Summary
Balanced fusion and fission are key for proper function and physiology of mitochondria1,2. Remodelling of the mitochondrial inner membrane (IM) is mediated by dynamin-like Mitochondrial genome maintenance 1 protein (Mgm1) in fungi or the related Optic atrophy protein 1 (OPA1) in animals3–5. Mgm1 is required for the preservation of mitochondrial DNA in yeast6, whereas mutations in the OPA1 gene in humans are a common cause for autosomal dominant optic atrophy, a genetic disorder affecting the optical nerve7,8. Mgm1 and OPA1 are present in mitochondria as a membrane-integral long (l) form and a short (s) form that is soluble in the intermembrane space. Yeast strains expressing temperature-sensitive mutants of Mgm19,10 or mammalian cells devoid of OPA1 display fragmented mitochondria11,12, suggesting an important role of Mgm1/OPA1 in IM fusion. Consistently, only the mitochondrial outer membrane (OM), but not the IM, fuses in the absence of functional Mgm113,14. Mgm1 and OPA1 have also been shown to maintain proper cristae architecture10,14. For example, OPA1 prevents the release of pro-apoptotic factors by tightening cristae junctions15. Finally, s-OPA1 localises to mitochondrial constriction sites, where it presumably promotes mitochondrial fission16. How Mgm1/OPA1 perform their diverse functions in membrane fusion, scission, and cristae organisation is at present unknown. Here, we present crystal and electron cryo-tomography (cryo-ET) structures of Chaetomium thermophilum Mgm1. Mgm1 consists of a GTPase domain, a bundle signalling element (BSE) domain, a stalk, and a paddle domain containing a membrane binding site. Biochemical and cell-based experiments demonstrate that the Mgm1 stalk mediates assembly of bent tetramers into helical filaments. Cryo-ET of Mgm1-decorated lipid tubes and fluorescence microscopy experiments on reconstituted membrane tubes indicate how the tetramers assemble on positively or negatively curved membranes. Our findings convey how Mgm1/OPA1 filaments dynamically remodel the mitochondrial IM.
We purified and crystallised a truncated s-Mgm1 isoform from the thermophilic fungus Chaetomium thermophilum (from here on Mgm1) (Fig. 1a, Extended Data Fig. 1a, Supplementary Data Fig. 1). Crystals of this construct grown in the absence of nucleotides diffracted to 3.6 Å resolution. The structure was solved by single anomalous dispersion (Extended Data Fig. 1b, c, Extended Data Table 1).
The structure of Mgm1 contains four domains: A G domain, a bundle signalling element (BSE) domain, a stalk, and a paddle (Fig. 1a, b). The G domain closely resembles that of human dynamin (Extended Data Fig. 2). An interface across the nucleotide-binding site responsible for G domain dimerisation in the dynamin superfamily (the ‘G interface’) is highly conserved in Mgm1 (Extended Data Fig. 1e). The adjacent BSE domain consists of three helices derived from different regions of Mgm1 (Fig. 1a, b). The BSE domain contacts the G domain, as in the closed conformation of dynamin17-19. The Mgm1 stalk domain is shorter than the dynamin stalk, comprising an antiparallel kinked four-helix bundle (Fig. 1b, Extended Data Fig. 2c, d). Unique to Mgm1 is the paddle, an elongated three-helix domain at the tip of the stalk, which is inserted between stalk helices α3 S and α4 S and contains a disulphide bridge linking Cys812 to Cys821 (Fig. 1b). Dynamin has a membrane-binding pleckstrin homology domain in the corresponding position.
We mutated two positively charged, surface-exposed residues as well as the two cysteines of the disulphide bridge in the paddle. In co-sedimentation experiments, the Mgm1 construct efficiently bound to Folch liposomes (lipids from bovine brain), whereas the mutants bound less strongly (Fig. 1c, Extended Data Fig. 3a). Mgm1 bound to the non-hydrolysable GTP analogue GTPγS with a Kd of 9 μM (Extended Data Fig. 3b). The intrinsic GTPase activity of Mgm1 (about 0.5 min-1 at 37 °C) was stimulated about 500-fold in the presence of Folch liposomes, reaching rates of 270 min-1. Liposomes also accelerate the GTPase activity of yeast Mgm1 and human OPA120, 21. Stimulation of GTPase activity was significantly reduced for all paddle mutants (Fig. 1d).
When incubated with liposomes, Mgm1 induced tubulation and coated the membrane surface in a regular pattern (Fig. 1e), with or without added nucleotide (Extended Data Fig. 3e, f). The membrane remodelling activity of the paddle mutants was reduced, indicating that the paddle constitutes a membrane-binding site (Fig. 1e, Extended Data Fig. 3g).
The asymmetric unit of the crystals contained an Mgm1 dimer. The dimer interface (termed interface-2, in analogy to dynamin17, 18) includes a hydrophobic core which is flanked by polar residues (Fig. 2a). By analytical ultracentrifugation (AUC), we detected a concentration-dependent monomer-dimer equilibrium for Mgm1 (Fig. 2b, Extended Data Fig. 3c). The F840D mutation in the centre of the hydrophobic dimer interface rendered the protein monomeric. Assembly via the Mgm1 stalk interface-2 results in a V-shaped dimer, whereas dynamin stalks form an X-shaped dimer (Extended Data Fig. 2d, e).
Mutations of several interface-2 residues reduced liposome binding and liposome-stimulated GTPase activity (Fig. 2d, e, Extended Data Fig. 3a). The most severe mutant, F840D, failed to tubulate liposomes and did not form a regular protein pattern (Fig. 2c-e, Extended Data Fig. 3g), confirming the importance of interface-2 for Mgm1 assembly on the membrane surface.
We used a yeast model system to express Mgm1 mutants in a strain in which the expression of endogenous Mgm1 was under control of the galactose-inducible and glucose-repressed GAL1 promoter (Extended Data Fig. 4a). Loss of Mgm1 expression was associated with a rapid and irreversible loss of the mitochondrial genome, fragmentation of the mitochondrial network and the subsequent inability to switch to respiratory metabolism upon glucose depletion (Extended Data Fig. 4b, c)6, 10. Re-expression of yeast Mgm1 rescued the loss of mitochondrial respiratory function, as assessed by yeast growth, the presence of mitochondrially-encoded cytochrome c oxidase 1 protein (Cox1) and restoration of the mitochondrial network (Extended Data Fig. 4b-g). In line with the liposome-binding assays, the yeast F805D mutant (corresponding to F840D in Mgm1), but not the N675A mutant (corresponding to I700D in Mgm1, Supplementary Fig. 1), failed to complement the loss of endogenous Mgm1 (Extended Data Fig. 4d, e, g). These results highlight the importance of interface-2 for Mgm1-dependent maintenance of mitochondrial DNA and respiration-competent mitochondria.
In the crystals, two Mgm1 dimers assembled into a tetramer via another ~1000 Å2 stalk interface which, again in analogy to dynamin, we refer to as stalk interface-1 (Fig. 3a). The tetramer is further stabilised by a ~1100 Å2 contact between the BSE domain of one dimer and the stalk of the adjacent dimer. Interface-1 and the BSE/stalk contact site are highly conserved in the Mgm1 family (Extended Data Fig. 1e). Notably, the interface-1 interaction induces a 20° bend between two stalk dimers (Extended Data Fig. 2e).
Mgm1 mutants D559A or K562A in interface-1 and Y537A or R646A in the BSE/stalk contact did not show major differences in liposome binding or GTPase activity compared to Mgm1 (Extended Data Fig. 3a, d). The mutants also tubulated liposomes and formed a regular pattern on the membrane (Extended Data Fig. 3g). However, when introduced into the corresponding positions of yeast Mgm1, all mutants failed to complement the loss of wild-type Mgm1 in respiratory growth (Fig. 3b), mitochondrial genome maintenance and mitochondrial morphology (Extended Data Fig. 4d, g). Interestingly, the Y520A BSE/stalk contact mutant in the tetramer interface exerted a strong dominant negative effect on respiratory yeast growth when co-expressed with endogenous Mgm1 (Extended Data Fig. 4h). The corresponding yeast strain retained mitochondrial DNA (Extended Data Fig. 4i), allowing us to examine Mgm1-specific deficits on mitochondrial morphology and ultrastructure. Expression of Y520A induced fragmentation of the mitochondrial network (Extended Data Fig. 4j, k), reduced cristae number and length and an increased cristae diameter (Extended Data Fig. 4l, m).
