaan et al., 2017) and phosphorylation of Yorkie-S74 does not interfere with its binding to Scalloped (Figure 5E).

A key aspect of Yorkie-mediated growth control is its regulation by multiple negative feedback loops that maintain homeostasis. Yorkie enhances the expression of several tumor suppressors, including Ex, Kibra, Warts and Crumbs, which act as upstream negative regulators of its own activity (Genevet et al., 2010; Hamaratoglu et al., 2006; Jukam et al., 2013; Zheng and Pan, 2019). In that light, it is interesting to consider Yorkie-driven expression of Diap1, an inhibitor of caspase activity (Abrams, 1999). While this is generally considered to be part of the anti-apoptotic function of Yorkie, it is important to note that caspase function is not confined to apoptosis (Miura, 2012). For example, we have previously demonstrated that Acinus is cleaved and inactivated by the caspase Dcp-1 in non-apoptotic cells of fat bodies and imaginal discs (Nandi et al., 2014) and a recent report documented a role for caspase-mediated cleavage of Acinus in regulating imaginal tissue growth (Shinoda et al., 2019). Together, these data suggest that Yorkie-driven Diap1 expression may initiate a previously unappreciated negative feedback loop consisting of the inactivation of Dcp-1, the resulting disinhibition of Acinus, ultimately promoting Atg1-mediated inhibitory Yorkie phosphorylation. The mechanism by which Acinus activates Atg1 remains unclear, however.

In addition to the canonical function of Atg1 kinase and its orthologs as major regulators of autophagy, an increasing number of non-canonical, autophagy-unrelated substrates have emerged (Wang and Kundu, 2017). For example, a function in axonal transport, first observed in C. elegans for the unc-51 homolog of Atg1 (Ogura et al., 1994), was also observed in flies and mammals (Toda et al., 2008; Wang et al., 2017). Furthermore, ER-to-Golgi trafficking (Joo et al., 2016) and Rab5-mediated endocytosis (Tomoda et al., 2004) have been identified as additional functions related to autophagy-independent membrane trafficking. To which extent the substrates in these different contexts are targeted by distinct pools of the Atg1 kinase is not clear. It is thus interesting to note that Yorkie phosphorylation by Atg1, unlike autophagy induction, is independent of its cofactor Atg13 (Alers et al., 2014). An Atg13-independent role for Atg1 has previously also been described for the degradation of Drosophila salivary glands (Nandy et al., 2018). Understanding the possible role that Acinus plays in promoting the activity of distinct Atg1 pools is an important goal of our ongoing work.

STAR*METHODS

LEAD CONTACT AND MATERIALS AVAILABILITY

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Helmut Kramer (helmut.kramer@utsouthwestern.edu). All unique/stable reagents generated in this study are available from the Lead Contact without restriction.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Drosophila Strains

Fly stocks were maintained at room temperature on standard cornmeal molasses-yeast food supplemented with dry yeast unless stated otherwise. For all SEM images of adult eyes, only females were used because of their typically larger size. For all other experiments, males and females were used indiscriminately without analysis of gender-specific effects.