We used electron cryo-tomography (cryo-ET) and subtomogram averaging to determine the structure of membrane-bound Mgm1 (Fig. 4a, b, Extended Data Fig. 5a, b). In the absence of nucleotide, or upon addition of GTPγS, Mgm1 remodelled Folch liposomes into membrane tubes of varying diameters, ranging from ~18 - 140 nm. The Mgm1 coat decorated membrane tubes in a regular lattice. For subtomogram averaging, preformed tubes of ~20 nm diameter were used in order to increase the number of particles for averaging. These tubes also stimulated the GTPase activity of Mgm1, although less strongly than Folch liposomes (Extended Data Fig. 5c). The final resolution of the subtomogram average (STA) volume was 14.7 Å for the nucleotide-free and nucleotide-bound forms (Extended Data Table 1). No significant differences were apparent between the two STA volumes. Strikingly, the Mgm1 tetramer fits the STA volume with only minor positional domain rearrangements (Fig. 4b, Extended Data Fig. 6a, c, e). The G domain was in a closed conformation relative to the BSE domain and located furthest from the membrane, the stalk was in the middle, and the paddle was next to the membrane. The Mgm1 coat in Fig. 4b-c can be viewed as a left-handed four-start helix, consisting of four parallel helical filaments (Extended Data Fig. 7a, b). Similar filaments were observed on Folch lipid tubes of different diameter, although their helical parameters varied (Extended Data Fig. 5d). The filament backbone was formed by stalks oligomerising in an alternating fashion via interfaces-1 and 2. This contrasts with dynamin filaments, where the stalks oligomerise via three interfaces (Extended Data Fig. 2e)22, 23. As another difference to dynamin22, we did not observe G domain interactions between adjacent helix turns. Instead, contact was established through the paddle domains (Fig. 4b, c, Extended Data Fig. 6a). Mutations of the conserved residues F779 and S780 in the paddle contact site affected membrane binding and stimulated GTPase activity only mildly (Extended Data Fig. 3a, d). Expression of the corresponding Mgm1 mutant in yeast complemented the loss of endogenous Mgm1 with respect to respiratory growth, but the cells exhibited moderate alterations of mitochondrial morphology and mitochondrial genome maintenance (Extended Data Fig. 4d, f, g).
The tendency for Mgm1 to form a left-handed helix on the convex exterior of membrane tubes is consistent with the curvature of the crystallographic tetramer that arises from the interaction of interface-1. A model in which several dimers are connected via identical interfaces-1 results in a continuous filament with dimensions and helix parameters (radius, pitch) similar to those observed by cryo-ET (Extended Data Fig. 7b, c). Microsecond-scale molecular dynamics simulations (MD) starting from the crystallographic tetramer provide further evidence for the curvature preference of the Mgm1 interface-1 (Extended Data Fig. 7d-k). The most likely curvature and twist in the simulated interface-1 was the same as in the crystal lattice. The simulation results suggested sufficient flexibility to account for variability in the radii of tubes decorated on the outer membrane surface.
We followed the dynamics of Mgm1 assembly on the membrane by live fluorescence confocal imaging. By manipulating streptavidin beads adhering to giant unilamellar vesicles (GUVs) with optical tweezers24, membrane tubes can be pulled out of the GUV in a controlled manner. Mgm1 was then injected into the chamber with a second pipette (Fig. 4d).
Consistent with cryo-ET and negative-stain EM results, Mgm1 adapted to different degrees of membrane curvature by decorating the outer surface of the membrane tube and the GUV. GTP addition after assembly did not result in membrane scission under these conditions, but the force required to hold the tube in place (measured as a function of bead displacement) increased by a factor of 3 to 5. This is consistent with a GTP-dependent structural rearrangement of the Mgm1 coat and/or a GTP-dependent expansion of the membrane tube (Extended Data Fig. 8a, b).
Cryo-ET analysis revealed that Mgm1 occasionally decorated the inside surface of Folch membrane tubes in a regular pattern, suggesting that the liposomes were leaky (Fig. 5a, Extended Data Fig. 5e). In further experiments, liposomes were sonicated for a few seconds after adding Mgm1 to promote formation of the internal lattice. Tubes with an internal lattice were much wider and less variable in diameter (range 90-105 nm) (Extended Data Fig. 5e). The negative (concave) membrane curvature on the inner surface of a larger tube resembles the inside of mitochondrial cristae. Subtomogram averages of Mgm1 decorating the inner vesicle surface were obtained for the nucleotide-free and GTPγS-bound form (Fig. 5, Extended Data Fig. 5f, g, Extended Data Table 1). At an estimated resolution of 20.6 Å for the nucleotide-free and 18.8 Å for the nucleotide-bound form, the STA volumes appeared very similar.
As in the external lattice, the crystallographic Mgm1 tetramer fitted the STA volume of the internal lattice with only minor rearrangements (Fig. 5a, b, Extended Data Fig. 6b, d, e). The G domains were furthest from the membrane facing into the tube, the stalk was in the middle and the paddle domain was next to the membrane. The arrangement of tetramers on the internal lattice differed markedly from that on the external membrane surface (Fig. 5a, b, Extended Data Fig. 6a-e). Rather than through interface-1, assembly involved a contact between neighbouring tetramers that included conserved patches in the BSE and stalk domains, closely resembling the linear arrangement of tetramers in the crystal lattice (Extended Data Fig. 6f). The angle between filaments of Mgm1 tetramers and the plane perpendicular to the tube axis was 69°, whereas it was 21° in the external lattice (Fig. 5b, Extended Data Fig. 6a, b). As another major difference to the external lattice, G domains were in close contact, and their orientation indicated that they interacted though the G interface. This G domain contact was enabled by the opening of interface-1, even though the G domain/BSE remained closed. As in Mgm1 filaments on the outer membrane surface, the paddle domains contributed to lattice formation.
To probe Mgm1 assembly on negatively curved membrane surfaces, streptavidin beads were pulled inside a GUV (Fig. 5c). In this situation, Mgm1 assembled preferentially at the funnel-shaped connection between the tube and the GUV and then grew further into the tube. Mgm1 did not redistribute on the membrane in the presence of GTP (Extended Data Fig. 8c). However, as with the positively curved (convex) membranes, the force on the tube increased in a GTP-dependent manner (Extended Data Fig. 8d). Together with the cryo-ET results, these experiments demonstrate conclusively that Mgm1 can form stable assemblies on negatively curved membranes.
Our study reveals the structural basis of Mgm1 assembly via the stalks into dimers, tetramers and helical filaments. Dynamin17, 18, 22, dynamin-like MxA25 and DNM1L26, 27 are likewise known to oligomerise via their stalks into helical filaments, although important parameters of the assembly mode differ (Extended Data Fig. 2e). In dynamin, the G domains of adjacent turns transiently dimerise and mediate a GTPase-dependent power stroke19, 28, which is thought to pull the filament turns against each other29, 30. We propose that Mgm1 may undergo a similar power stroke: (1) The G/BSE domains in Mgm1 and dynamins are virtually identical; (2) the mechanisms of membrane-stimulated GTPase activity are similar; (3) G domains in our cryo-ET reconstructions are closely apposed; (4) a GTP-dependent force was observed in the tube-pulling assays; and (5) temperature-sensitive mutations in Mgm1 localise to one of the GTP-binding loops (switch I), the G/BSE domain interface or the assembly interface-110 (Extended Data Fig. 1d). Furthermore, the GTPase activity of OPA1 is required to sustain cristae morphology14.