Bloomington Drosophila Stock Center provided OreR, w¹¹¹⁸, and Gal4 driver lines (BS 30557, BS 25754 -Dcr-2 was removed from this line before use, BS 8860, BS 1104), the following transgenes: UAS-Atg1 (BS 51655), y[1] w[*]; P{UAS-YkiS168A.GFP.HA} (BS 28836), w[*]; P{UAS-yki.S111A.S168A.S250A.V5}attP2 (BS 28817), P[hsFLP]¹, y¹w¹¹¹⁸; Dr¹/TM3, Sb¹ (BS 7), P[hsFLP]¹, w¹¹¹⁸; Adv¹/CyO (BS 6), and w¹¹¹⁸; P[GAL4-Act5C(FRT.CD2).P]^S, P[UAS-RFP.W]³/TM3, Sb¹ (BS 30558), P{ry[+t7.2]=hsFLP}12, y[1]w[*]; P{ry[+t7.2]=neoFRT}42D. hpo[KS240]/CyO (BS 25085), w[1118]; P{ry[+t7.2]=neoFRT}42D P{w[+mC]=Ubi-GFP(S65T)^nls}2R/CyO (BS 5626) and deficiency stocks listed in Supplemental Figure 1. RNAi lines were obtained from Bloomington Drosophila Stock Center and Vienna Drosophila Resource Center. Other fly strains used were: M{UAS-Atg6.ORF.3xHA.GW}ZH-86Fb (FlyORF), UAS-Acn-wt (Nandi et al., 2017), ubi-GFP acn²⁷ubi-GFP FRT40A (Haberman et al., 2010), UAS-Atg13-FLAG, UAS-myc-Atg1, UAS-myc-Atg1^K38Q (Chang and Neufeld, 2009), yw, hsFLP; Atg1 ^3D FRT80B/TM6B (Scott et al., 2004) [gift from Tom Neufeld], FRT42D yki^B5/CyO, P{ry[+t7.2]=hsFLP}1, w[1118]; P{w[+mC]=GAL4-Act5C(FRT.CD2).P}S, P{w[+mC]=UAS-GFP} (Huang et al., 2005), en-Gal4,UAS-m-Cherry/CyO, hsFLP; FRT40A LacZ, hsFLP; FRT80B, UAS-GFP, UAS-Yorkie/CyO, yw; Sp/CyO; ban-LacZ/TM6B, Tb¹ (Herranz et al., 2012) [gift from DJ Pan], hsFLP; r4-Gal4 FRT82B UAS-GFP-nls, FRT82B Atg13⁸¹/TM6B (Mukherjee et al., 2016) [gift from Andreas Jenny]. Experiments with UAS-RNAi transgenes were performed at 28°C to maximize knockdown efficiency and all other crosses were performed at 25°C. AMPK RNAi knockdown clones in fat body were generated using hsFLP; Actin>CD2>Gal4, UAS-GFP exposing 3-day old larvae to a heat shock for 15 min at 38°C. All other overexpression and RNAi knock-down clones in fat body were generated by heat shocking larvae carrying hsFLP; Actin>CD2>Gal4, UAS-RFP and the indicated UAS-transgenes at 38°C for 1 hour the day prior to dissection. Atg1 over-expression clones in wing discs were generated by heat shocking 3-day old larvae containing hsFLP; Actin>CD2>Gal4, UAS-GFP and indicated UAS-transgenes at 38°C for 30 mins and expressing the transgene for 24 h at room temperature. hsFLP-induced mutant clones were generated as described (Liu et al., 2016).

UAS-Yorkie transgenes were generated by standard cloning in a pAttB-UAS vector for site-specific insertion. Specific mutations were introduced through standard mutagenesis or Gibson assembly of gBlocks (IDT, Coralville, Iowa), sequence-verified and inserted into the AttP landing sites at 43A1. CRISPR/Cas9-mediated mutagenesis of Yorkie were performed as described (Stenesen et al., 2015) using tools available from the O’Connor-Giles, Wildonger, and Harrison laboratories (www.flycrispr.wisc.edu). Two guide RNAs located 5’ to the Yorkie coding sequences and 3’ to S97 (gRNA1: GTCGGCTGCACCTGCGGAATGCC and gRNA2: GTCGGGAGTGATGTATCGCCAGG) were introduced into the pCDF3-dU6 vector and co-injected with the appropriate template plasmid for homologous repair. Template plasmids were assembled in a pBluescript backbone from a 1kb PCR-amplified 5’ homology arm, and gBlocks (IDT, Coralville, IA) encoding an N-terminal modified 3xFLAG-tag (GDYKDHDGDYKDHDIDYNDHD), and WT, S74A, or S74,97A mutant Yorkie sequences, and a 910 bp 3’ homology arm. Embryo injections were done by Rainbow Transgenic Flies (Camarillo, CA), and the resulting potentially chimeric adult flies were crossed with balancer stocks. Their progeny, potential founders, were crossed again to balancer stocks and genotyped using a single-fly PCR preparation to identify lines containing germ-line Flag-Yorkie using a forward primer within the newly introduced FLAG-tag (GATTACAACGACCACGACGA) and a reverse primer complementary to newly introduced silent mutations 3’ to the serine S97 (ATGGAGCTGGTGGTGTGAAG). Genomic regions surrounding the Yorkie locus, outside the homology arms of the CRISPR Yorkie homology template plasmids, were amplified and sequenced to verify the correct editing of the Yorkie locus.