A dynamin-like power stroke would result in different remodelling processes depending on the assembly geometry of the Mgm1 filaments. When assembled on positively curved membranes in a left-handed helical pattern (Fig. 4), a dynamin-like power stroke would expand the diameter of the lipid tube. Conversely, a right-handed helix pattern would result in constriction as observed in dynamin (Extended Data Fig. 9a, b, Supplementary Video 1).
Mgm1 is the only known member of the dynamin superfamily that can assemble on the inside of membrane tubes, a membrane geometry similar to that of mitochondrial inner membrane cristae. We postulate that Mgm1 can form helical filaments at the inside of membrane tubes with the shape and dimensions of crista junctions (Extended Data Fig. 9c). Importantly, a power stroke in a left-handed helical assembly on the inside of membrane tube would constrict its diameter, as observed for the crista junctions upon OPA1 overexpression14, whereas a right-handed assembly would expand it (Extended Data Fig. 9a, b, Supplementary Video 1). In Extended Data Fig. 9e-h, we suggest how the membrane geometry of different filament assemblies might explain IM fusion, scission or stabilisation of cristae.
Taken together, our structural and functional studies reveal the molecular basis of Mgm1 assembly into filaments and models of how the rearrangements of these filaments induces remodelling of the inner mitochondrial membrane.
Methods
Protein expression and purification
Chaetomium thermophilum Mgm1 (Mgm1, amino acids 219-912) and indicated mutants of this construct were expressed from pET46-EK/LIC (Novagen) as N- terminal His6-tag fusion followed by a PreScission cleavage site. Proteins were expressed in Escherichia coli host strain BL21-DE3, and bacteria were cultured TB medium at 37 °C followed by induction with 200 μM Isopropyl-β-D-thiogalactopyranoside (IPTG) and a temperature shift to 20 °C for overnight expression. Seleno-methionine (SeMet) substituted Mgm1 was expressed in M9 minimal medium, supplemented with L-amino acids Lys, Phe, Thr (100 mg/l), Ile, Leu, Val, SeMet (50 mg/l), using the same vector and host strain as for native protein expression31. Cells were resuspended in buffer A (25 mM HEPES/NaOH (pH 7.8), 350 mM NaCl, 150 mM KCl, 2 mM MgC12, 1 μM DNase (Roche), 500 μM Pefabloc (Roth) and disrupted by a microfluidizer (Microfluidics). Cleared lysates (95,000 x g, 1 h, 4 °C) were incubated with Benzonase (Novagen) for at least 30 min at 4 °C prior to application to a Co2+-Talon column (Clontech). Protein were eluted with buffer A containing additional 100 mM imidazole. Fractions containing Mgm1 were incubated with 2.4 mM beta-mercaptoethanol (BME) and His6-tagged Prescission protease overnight at 4 °C. Using 50 kD molecular weight cut-off concentrators (Amicon), imidazole, BME and the free His-tag were removed by washing with buffer A, before a second application to a Co2+-Talon column to remove non-cleaved His-tagged Mgm1 and protease. The flow- through and four column volumes of washing buffer A were collected and concentrated. Finally, Mgm1 was purified by size exclusion chromatography on a Superdex200 column (GE) in buffer A. Fractions containing Mgm1 were pooled, concentrated and flash-frozen in liquid nitrogen (Extended Data Fig. 1a). SeMet substituted protein and mutants were purified using the same protocol.
Crystallisation and structure determination
Crystallisation trials by the sitting-drop vapour-diffusion method were performed at 4 °C using a Gryphon pipetting robot (Art Robbins Instruments) and Rock Imager storage system (Formulatrix). 300 nl of the seleno-methionine substituted Mgm1 at a concentration of 12.9 mg/ml was mixed with an equal volume of reservoir solution containing 8% PEG400, 3% isopropanol, 100 mM Na-citrate buffer (pH 5.5). Crystals appeared after 2 weeks and had final dimensions of 500 μM x 200 μM x 50 μM. During flash-cooling of the crystals in liquid nitrogen, a cryo-solution containing additionally 20% ethylene glycol was used. The dataset was recorded at BL14.1 at BESSY II, Berlin. One native dataset was collected at wavelength 0.9794 Å and 100 K temperature from a single crystal and processed and scaled using the XDS program suite32, 33. 22 out of 26 Se sites were detected by Autosol/PHENIX34 for 2 molecules in the asymmetric unit (80% solvent content). The density showed a continuous trace for the peptide backbone and clear anomalous signals for the positions of the seleno-methionine side chains. The initial model was built by adapting the BSE and stalk domain from the human dynamin 3 structure (5A3F) to the density. For chain A, the nucleotide-free G domain of human dynamin 1 (2AKA) fitted the density well, whereas density for the G domain of chain B was weak. The G domain was therefore omitted in the initial chain B model. The density for L2S and paddle showed well-ordered loop regions and helices. Missing residues in this area were built guided by the anomalous signal of the seleno-methionine side chains. The model was built using COOT35 and iteratively refined with Phenix 1.11.1-257536 including Hendrickson-Lattman coefficients, non-crystallographic symmetries of the respective domains, secondary structure restraints, one TLS group per domain and one B factor per amino acid. Occupancy of side chains with significant radiation damage was reduced to 0.8 or 0.6 for surface exposed glutamate or aspartate residues, and to 0.8 or 0.5 for seleno-methionine residues. Finally, the G domain from chain A was transplanted to chain B and refined as a rigid body. Two ethylene glycol molecules were built into remaining difference density at the end of the refinement. 1252 residues of 1304 refined residues (96%) are in the most favoured regions of the Ramachandran plot and 3 residues in the disallowed regions (0.23%), as analysed with Phenix. Buried surface areas were calculated using the PISA server37. Domain superpositions were performed with lsqkab from the CCP4 program suite38. Figures were prepared with the PyMol Molecular Graphics System, Version 2.0 (Schrödinger, LLC.). Sequences were aligned using CLUSTAL W39 and adjusted by hand.
Analytical ultracentrifugation experiments
All measurements were performed in 25 mM HEPES/NaOH pH 7.8, 50 mM NaCl, 150 mM KCl, 1 mM MgC12 at 20 °C using an Optima XL-A centrifuge (Beckman, Palo Alto, CA) and an An50Ti rotor equipped with double sector cells. Depending on protein concentration, the distribution of the protein in the cell was monitored at 230 or 280 nm. Data were analysed using the software SedFit40. Sedimentation velocity was run at 40,000 rpm for 3 h, sedimentation equilibrium was performed at 8,000 rpm.
Liposome co-sedimentation assays
Liposomes were prepared as previously described (www. endocytosis.org). 0.6 mg/ml Folch liposomes (total bovine brain lipids fraction I from Sigma) in 25 mM HEPES/NaOH (pH 7.8), 60 mM NaCl, 100 mM KCl, 0.5 mM MgC12 were incubated at room temperature with 4 μM of the indicated Mgm1 construct for 10 min in 40 μ1reaction volume, followed by a 210,000 x g spin for 10 min at 20 °C and SDS-PAGE analysis of the supernatant and the pellet. For quantification, the protein bands were integrated using ImageJ and the intensity of each band (supernatant or pellet) was divided by the sum of the intensities from supernatant and pellet.
Isothermal titration calorimetry
ITC experiments were performed at 18 °C in a PEAQ-ITC (Malvern) in 20 mM HEPES/NaOH pH 7.5, 60 mM NaCl, 100 mM KCL, 0.5 mM MgC12, with 50 μM Mgm1 in the reaction chamber and 1 mM GTPγS in the syringe. Malvern software was used to integrate the binding isotherms and calculate the binding parameters.
GTP hydrolysis assay
GTPase activities of 1 μM of the indicated Mgm1 constructs were determined at 37 °C in 25 mM HEPES/NaOH (pH 7.8), 60 mM NaCl, 100 mM KCl, 0.5 mM MgC12, in the absence and presence of 0.1 mg/ml Folch liposomes, using saturating concentrations of GTP as substrate (1 mM for the basal and 3 mM for the stimulated reactions). Reactions were initiated by the addition of protein to the reaction. At different time points, reaction aliquots were diluted 15-fold with GTPase buffer and quickly frozen in liquid nitrogen. Samples were analysed with an HPLC system (Agilent Technologies). Denatured proteins were adsorbed to a C18 guard column and nucleotides were separated via a reversed-phase Hypersil ODS-2 C18 column (250 x 4 mm), with 10 mM tetrabutylammonium bromide, 100 mM potassium phosphate (pH 6.5), 7.5% acetonitrile as running buffer. Nucleotides were detected by absorption at 254 nm and quantified by integration of the corresponding peaks. Rates were derived from a linear fit to the initial reaction.
Negative-stain electron microscopy
For electron microscopy of negatively stained samples in a Zeiss EM910, 4 μM Mgm1 (amino acids 219-912) in 25 mM HEPES-NaOH (pH 7.8), 60 mM NaCl, 100 mM KCl, 0.5 mM MgC12 and 3 mM guanosine-5'-[(β,γ)-methyleno]triphosphate were incubated at room temperature for 10 min. The final concentration of unfiltered Folch liposomes was 0.6 mg/ml. Samples were incubated on carbon-coated copper grids (Plano GmbH, Wetzlar, Germany) and stained with 2% uranyl acetate.
Yeast growth assay
To test the ability of mutant Mgm1 variants to complement the loss of wild-type Mgm1 in yeast (Saccharomyces cerevisiae), a GAL1 promoter was inserted upstream of the MGM1 open reading frame by homologous recombination. To this end, the GAL1 promoter was amplified from pFA6a-kanMX6 -PGAL141 (using oligos MGM1-PGAL-FW CATCCCAAGAGTGGCGAACTATAACACATTAGTAAGGATGgaattcgagctcgtttaaac and MGM1-PGAL-REV GCTGTCTTCTCAGAATTAAAAGCCGTACTGGGCTCGCATT cattttgagatccgggtttt42) and transformed into the YPH499 wild-type strain43. Mutations were introduced into pRS414 -Mgm144 by site-directed mutagenesis. The PGAL1-MGM1 yeast strain was transformed with the empty vector pRS414 or pRS414-Mgm1 encoding wild-type Mgm1 or mutant variants. After selection on synthetic defined (-TRP) media (0.67% [w/v] YNB without amino acids [BD Difco], – TRP amino acid drop-out mix [MP Biomedicals]) containing 2% [w/v] galactose and 1% [w/v] raffinose), yeast were grown in media containing 2% [w/v] glucose as carbon source to suppress expression of the endogenous wild-type Mgm1 allele. Under these conditions, cells expressing no or non-functional Mgm1 rapidly lose mitochondrial DNA6. Subsequently, cultures were diluted in media containing 0.2% [w/v] glucose in 48-well microtiter plates and growth was monitored for 24 h at 30 °C using a Tecan Spark 10M microplate reader by measuring the absorbance at 600 nm every 5 min after a 10 s linear shake with an amplitude of 2.5 mm at 630 rpm. Between cycles, the plate was agitated in a double-orbital shaker with an amplitude of 1.5 mm at 180 rpm. Blank-corrected mean absorbance values from two or three wells per mutant strain were plotted using GraphPad Prism 6.0 and growth experiments were repeated with cell populations from three independent yeast transformations.
To test for dominant-negative effects of Mgm1 mutants, the wild-type strain YPH499 was transformed with pRS414-Mgm1 encoding wild-type or mutant Mgm1 and growth was assessed in synthetic defined medium containing 3% [v/v] glycerol as described above. To test whether Mgm1 variants are stably expressed in yeast cells and able to retain mitochondrial DNA, mitochondria were isolated on a small scale45 and analysed by SDS-PAGE and Western blotting using antibodies directed against Mgm1, Cox1 (mitochondrially encoded cytochrome c oxidase subunit 1) and Ssc1 (mitochondrial Hsp70, loading control).
Yeast microscopy
Yeast cells were grown in synthetic defined (-TRP) media containing either 2% [w/v] glucose (for PGAL1-MGM1 yeast strains expressing plasmid-borne Mgm1 variants) or 3% [v/v] glycerol (for dominant-negative mutant strains) to mid-logarithmic phase and stained with 0.5 μg/ml DAPI (4',6-diamidino-2-phenylindole) and 175 nM DiOC6 (3,3'-dihexyloxacarbocyanine iodide) in 5% [w/v] glucose, 10 mM HEPES (pH 7.2). Immediately after staining, Z-stacks were recorded on a Leica DMi8 fluorescent microscope with a 63x/1.40 objective and a Leica DFC3000 G CCD camera. Images were deconvoluted with Huygens Essential (Scientific Volume Imaging, The Netherlands, http://svi.nl) and maximum intensity projections were created in Fiji46. Contrast was adjusted linearly to correct for variations in DiOC6 uptake. For quantification of mitochondrial morphology, cells with tubular or fragmented mitochondrial networks were counted in images from three independent cultures (for each culture at least 70 cells were counted). WT p0 cells were generated by ethidium bromide treatment of p+ cells.
Electron microscopy of yeast mitochondria
Yeast cells were fixed for 3h with 4% (w/v) paraformaldehyde, 0.5% (v/v) glutaraldehyde in 0.1M citrate buffer (pH and temperature adjusted to growth conditions). Samples were treated with 1% (w/v) sodium metaperiodate for 1 h at room temperature. Yeast cells were embedded in 10% (w/v) gelatin, infiltrated with 2.3M sucrose and frozen in liquid nitrogen. Ultrathin sections were cut at -115 °C (Reichert Ultracut S, Leica) and collected on 200 mesh copper grids (Plano) coated with formvar and carbon. Sections were stained with 3% (w/v) tungstosilicic acid hydrate in 2.5% (w/v) polyvinyl alcohol. Samples were examined at 80 kV with a Zeiss EM 910 electron microscope (Zeiss), and images were recorded with a Quemesa CDD camera and the iTEM software (Emsis GmbH). Images were analysed by ImageJ/Fiji. All applied statistical test were calculated with Prism (GraphPad software). Normality distribution test (Kolmogorov-Smirnov test) was carried out for all experimental values, and with normally distributed data, a Student t-Test (two-tailed P-value) was applied, otherwise the Mann-Withney-Rank-Sum (twotailed P-value) test was used to calculate the significant difference between two groups.
Liposome preparation for electron cryo-tomography
For examining Mgm1 assembly on membranes by electron cryo-tomography, dried lipids were rehydrated to a final concentration of 3 mg/ml in liposome buffer (20 mM HEPES, pH 7.5, 150 mM NaCl). Folch lipids (brain extract from bovine brain, type I, fraction I, Sigma-Aldrich) were used for inside decoration, or a lipid mixture of 70% galactocerebroside47, 10% cardiolipin (both Sigma-Aldrich) and 20% DOPC (Avanti Polar Lipids) for outside decoration of tubes. Liposomes were prepared by sonication plus extrusion through a 1 μm polycarbonate filter. Rehydrated lipids were incubated with purified Mgm1 (final concentration 10 μM) for 30 minutes at room temperature in the absence or presence of GTPγS (final concentration 1 mM, Jena Bioscience GmbH, Jena, Germany). For inside decoration, Mgm1 (+/- nucleotide) was added prior to the liposome preparation step.