METHOD DETAILS

Wing measurement

Wings were removed from adult female flies at least one to three days post eclosion, dehydrated in 75% ethanol, placed on glass slides, mounted with Permount (Fisher) and a 1.5 coverslip, and dried on a slide warmer at 65°C. Wings were imaged using a Zeiss Discovery Stereoscope and quantified using area measurement in ImageJ as previously described (Rauskolb et al., 2011).

Immunofluorescence Staining

Whole-mount tissues were fixed and stained as described (Akbar et al., 2011). Fed and starved 96-h fat bodies were collected and stained as described (Nandi et al., 2017).

Fluorescence images were captured with 63× (NA 1.4) or 40× (NA1.3) or 20X (NA 0.75) lenses on an inverted confocal microscope (LSM710 or LSM510 Meta; Carl Zeiss, Inc.). Confocal Z-stacks of tissues were collected at a 1-μm step size and processed using ImageJ and Adobe Photoshop.

Antibodies used: Mouse anti-Diap1 (1:1,000, gift from DJ Pan), Rabbit anti pS74 Yorkie (1:500), Chicken anti-GFP (1:500) from Aves and Chicken anti-β-Gal (1:1000) from Abcam, Guinea pig anti-Acinus (1:1000, Haberman et al., 2010), Rabbit anti-pS641-Acn (1:500, (Nandi et al., 2014)), Rabbit anti-pS437-Acn (1:500, (Nandi et al., 2017)), Rabbit anti-GABARAP which detects Drosophila melanogaster ATG8a (1:100, (Nandi et al., 2017)), Guinea pig anti-Yorkie (1:400, gift from Iswar Hariharan), Guinea pig anti-Expanded (1:5000, gift from Richard Fehon (Su et al., 2017)).

Scanning Electron Microscopy

SEM of fly eyes were obtained using standard methods as described (Wolff, 2011) (Nandi et al., 2014) with a Zeiss Sigma Scanning Electron Microscope with the InLens detector and an EHT of 3.0kV.

In Vitro Kinase assays

Radioactive in-vitro kinase assays were performed as described (Karra et al., 2017). Briefly, 400 ng of substrate (YAP1 or TAZ) were incubated with 100 ng of kinase ULK1 in kinase assay buffer (10mM Tris/HCl, pH 7.5, 10 M ATP (5 Ci of [γ−³²P]ATP {Perkin Elmer, Cat#NEG002A100UC} per reaction), 5 mM MgCl₂, and 10 mM β-glycerophosphate) for 1 h at 30°C. Proteins were separated by SDS-PAGE, the gel was stained with Coomassie Brilliant Blue G-250 (Thermo Fisher Scientific) and de-stained overnight. The gel was then dried on a Whatman 3MM Chr Chromatography paper (GE Healthcare) pre-soaked in methanol in a gel dryer at 80°C for 90 mins. Incorporation of ³²P-phosphate was detected by autoradiography. Proteins used were human ULK1 (Sigma product number: SRP5096 Lot: G1163–1), human TAZ (OriGene Technologies product number: TP304082 Lot: 1160CA), and human Yap1 (OriGene Technologies product number: TP325864 Lot: 10a73e).

Non-radioactive phosphorylation of GST fusion proteins was performed as described (Nandi et al., 2017). In brief, immobilized GST-Yki⁵³⁻¹¹⁹ fusion proteins were exposed to 50 ng ULK1 (Sigma Aldrich) in 100 μl kinase assay buffer (25 mM MOPS, pH 7.2, 12. 5mM glycerol 2-phosphate, 25 mM MgCl₂, 5 mM EGTA, 2mM EDTA, 0.25 mM DTT, and 0.5 mM ATP) for 30 min at 30°C. Immobilized GST-Yorkie proteins were washed twice with PBS containing 0.1% Triton-X100, eluted with 20 mM glutathione and analyzed by western blots using antibodies against pS74-Yorkie (1:2000), pS97-Yorkie (1:400), or GST (1:10,000) for detection of total GST-Yorkie proteins. Rabbit anti pS74 Yorkie against the sequence (DDNLQALFD-(p)S-VLNPGDAKR) and anti pS97 Yorkie against the sequence (RMRKLPN-(p)S-FFTPPAPS) were generated by Genemed Synthesis (San Antonio).

Yki binding assays

4 μg of pMT-TST-Myc-Sd encoding TwinStrep-Myc-tagged Sd under metallothionein promoter control (sequence available upon request) was transfected into 10⁷ S2 cells using TransIT-2020 (Mirus, MIR5404) following the manufacturer’s instructions. 16 hours following induction with CuSO₄ (0.7 mM), S2 cells were lysed by sonication in 100 mM Tris-Cl pH8.0, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, including protease inhibitors (Roche, Cat#05892970001). Sd was bound to MagStrep “type3” XT beads (iba Cat#2-4090-002) followed by three washes with lysis buffer. 500 ng GST-Yki⁵³⁻¹¹⁹ fusion proteins (wt, S74A, S97A, S74,97A) with or without phosphorylation using 50 ng Ulk1 (as described above) were incubated with Sd-bound beads for 1 h. Beads were washed 3 times in lysis buffer and proteins eluted using 1X Laemmli SDS buffer at 100°C. For western blots, Nitrocellulose membranes (0.45 μm, Amersham Protran) were cut in half just below the ~41kDa marker and blocked in 4% BSA. The upper half was used for detection of Myc-Sd (Mouse anti-myc 9E10; DSHB)) and the lower half was probed with mouse anti-GST (Thermo Fisher, MA4–004), rabbit anti-Yki-pS97, and rabbit anti-YkipS74 (Genemed Synthesis). Secondary antibodies used in conjunction with a Li-Cor Odyssey scanner were goat anti-mouse IR Dye 700DX (Odyssey 926–32510) and goat anti-rabbit IR Dye 800CW (Odyssey 926–32211).

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical significance of survival assays was determined in Prism (GraphPad) using a two-tailed Student’s t-test. Graphs resulting from these analysis show means ± SD. P-values smaller than 0.05 are considered significant, and values are indicated with * (<0.05), ** (<0.01), *** (<0.001), or **** (<.0001). For wing measurements, replicates were done in sets of 15 wings per set, with 3–4 replicates for each genotype. Measurements were normalized to Gal4-driver only controls and statistical significance was determined in Prism (GraphPad) using oneway ANOVA for multiple comparisons, followed by Tukey’s test. P-Values smaller than 0.05 are considered significant and values are indicated as * (<0.05), ** (<0.01), *** (<0.001), or **** (<.0001).

DATA AND SOFTWARE AVAILABILITY

This study did not generate data sets or code.