Grid preparation and image acquisition for electron cryotomography
The final sample was mixed 1:1 with colloidal gold fiducial markers and 3 μ1were applied to freshly glow-discharged R2/2 Cu 300-mesh holey carbon-coated support grids (Quantifoil Micro Tools, Jena, Germany). Grids were plunge-frozen using a Vitrobot Mark IV plunge-freezer at 100% humidity and 10°C. Samples were imaged in a FEI Titan Krios electron microscope (FEI Company, Hillsboro, OR) operating at 300 kV, equipped with a K2 summit direct electron detector and Quantum energy filter (Gatan, Inc., Pleasanton, CA). The nominal magnification was set to 53,000x, yielding a calibrated pixel size of 2.7 Å. Tomographic tilt series were acquired following a dose-symmetric tilting scheme48 with a 3° increment and a cumulative total electron dose of approximately 90 e/Å2. Defocus values ranged from -2.0 to -4.0 |j,m. Data were acquired with the SerialEM software package49 in dose-fractionation mode.
Tomogram reconstruction and subtomogram averaging
Dosefractionated movies of tomograms were aligned using either Unblur50 or MotionCor251. After CTF-correction images were combined to generate a raw image stack that was used as input for generating tomograms with IMOD. Single tilt-images were aligned by gold fiducial markers and volumes reconstructed by weighted back-projection. Particle extraction, alignment and subtomogram averaging were performed with Dynamo52 and MATLAB. For a whole tube, particles were picked along the filaments using the respective option in the Dynamo toolbox. 18 membrane tubes covered with a clear visible protein coat within 15 different tomograms and 10 tubes within 10 tomograms were used for processing for the apo form and the GTPγS bound form, respectively. Due to the differences in diameter of the inside decoration, only two membrane tubes in two individual tomograms were used for the apo form as well as the GTPγS bound state. For close-up views, tubes were sub-boxed along the helical pattern. For tubes decorated on the inside, particles were picked along the wall of the lipid tube. Before subtomogram averaging, the datasets was divided into two independent half sets for resolution estimation. Each half set was aligned to an independent reference generated from a subset of each half set and reference-free alignment. To address the possibility of different handedness, classification was done during the processing workflow. Only protein assemblies with a left-handed helical pattern were observed. To exclude that the left-handed arrangement of the outside decoration was driven by the preformed lipid tubes, subtomogram averaging of Mgm1 covering the outside of Folch lipid tubes of different diameter was done. Also in this case, only protein assemblies with a left-handed helical pattern were observed. Numbers of particles contributing to the converged averages of the main structures and final resolution from FSC curves are listed in Extended Data Table. 2. The final structures were obtained using relion_reconstruct from the Relion toolbox. USCF Chimera and MATLAB were used for structure and FSC curve display, respectively53.
Molecular dynamics simulations
Flexible fitting into cryo-ET volume: A general approach for building atomic models from cryo-ET reconstructions is to include a potential energy term coupling the atomic coordinates during a molecular simulation to the experimentally determined density. Here, we used the MDfit method54, which employs an all-atom structure-based model (SBM)55 based on the tetramer crystal structure, and additionally includes an energetic term that attempts to maximise the correlation between the experimental density and the simulated density of the molecular dynamics trajectory. The SBM has an explicit energy minimum at the tetramer crystal structure, which means that the secondary structure seen in the crystal is maintained during flexible fitting. Modified Gromacs source code containing MDfit and software for creating the all-atom structure-based topologies are available for download at http://smog-server.org 55. Default MDfit parameters were used, including setting the energetic weight of the map equal to the number of atoms. For both the inner and outer decoration, the initial configuration was generated by manually placing twelve tetramers (247,728 heavy atoms) into and surrounding the cryo-ET volume with the aid of the “Fit in Map” tool in Chimera53. Simulations were performed until the cross-correlation stabilised. Only the dimers that were completely within the cryo-ET volume were saved for deposition alongside the cryo-ET volume. After fitting the inner decoration, G domains appeared to be in contact. This was checked by strongly constraining the G domains to form the G interface (as in dynamin). The fit including the constraint was nearly identical to that without, suggesting that the cryo-ET for the inner decoration contains the canonical G interface. The submitted model includes the constraint.
All-atom MD to support the “pre-shaped” tetramer and characterise its flexibility: A 2.6 microsecond all-atom molecular dynamics simulation of a stalk tetramer in explicit solvent was performed to estimate its shape in the absence of crystal interactions. The simulation was initialised from the tetramer crystal structure with a closed interface-1 and contained for each monomer the four stalk helices (residues 549-590, 635-720, and 828-877). Two G-G-S-G-G linkers were used to connect breaks in the stalk where the paddle was cut out, creating a single chain for each stalk monomer. Simulations were performed with Acellera ACEMD56 using the CHARMM36 forcefield57. Details of the simulation are as follows: NPT ensemble, temperature 300K, Langevin thermostat, Berendsen barostat at 1 atm, restrained bonds, timestep 4 fs, PME electrostatics, grid spacing 1 Å, cutoff 9 Å, switching at 7.5 Å. The conformation of the stalk tetramer was analysed to estimate the structural preference and flexibility of a stalk filament containing the tetramer. See Extended Data Fig. 7 for details.
All-atom structure-based model for inner decoration of 1-start helix: Our aim was to determine the tetramer structure upon confinement in a filament decorating the interior of a narrow membrane tube (r=30 nm) with a small pitch (p=12 nm). In particular, we were interested whether the crystallographic interfaces 1/2 can be consistent with negatively curved geometries. To this end, a molecular dynamics simulation was performed on a short filament (octamer) using a simplified potential that includes the all-atom geometry. Three constraints were imposed: 1) the putative membrane binding residues R748 and K749 in each monomer were constrained to a 30 nm radius from the z-axis, 2) an impenetrable cylindrical wall was imposed with a 30 nm radius, 3) the z coordinate of the centres of mass of each dimer (interface-2) were constrained such that the short filament had an effective pitch of 12 nm. No restraints were introduced in interface-1. The simulation potential was an all-atom structure-based model using the tetramer crystal structure with interface-1 formed. The simulation topology for Gromacs58 was created using the tetramer crystal and SMOG2.1 with the default forcefield “SBM_AA”55. The octamer topology was created by merging two tetramer topologies and additionally copying the requisite pair interactions for the new interface-1 created by connecting the tetramers. Langevin dynamics with a low temperature (0.16 reduced units, 20K Gromacs temperature) for 10x106 steps was used to get near to the minimum energy subject to the constraints. A steepest-descent minimisation was used for the final analysed configuration. To minimize edge effects, the interior tetramer of the octamer filament was analysed.