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Goat anti-Mouse-IgG Alexa Fluor 405	Thermo Fisher Scientific	Cat# A-31553, RRID: AB_221604
Goat anti-Rabbit-IgG Alexa Fluor 405	Thermo Fisher Scientific	Cat# A-31556; RRID:AB_22160
Goat anti-Mouse-IgG Alexa Fluor 488	Thermo Fisher Scientific	Cat# A32723; RRID:AB_2633275
Goat anti-Rabbit-IgG Alexa Fluor 488	Thermo Fisher Scientific	Cat# A32731; RRID:AB_2633280
Goat anti-Rabbit-IgG Alexa Fluor 647	Thermo Fisher Scientific	Cat# A32733; RRID:AB_2633282
Goat anti-Mouse-IgG Alexa Fluor 647	Thermo Fisher Scientific	Cat# A32728; RRID:AB_2633277
Goat anti-Guinea Pig-IgG Alexa Fluor 488	Thermo Fisher Scientific	Cat# A-11073; RRID:AB_2534117
Goat anti-Guinea Pig-IgG Alexa Fluor 568	Thermo Fisher Scientific	Cat# A-11075; RRID:AB_2534119
Goat anti-Guinea Pig-IgG Alexa Fluor 647	Thermo Fisher Scientific	Cat# A-21450; RRID:AB_2735091
Goat anti-Mouse IgG Alexa Fluor 568	Thermo Fisher Scientific	Cat# A-11004; RRID:AB_2534072
Goat anti-Rabbit IgG Alexa Fluor 568	Thermo Fisher Scientific	Cat# A-11036; RRID:AB_10563566
anti-GST (mouse monoclonal)	Thermo Fisher Scientific	Cat#:MA4–004; RRID:AB_10979611
anti-Acn (aa 423–599) (guinea pig polyclonal)	(Haberman et al., 2010)	N/A
anti-Myc 9E10 (mouse monoclonal)	Developmental Studies Hybridoma Bank	DSHB:9E10; RRID:AB_2266850
anti-GABARAP (rabbit monoclonal))	Abcam	Cat#:ab109364; RRID:AB_10861928
anti-GFP (chicken monoclonal)	Aves	Cat#:GFP-1020; RRID:AB_2307313
anti-pS74-Yorkie (rabbit polyclonal)	This work; Genemed Synthesis	N/A
anti-pS97-Yorkie (rabbit polyclonal)	This work; Genemed Synthesis	N/A
anti-pS437-Acinus (rabbit polyclonal)	Genemed Synthesis (Nandi et al., 2017)	NA
anti-pS641-Acinus (rabbit polyclonal)	Genemed Synthesis (Nandi et al., 2014)	NA
anti-Yorkie (guinea pig polyclonal)	gift from Iswar Hariharan	N/A
anti-Diap-1 (mouse polyclonal)	gift from DJ Pan (Wu et al., 2003)	N/A
anti-Expanded (guinea pig polyclonal)	gift from R Fehon (Su et al., 2017)	NA
anti-Beta Gal (chicken polyclonal)	Abcam	Cat#:ab9361; RRID:AB_307210
goat anti-mouse IgG IR Dye 700DX	LI-COR Biosciences	Cat# 926–32510; RRID:AB_1850021
goat anti-rabbit IgG IR Dye 800CW	LI-COR Biosciences	Cat# 925–32211; RRID:AB_2651127)
Chemicals, Peptides, and Recombinant Proteins
ULK1 (1–649), active GST tagged, human	Sigma	Cat#:SRP5096 Lot: G1163–1
human TAZ	OriGene Technologies	Cat#:TP304082 Lot: 1160CA
human Yap1	OriGene Technologies	Cat#:TP325864 Lot: 10a73e
GST-Yki53–119-WT	This work	N/A
GST-Yki53–119-S74A	This work	N/A
GST-Yki53–119-S97A	This work	N/A
GST-Yki53–119-S74,97A	This work	N/A
DDNLQALFD-(p)S-VLNPGDAKR	This work; Genemed Synthesis	N/A
RMRKLPN-(p)S-FFTPPAPS	This work; Genemed Synthesis	N/A