Tube pulling assays
Mgm1 was labelled with a fluorescein-labelled peptide using a sortase-mediated reaction59. All lipids were purchased from Avanti Polar Lipids, Alabaster, AL, USA. Giant Unilamellar Vesicles (GUVs) were electroformed24 from a lipid mix (2 mg/ml) containing Di-Oleyl-Phosphatidylcholine (DOPC), Di-Oleyl-Phosphatidylserine (DOPS), Rhodamine-phosphatidylethanolamine (Rhod-PE) and Di-Sialyl-Phosphatidylserine-Poly-ethylene-glycol-2000-biotin (DSPE-PEG(2000)Biotin), at a ratio of 7:3:0.01:0.003. GUVs were then transferred to a microscopy chamber of two rectangular glass slides (11x35 mm) and mounted on an inverted microscope including a Nikon eclipse Ti base, a CSU-X1 confocal system (Nikon, Tokyo, Japan), an Andor Ixon EMCCD camera (Oxford Instruments, Abingdon-on-Thames, UK) and a homemade optical tweezers consisting of a 5 W 1064 nm laser (ML5-CW-P-TKS-OTS, Manlight, Lannion, France) focused through a 100 x 1.3 NA oil objective. Images were acquired using SlideBook software (Intelligent Imaging Innovation). Bead traces were acquired with a C-MOS Camera (Picelink, Ottowa, Canada) using custom-made software. Outward membrane nanotubes were formed by holding a 3.05 μM streptavidin-coated polystyrene bead (Spherotech, Lake Forrest, IL, USA) glued onto a GUVs with optical tweezers, while pulling away the GUVs held by aspiration with a hand micropipette and controlled with motorised micromanipulators (MP-285, Sutter Instrument, Novato, CA, USA). Subsequently, Mgm1 was diluted to 3 μM final concentration in 20 mM HEPES/NaOH pH 7.4, 200 mM NaCl and 1 mM MgC12, and injected in the vicinity of the membrane tube using a second micropipette connected to a pressure control system (MFCS-VAC -69 mbar, Fluigent, Le Kremlin-Bicétre, France). For pulling membrane nanotubes inward, 2.01 μM glass beads (Bangs Laboratories, Fishers, IN, USA) were internalised with optical tweezers into GUVs adhering to an Avidin-coated flow chamber (coverslip and sticky-Slide VI 0.4, Ibidi, Germany). Tubes were pulled by moving the stage, and thus the GUV. 3 μM Mgm1 were added with a syringe pump (Aladdin, World Precision Instruments) connected to the Ibidi flow chamber. The force F was determined by applying Hooke’s law F= k*Δx to the bead displacement Δx and trap stiffness k (3.05 μM beads: k=79 pN/nm; 2.01 μM beads: k= 75 pN/nm). The basis of inward pulled tubes was unstable and moved on the surface of the GUV, so that the projection on the bead displacement in the X and Y axes changed rapidly. Furthermore, since the beads were pre-endocytosed into the GUVs, the initial position of the bead without force was unknown, compared to the outward tube pulling assay, where the bead position was recorded before it became attached to the GUV. Therefore, ΔF instead of F was plotted as it is more reliable. In Extended Data Fig. 8d, 6 μM Mgm1 was added to increase protein polymerization and therefore the force generated. In experiments requiring GTP, the buffer was supplemented with 2 mM GTP. The following settings were applied for Fig. 4c, Extended Data Fig. 8a, b: resolution: 512x512x10s, 145 nm/pxl, 16 bit; fluorochromes: Fluorescein (excitation: 488 nm, Bandpass filter 520/50, Dichroic Beamsplitter 405/488/568/647; LUT: Green (Fiji)) Rhodamine B (excitation: 561 nm, Bandpass filter 607/30, Dichroic Beamsplitter 405/488/568/647; LUT: Red (Fiji)); experiments were performed at room temperature in 20 mM HEPES/NaOH pH 7.4, 200 mM NaCl, 1 mM MgC12. For Fig. 5c, Extended Data Fig. 8c-d: resolution: 512x512x30s, 145 nm/pxl, 16 bit; fluorochromes and experimental conditions as above.
Extended Data
Extended Data Table 1. Data collection and refinement statistics.
a Crystallographic data | |
---|---|
Mgm1, SeMet pdb code 6QL4 | |
Data collection | |
Space group | P4122, 1 dimer/ ASU |
Cell dimensions | |
a, b, c (Å) | 147.4, 147.4, 344.7 |
α, β, γ (°) | 90, 90, 90 |
Wavelength | 0.9794 (Å) |
Resolution (Å)* | 3.60 (3.60-3.69) |
Rsym* (%) | 22.0(184) |
I / σI* | 8.0(1.1) |
Completeness (%)* | 99.8 (98.4) |
Redundancy | 6.7 |
Refinement | |
Resolution (Å) | 49.1 -3.6 |
No. reflections | 44,814 |
Rwork / Rfree | 24.4 / 125.2 |
No. atoms | |
Protein | 10,332 |
Ligand/ion | 2 |
Water | 0 |
B-factors | |
Protein | 212 Å2 |
Ligand/ion | 101 Å2 |
Water | - |
R.m.s deviations | |
Bond lengths (Å) | 0.004 |
Bond angles (°) | 0.986 |
b, Cryo-ET data | |||||
---|---|---|---|---|---|
Mgm1 +GTPγS Outside (EMDB-4585) |
Apo Mgm1 Outside (EMDB-4582) |
Apo Mgm1 Outside overall tube (EMDB-4584) |
Mgm1 +GTPγS Inside (EMDB-4586) |
Apo Mgm1 Inside (EMDB-4583) |
|
Data collection and processing | |||||
Magnification | 53,000 | 53,000 | 53,000 | 53,000 | 53,000 |
Voltage(kV) | 300 | 300 | 300 | 300 | 300 |
Electron exposure (e-/ (Å)2) | 90 – 100 | 90 – 100 | 90 – 100 | 90 – 100 | 90 – 100 |
Per tomogram | |||||
Defocus range (μm) | 2 - 4 | 2 - 4 | 2 - 4 | 2 - 4 | 2 - 4 |
Pixel size (Å) | 2.7 | 2.7 | 2.7 | 2.7 | 2.7 |
Symmetry imposed | No | No | No | No | No |
Initial particle images (no.) | 71,884 | 12,440 | 2,214 | 4,751 | 1,874 |
Final particle images (no.) | 9,471 | 11,474 | 1,677 | 1,820 | 1,792 |
Map resolution (Å) | 14.7 | 14.7 | 20.4 | 18.8 | 20.6 |
FSC threshold | 0.143 | 0.143 | 0.143 | 0.143 | 0.143 |
Supplementary Material
Acknowledgements
This project was supported by ERC grants MitoShape (ERC-2013-CoG-616024 to O.D.) and ScaleCell (ERC-CoG-772230 to F.N.), grants from the Deutsche Forschungsgemeinschaft (SFB958/A12 and SFB740/C07 to O.D. SFB958/A04 and SFB740/D07 to F.N., SFB894/A20 to M.v.d.L., IRTG1830 to M.v.d.L. and F.W., SFB807 to R.S.), the Max Planck Society, a Humboldt fellowship to J.N., a pre-doctoral fellowship of the Boehringer Ingelheim Fonds to F.W., a Sofja Kovalevskaja Award from the Alexander von Humboldt Foundation to M.K., and a DOC Fellowship of the Austrian Academy of Sciences to M.H.. We thank Yvette Roske for help with crystallographic data collection, structure solution and ITC measurements, Tobias Brandt for help and assistance in preparing cryo-EM samples, Deryck Mills for cryo-EM maintenance, Bettina Purfürst for support in the negative-stain EM analyses, Tobias Bock-Bierbaum for helpful comments on the manuscript, Erik Werner from Research Network Services Ltd., Berlin, Germany, for his careful work on the videos, Audrey Xavier for help with Mgm1 fluorescence labelling, and the entire BESSY team for generous support during data collection at beamlines BL14.1, BL14.2 or BL14.3.
Footnotes
Author contributions. K.F. designed the construct, grew the crystals and solved the structure. L.D. determined the cryo-ET reconstructions with support of A.M., R.S and M.K.; J.N. and. F.N. conducted and analysed molecular modelling and molecular dynamics simulations, F.W. and A.v.d.M performed yeast-growth assays and A.-K. P. the tube-pulling assay together with N.C.; J.N., F.W. and A.-K. P. contributed equally to this study. J.S. purified the protein and J.S. and K.F. carried out the liposome co-sedimentation and GTPase assays, H.L. performed the AUC assays. E. R. and M. H. grew initial crystals of related Mgm1 constructs; C.M. and S.K. analysed yeast mitochondria using EM; K.F., L.D., J.N., C.M., A.R., M.v.d.L., W.K. and O.D. designed research and interpreted structural data. K.F., L.D., J.N., M.v.d.L., W.K. and O.D. wrote the manuscript.
Competing interests. The authors declare no competing financial or non-financial interest.
Additional information.
Extended data is available for this paper.
Supplementary information is available for this paper.
Reprints and permission information is available at npg.nature.com/reprintsandpermissions.
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Data availability
The atomic coordinates of Mgm1 have been deposited in the Protein Data Bank with accession number 6QL4. Maps obtained by subtomogram averaging were deposited in the Electron Microscopy Data Bank with accession number EMD-4582, EMD-4584 for nucleotide-free Mgm1 on the outside of lipid tubes in a close-up view and the overall tube structure, respectively. EMD-4585 shows Mgm1 on the outside of a lipid tube in the GTPγS bound state. EMD-4583, EMD-4586 shows Mgm1 decorating the inside of a tube without and with GTPγS, respectively. All source data associated with the paper (beyond those deposited) are provided as supplementary information.