H-XStable Prestained Protein Ladder	UBP-Bio	Cat#:L2021
Fast SYBR Green Master Mix	Applied Biosystems	Cat#:4385610
Alkaline Phosphatase, Calf Intestinal	New England BioLabs	Cat#:M0290S
VECTASHIELD Antifade Mounting Medium with DAPI	Vector Laboratories	Cat#:H-1200
VECTASHIELD Antifade Mounting Medium	Vector Laboratories	Cat#:H-1000
cOmplete™ ULTRA Tablets, Mini, EASYpack Protease Inhibitor Cocktail	Roche	Cat#:5892970001
Permount	Fisher	Cat#SP15–100
[γ-32P]ATP	Perkin Elmer	Cat#NEG002A100UC
TransIT-2020 Transfection Reagent	Mirus	Cat#:MIR5404
MagStrep “type3” XT beads	iba	Cat#:2-4090-002
Coomassie Brilliant Blue G-250	Thermo Fisher Scientific	Cat#:20279
Whatman 3MM Chr Chromatography paper	GE Healthcare	Cat#:05-716-3V
Paraformaldehyde for EM	Ted Pella Inc.	Cat#:18501
Cacodylic Acid, Sodium Salt	Ted Pella Inc.	Cat#:18851
Glutaraldehyde, 8% for EM	Ted Pella Inc.	Cat#:18422
Hexamethyldisilazane (HMDS)	Electron Microscopy Sciences	Cat#:16700
Amersham Protran Premium 0.45 μM Nitrocellulose Membrane	GE Healthcare	Cat#:10600003
Critical Commercial Assays
High-Capacity cDNA Reverse Transcription kit	Applied Biosystems (now: Thermo Fisher Scientific)	Cat#:4368813
Experimental Models: Cell Lines
Drosophila melanogaster S2 Cell Line	KCB	KCB Cat# KCB 200559YJ; RRID:CVCL_Z232
Experimental Models: Organisms/Strains
Drosophila melanogaster, GMR-GAL4	Bloomington Drosophila Stock Center	RRID: BDSC_1104
Drosophila melanogaster, engrailed-GAL4, UAS-RFP/CyO	Bloomington Drosophila Stock Center	RRID: BDSC_30557
Drosophila melanogaster, engrailed-GAL4, UAS-m-Cherry/CyO	gift from DJ Pan	N/A
Drosophila melanogaster, UAS-Dcr-2; nubbin-GAL4 (Dcr-2 was removed before use)	Bloomington Drosophila Stock Center	RRID: BDSC_25754
Drosophila melanogaster, MS1096-GAL4	Bloomington Drosophila Stock Center	RRID: BDSC_8860
Drosophila melanogaster, Oregon-R	Bloomington Drosophila Stock Center	RRID:BDSC_5
Drosophila melanogaster, w[1118]	Bloomington Drosophila Stock Center	RRID:BDSC_3605
Drosophila melanogaster, y[1] w[*]; P{w[+mC]=UAS-Atg1.S}6B	Bloomington Drosophila Stock Center	RRID:BDSC_51655
Drosophila melanogaster, y[1] w[*]; P{w[+mC]=UAS-yki.S168A.GFP.HA}10-12-1	Bloomington Drosophila Stock Center	RRID:BDSC_28836
Drosophila melanogaster, w[*]; P{y[+t7.7] w[+mC]=UAS-yki.S111A.S168A.S250A.V5}attP2	Bloomington Drosophila Stock Center	RRID:BDSC_28817
Drosophila melanogaster, P{ry[+t7.2]=hsFLP}1, w[1118]; Adv[1]/CyO	Bloomington Drosophila Stock Center	RRID:BDSC_6
Drosophila melanogaster, P{ry[+t7.2]=hsFLP}1, y[1] w[1118]; Dr[Mio]/TM3, ry[*] Sb[1]	Bloomington Drosophila Stock Center	RRID:BDSC_7
Drosophila melanogaster, w[1118]; P{w[+mC]=GAL4-Act5C(FRT.CD2).P}S, P{w[+mC]=UAS-RFP.W}3/TM3, Sb[1]	Bloomington Drosophila Stock Center	RRID:BDSC_30558