References
- 1.Nunnari J, Suomalainen A. Mitochondria: in sickness and in health. Cell. 2012;148:1145–1159. doi: 10.1016/j.cell.2012.02.035. S0092-8674(12]00235-8[pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Youle RJ, van der Bliek AM. Mitochondrial fission, fusion, and stress. Science. 2012;337:1062–1065. doi: 10.1126/science.1219855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.van der Laan M, Horvath SE, Pfanner N. Mitochondrial contact site and cristae organizing system. Curr Opin Cell Biol. 2016;41:33–42. doi: 10.1016/j.ceb.2016.03.013. [DOI] [PubMed] [Google Scholar]
- 4.Pernas L, Scorrano L. Mito-Morphosis: Mitochondrial Fusion, Fission, and Cristae Remodeling as Key Mediators of Cellular Function. Annu Rev Physiol. 2016;78:505–531. doi: 10.1146/annurev-physiol-021115-105011. [DOI] [PubMed] [Google Scholar]
- 5.Wai T, Langer T. Mitochondrial Dynamics and Metabolic Regulation. Trends Endocrinol Metab. 2016;27:105–117. doi: 10.1016/j.tem.2015.12.001. [DOI] [PubMed] [Google Scholar]
- 6.Jones BA, Fangman WL. Mitochondrial DNA maintenance in yeast requires a protein containing a region related to the GTP-binding domain of dynamin. Genes Dev. 1992;6:380–389. doi: 10.1101/gad.6.3.380. [DOI] [PubMed] [Google Scholar]
- 7.Alexander C, et al. OPA1, encoding a dynamin-related GTPase, is mutated in autosomal dominant optic atrophy linked to chromosome 3q28. Nat Genet. 2000;26:211–215. doi: 10.1038/79944. [DOI] [PubMed] [Google Scholar]
- 8.Delettre C, et al. Nuclear gene OPA1, encoding a mitochondrial dynamin-related protein, is mutated in dominant optic atrophy. Nat Genet. 2000;26:207–210. doi: 10.1038/79936. [DOI] [PubMed] [Google Scholar]
- 9.Wong ED, et al. The dynamin-related GTPase, Mgm1p, is an intermembrane space protein required for maintenance of fusion competent mitochondria. J Cell Biol. 2000;151:341–352. doi: 10.1083/jcb.151.2.341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Meeusen S, et al. Mitochondrial inner-membrane fusion and crista maintenance requires the dynamin-related GTPase Mgm1. Cell. 2006;127:383–395. doi: 10.1016/j.cell.2006.09.021. S0092- 867406012141[pii] [DOI] [PubMed] [Google Scholar]
- 11.Cipolat S, Martins de Brito O, Dal Zilio B, Scorrano L. OPA1 requires mitofusin 1 to promote mitochondrial fusion. Proc Natl Acad Sci U S A. 2004;101:15927–15932. doi: 10.1073/pnas.0407043101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ishihara N, Fujita Y, Oka T, Mihara K. Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. EMBO J. 2006;25:2966–2977. doi: 10.1038/sj.emboj.7601184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Meeusen S, McCaffery JM, Nunnari J. Mitochondrial fusion intermediates revealed in vitro. Science. 2004;305:1747–1752. doi: 10.1126/science.1100612. [DOI] [PubMed] [Google Scholar]
- 14.Frezza C, et al. OPA1 controls apoptotic cristae remodeling independently from mitochondrial fusion. Cell. 2006;126:177–189. doi: 10.1016/j.cell.2006.06.025. S009286740600810-5 [pii] [DOI] [PubMed] [Google Scholar]
- 15.Yamaguchi R, et al. Opa1-mediated cristae opening is Bax/Bak and BH3 dependent, required for apoptosis, and independent of Bak oligomerization. Mol Cell. 2008;31:557–569. doi: 10.1016/j.molcel.2008.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Anand R, et al. The i-AAA protease YME1L and OMA1 cleave OPA1 to balance mitochondrial fusion and fission. J Cell Biol. 2014;204:919–929. doi: 10.1083/jcb.201308006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Faelber K, et al. Crystal structure of nucleotide-free dynamin. Nature. 2011;477:556–560. doi: 10.1038/nature10369. nature10369 [pii] [DOI] [PubMed] [Google Scholar]
- 18.Ford MG, Jenni S, Nunnari J. The crystal structure of dynamin. Nature. 2011;477:561–566. doi: 10.1038/nature10441. nature10441 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Chappie JS, Acharya S, Leonard M, Schmid SL, Dyda FG. domain dimerization controls dynamin’s assembly-stimulated GTPase activity. Nature. 2010;465:435–440. doi: 10.1038/nature09032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ingerman E, et al. Dnml forms spirals that are structurally tailored to fit mitochondria. J Cell Biol. 2005;170:1021–1027. doi: 10.1083/jcb.200506078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ban T, Heymann JA, Song Z, Hinshaw JE, Chan DC. OPA1 disease alleles causing dominant optic atrophy have defects in cardiolipin-stimulated GTP hydrolysis and membrane tubulation. Hum Mol Genet. 2010;19:2113–2122. doi: 10.1093/hmg/ddq088. ddq088 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kong L, et al. Cryo-EM of the dynamin polymer assembled on lipid membrane. Nature. 2018;560:258–262. doi: 10.1038/s41586-018-0378-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Reubold TF, et al. Crystal structure of the dynamin tetramer. Nature. 2015;525:404–408. doi: 10.1038/nature14880. nature14880 [pii] [DOI] [PubMed] [Google Scholar]
- 24.Chiaruttini N, et al. Relaxation of Loaded ESCRT-III Spiral Springs Drives Membrane Deformation. Cell. 2015;163:866–879. doi: 10.1016/j.cell.2015.10.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gao S, et al. Structure of myxovirus resistance protein a reveals intra- and intermolecular domain interactions required for the antiviral function. Immunity. 2011;35:514–525. doi: 10.1016/j.immuni.2011.07.012. S1074-76131100369-4 [pii] [DOI] [PubMed] [Google Scholar]
- 26.Frohlich C, et al. Structural insights into oligomerization and mitochondrial remodelling of dynamin 1-like protein. EMBO J. 2013;32:1280–1292. doi: 10.1038/emboj.2013.74. emboj201374 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kalia R, et al. Structural basis of mitochondrial receptor binding and constriction by DRP1. Nature. 2018;558:401–405. doi: 10.1038/s41586-018-0211-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chappie JS, et al. A pseudoatomic model of the dynamin polymer identifies a hydrolysis-dependent powerstroke. Cell. 2011;147:209–222. doi: 10.1016/j.cell.2011.09.003. S0092-86741101015-4 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Roux A, Uyhazi K, Frost A, De Camilli P. GTP-dependent twisting of dynamin implicates constriction and tension in membrane fission. Nature. 2006;441:528–531. doi: 10.1038/nature04718. [DOI] [PubMed] [Google Scholar]
- 30.Antonny B, et al. Membrane fission by dynamin: what we know and what we need to know. EMBO J. 2016;35:2270–2284. doi: 10.15252/embj.201694613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Doublie S. Preparation of selenomethionyl proteins for phase determination. Methods Enzymol. 1997;276:523–530. [PubMed] [Google Scholar]
- 32.Kabsch W. XDS. Acta Cryst D. 2010;66:125–132. doi: 10.1107/S0907444909047337. S0907444909047337 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sparta KM, Krug M, Heinemann U, Mueller U, Weiss MS. Xdsapp2.0. J Appl Cryst. 2016;49:1085–1092. doi: 10.1107/S1600576716004416. [DOI] [Google Scholar]
- 34.Terwilliger TC, et al. Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Cryst D. 2009;65:582–601. doi: 10.1107/S0907444909012098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Cryst D. 2004;60:2126–2132. doi: 10.1107/S0907444904019158. [DOI] [PubMed] [Google Scholar]