Drosophila melanogaster, P{ry[+t7.2]=hsFLP}1, w[1118]; P{w[+mC]=GAL4-Act5C(FRT.CD2).P}S, P{w[+mC]=UAS-GFP}	gift from DJ Pan; (Huang et al., 2005)	N/A
Drosophila melanogaster, P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{ry[+t7.2]=neoFRT}42D hpo[KS240]/CyO	Bloomington Drosophila Stock Center	RRID:BDSC_25085
Drosophila melanogaster, w[1118]; P{ry[+t7.2]=neoFRT}42D P{w[+mC]=Ubi-GFP(S65T)nls}2R/CyO	Bloomington Drosophila Stock Center	RRID:BDSC_5626
Drosophila melanogaster, UAS-ATG1 RNAi	Vienna Drosophila Resource Center	v16133; FBst0452169
Drosophila melanogaster, UAS-ATG5 RNAi	Vienna Drosophila Resource Center	v104461; FBst0476319
Drosophila melanogaster, UAS-ATG7 RNAi	Vienna Drosophila Resource Center	v45558; FBst0466207
Drosophila melanogaster, UAS-Acn RNAi	Vienna Drosophila Resource Center	v102407; FBst0474276
Drosophila melanogaster, UAS-Hpo RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_27661
Drosophila melanogaster, UAS-Acn RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_53676
Drosophila melanogaster, UAS-Atg1 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_26731
Drosophila melanogaster, UAS-Atg5 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_27551
Drosophila melanogaster, UAS-Atg5 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_34899
Drosophila melanogaster, UAS-Atg7 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_27707
Drosophila melanogaster, UAS-Atg7 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_34369
Drosophila melanogaster, UAS-Atg8 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_28989
Drosophila melanogaster, UAS-Atg8 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_34340
Drosophila melanogaster, UAS-Atg18 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_34714
Drosophila melanogaster, UAS-Atg18 RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_28061
Drosophila melanogaster, UAS-AMPK RNAi	Bloomington Drosophila Stock Center	RRID:BDSC_25931
Drosophila melanogaster, Df(2L)al, ds[al]/In(2L)Cy, Duox[Cy]	Bloomington Drosophila Stock Center	RRID:BDSC_3548
Drosophila melanogaster, w[1118]; Df(2R)ED3728, P{w[+mW.Scer\FRT.hs3]=3'.RS5+3.3'}ED3728/SM6a	Bloomington Drosophila Stock Center	RRID:BDSC_9067
Drosophila melanogaster, w[1118]; Df(3R)ED5664, P{w[+mW.Scer\FRT.hs3]=3'.RS5+3.3'}ED5664/TM6C, cu[1] Sb[1]	Bloomington Drosophila Stock Center	RRID:BDSC_24137
Drosophila melanogaster, w[1118]; Df(3R)ED6187, P{w[+mW.Scer\FRT.hs3]=3'.RS5+3.3'}ED6187/TM2	Bloomington Drosophila Stock Center	RRID:BDSC_9347
Drosophila melanogaster, UAS-Acn WT	(Nandi et al., 2017)
Drosophila melanogaster, FRT42D ykiB5/CyO	(Huang et al., 2005) gift from DJ Pan	N/A