- 36.Echols N, et al. Graphical tools for macromolecular crystallography in PHENIX. J Appl Cryst. 2012;45:581–586. doi: 10.1107/S0021889812017293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Krissinel E, Henrick K. Inference of macromolecular assemblies from crystalline state. J Mol Biol. 2007;372:774–797. doi: 10.1016/j.jmb.2007.05.022. [DOI] [PubMed] [Google Scholar]
- 38.Winn MD, et al. Overview of the CCP4 suite and current developments. Acta Cryst D. 2011;67:235–242. doi: 10.1107/s0907444910045749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Sievers F, Higgins DG. Clustal omega. Curr Protoc Bioinformatics. 2014;48:3 13 11–16. doi: 10.1002/0471250953.bi0313s48. [DOI] [PubMed] [Google Scholar]
- 40.Schuck P. Size-distribution analysis of macromolecules by sedimentation velocity ultracentrifugation and lamm equation modeling. Biophys J. 2000;78:1606–1619. doi: 10.1016/S0006-34950076713-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Longtine MS, et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 1998;14:953–961. doi: 10.1002/(SICI)1097-006(1199807)14:10<953::AID-YEA293>3.0.C0;2-U. [DOI] [PubMed] [Google Scholar]
- 42.Yofe I, Schuldiner M. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae. Yeast. 2014;31:77–80. doi: 10.1002/yea.2998. [DOI] [PubMed] [Google Scholar]
- 43.Sikorski RS, Hieter PA. system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989;122:19–27. doi: 10.1093/genetics/122.1.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Ieva R, et al. Mgr2 functions as lateral gatekeeper for preprotein sorting in the mitochondrial inner membrane. Mol Cell. 2014;56:641–652. doi: 10.1016/j.molcel.2014.10.010. [DOI] [PubMed] [Google Scholar]
- 45.Morgenstern M, et al. Definition of a High-Confidence Mitochondrial Proteome at Quantitative Scale. Cell Rep. 2017;19:2836–2852. doi: 10.1016/j.celrep.2017.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Schindelin J, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Wilson-Kubalek EM, Brown RE, Celia H, Milligan RA. Lipid nanotubes as substrates for helical crystallization of macromolecules. Proc Natl Acad Sci U S A. 1998;95:8040–8045. doi: 10.1073/pnas.95.14.8040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Hagen WJH, Wan W, Briggs JAG. Implementation of a cryo-electron tomography tilt-scheme optimized for high resolution subtomogram averaging. J Struct Biol. 2017;197:191–198. doi: 10.1016/j.jsb.2016.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Mastronarde DN. Automated electron microscope tomography using robust prediction of specimen movements. J Struct Biol. 2005;152:36–51. doi: 10.1016/j.jsb.2005.07.007. [DOI] [PubMed] [Google Scholar]
- 50.Grant T, Grigorieff N. Measuring the optimal exposure for single particle cryo-EM using a 2.6 A reconstruction of rotavirus VP6. Elife. 2015;4:e06980. doi: 10.7554/eLife.06980. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Zheng SQ, et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat Methods. 2017;14:331–332. doi: 10.1038/nmeth.4193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Castano-Diez D, Kudryashev M, Arheit M, Stahlberg H. Dynamo: a flexible, user- friendly development tool for subtomogram averaging of cryo-EM data in high- performance computing environments. J Struct Biol. 2012;178:139–151. doi: 10.1016/j.jsb.2011.12.017. [DOI] [PubMed] [Google Scholar]
- 53.Pettersen EF, et al. UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem. 2004;25:1605–1612. doi: 10.1002/jcc.20084. [DOI] [PubMed] [Google Scholar]
- 54.Whitford PC, et al. Excited states of ribosome translocation revealed through integrative molecular modeling. Proc Natl Acad Sci U S A. 2011;108:18943–18948. doi: 10.1073/pnas.1108363108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Noel JK, et al. SMOG 2: A Versatile Software Package for Generating Structure-Based Models. PLoS Comput Biol. 2016;12:e1004794. doi: 10.1371/journal.pcbi.1004794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Harvey MJ, De Fabritiis G. AceCloud: Molecular Dynamics Simulations in the Cloud. J Chem Inf Model. 2015;55:909–914. doi: 10.1021/acs.jcim.5b00086. [DOI] [PubMed] [Google Scholar]
- 57.Best RB, et al. Optimization of the additive CHARMM all-atom protein force field targeting improved sampling of the backbone phi, psi and side-chain chi 1 and chi 2 dihedral angles. J Chem Theory Comput. 2012;8:3257–3273. doi: 10.1021/ct300400x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Pronk S, et al. GROMACS 4.5: a high-throughput and highly parallel open source molecular simulation toolkit. Bioinformatics. 2013;29:845–854. doi: 10.1093/bioinformatics/btt055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Theile CS, et al. Site-specific N-terminal labeling of proteins using sortase-mediated reactions. Nat Protoc. 2013;8:1800–1807. doi: 10.1038/nprot.2013.102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Meglei G, McQuibban GA. The dynamin-related protein Mgm1p assembles into oligomers and hydrolyzes GTP to function in mitochondrial membrane fusion. Biochemistry. 2009;48:1774–1784. doi: 10.1021/bi801723d. [DOI] [PubMed] [Google Scholar]
- 61.Roux A, et al. Membrane curvature controls dynamin polymerization. Proc Natl Acad Sci U S A. 2010;107:4141–4146. doi: 10.1073/pnas.0913734107. 0913734107 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Rujiviphat J, et al. Mitochondrial Genome Maintenance 1 (Mgm1) Protein Alters Membrane Topology and Promotes Local Membrane Bending. J Mol Biol. 2015;427:2599–2609. doi: 10.1016/j.jmb.2015.03.006. [DOI] [PubMed] [Google Scholar]
- 63.Muhleip AW, et al. Helical arrays of U-shaped ATP synthase dimers form tubular cristae in ciliate mitochondria. Proc Natl Acad Sci U S A. 2016;113:8442–8447. doi: 10.1073/pnas.1525430113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Tarasenko D, et al. The MICOS component Mic60 displays a conserved membrane- bending activity that is necessary for normal cristae morphology. J Cell Biol. 2017;216:889–899. doi: 10.1083/jcb.201609046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Barbot M, et al. Mic10 oligomerizes to bend mitochondrial inner membranes at cristae junctions. Cell Metab. 2015;21:756–763. doi: 10.1016/j.cmet.2015.04.006. [DOI] [PubMed] [Google Scholar]
- 66.Bohnert M, et al. Central role of Mic10 in the mitochondrial contact site and cristae organizing system. Cell Metab. 2015;21:747–755. doi: 10.1016/j.cmet.2015.04.007. [DOI] [PubMed] [Google Scholar]
- 67.Hessenberger M, et al. Regulated membrane remodeling by Mic60 controls formation of mitochondrial crista junctions. Nature Comm. 2017;8:15258. doi: 10.1038/ncomms15258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Lee H, Smith SB, Yoon Y. The short variant of the mitochondrial dynamin OPA1 maintains mitochondrial energetics and cristae structure. J Biol Chem. 2017;292:7115–7130. doi: 10.1074/jbc.M116.762567. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The atomic coordinates of Mgm1 have been deposited in the Protein Data Bank with accession number 6QL4. Maps obtained by subtomogram averaging were deposited in the Electron Microscopy Data Bank with accession number EMD-4582, EMD-4584 for nucleotide-free Mgm1 on the outside of lipid tubes in a close-up view and the overall tube structure, respectively. EMD-4585 shows Mgm1 on the outside of a lipid tube in the GTPγS bound state. EMD-4583, EMD-4586 shows Mgm1 decorating the inside of a tube without and with GTPγS, respectively. All source data associated with the paper (beyond those deposited) are provided as supplementary information.