Drosophila melanogaster, hsFlp; FRT40A LacZ	gift from DJ Pan	N/A
Drosophila melanogaster, ubi-GFP acn[27] ubi-GFP FRT40A	(Haberman et al., 2010)	N/A
Drosophila melanogaster, hsFlp; r4-gal4 FRT82B UAS-GFPnls	gift from Andreas Jenny; (Mukherjee et al., 2016)	N/A
Drosophila melanogaster, FRT82B atg13(Δ81)/TM6B	gift from Andreas Jenny; (Mukherjee et al., 2016)	N/A
Drosophila melanogaster, y[1] w[*], hsFlp; ATG1(Δ3D) FRT80B/TM6B	gift from T Neufeld; (Scott et al., 2004)	N/A
Drosophila melanogaster, hsFlp; FRT80B, UAS-GFP	gift from DJ Pan	N/A
Drosophila melanogaster, y[1] w[*]; sp/CyO; Bantam-LacZ/TM6B, Tb1	gift from DJ Pan; (Herranz et al., 2012)	N/A
Drosophila melanogaster, UAS-myc-ATG1	gift from T Neufeld; (Chang and Neufeld, 2009)	N/A
Drosophila melanogaster, UAS-myc-ATG1 (K38Q)	gift from T Neufeld; (Chang and Neufeld, 2009)	N/A
Drosophila melanogaster, UAS-ATG13-Flag	gift from T Neufeld; (Chang and Neufeld, 2009)	N/A
Drosophila melanogaster, M{UAS-Atg6.ORF.3xHA.GW}ZH-86Fb	FlyORF	F003089; FBst0502063
Drosophila melanogaster, w; yki [S74A]	This work	N/A
Drosophila melanogaster, w[*]; UAS-Yki.WT/CyO	gift from DJ Pan; (Huang et al., 2005)	N/A
Drosophila melanogaster, w[*]; UAS-FLAG-Yki.S168A	This work	N/A
Drosophila melanogaster, w[*]; UAS-FLAG-Yki.S74,168A	This work	N/A
Drosophila melanogaster, w[*]; UAS-FLAG-Yki.S74,97, 168A	This work	N/A
Oligonucleotides
guide RNA1: GTCGGCTGCACCTGCGGAATGCC	Integrated DNA Technologies; This work	N/A
guide RNA2: GTCGGGAGTGATGTATCGCCAGG	Integrated DNA Technologies; This work	N/A
Forward PCR primers for Yki-S74AGATTACAACGACCACGACGA	Integrated DNA Technologies; This work	N/A
Reverse PCR primers for Yki-S74AATGGAGCTGGTGGTGTGAAG	Integrated DNA Technologies; This work	N/A
Recombinant DNA
pMT-TST-Myc-Sd	This work	N/A
pGEX-2T-Yki53–119_WT	This work	N/A
pGEX-2T-Yki53–119_S74A	This work	N/A
pGEX-2T-Yki53–119_S97A	This work	N/A
pGEX-2T-Yki53–119_S74,97A	This work	N/A
pAttB-UAS-FLAG-Yki.S168A	This work	N/A
pAttB-UAS-FLAG-Yki.S74,168A	This work	N/A
pAttB-UAS-FLAG-Yki.S74,97,168A	This work	N/A
pCDF3-dU6-Yki-gRNA1	This work	N/A
pCDF3-dU6-Yki-gRNA2	This work	N/A
pCDF3-dU6	(Port et al., 2014)	Addgene; Cat#: 49410
pBS-Flag-Yki-S74A_HDR	This work	N/A
Software and Algorithms
Imaris software	Bitplane	RRID:SCR_007370
Adobe Photoshop	Adobe	RRID:SCR_014199
ImageJ	NIH	RRID:SCR_003070
Image Studio ver 5.2	LI-COR	RRID:SCR_015795
Prism	GraphPad	RRID:SCR_002798

Highlights.

• Atg1 phosphorylates Yorkie at two ULK1/Atg1 consensus target sites

• Atg1-mediated phosphorylation blocks Scalloped binding and inhibits Yorkie activity

• This phosphorylation does not interfere with Yorkie’s nuclear localization

• Yorkie phosphorylation by Atg1 is promoted by elevated Acinus levels